View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk48-12 (Length: 830)

Name: R108-tnk48-12
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk48-12
R108-tnk48-12
[»] chr8 (3 HSPs)
chr8 (104-572)||(25116309-25116777)
chr8 (1-105)||(25116179-25116283)
chr8 (753-830)||(25116106-25116183)
[»] chr4 (3 HSPs)
chr4 (632-746)||(11459938-11460052)
chr4 (632-746)||(11464920-11465034)
chr4 (569-635)||(504873-504939)
[»] chr7 (1 HSPs)
chr7 (569-635)||(6928805-6928871)
[»] chr6 (1 HSPs)
chr6 (569-635)||(14541370-14541436)
[»] chr3 (2 HSPs)
chr3 (569-635)||(53091966-53092032)
chr3 (569-603)||(53091926-53091960)


Alignment Details
Target: chr8 (Bit Score: 377; Significance: 0; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 104 - 572
Target Start/End: Original strand, 25116309 - 25116777
Alignment:
104 ataagaaaggtgatcgcgacctcattgtcgaacatcctgatccagaaattgacaaaggttcgatgagtgccaaatgagaaacgtgacgnnnnnnnggagt 203  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||       |||||    
25116309 ataagaaaggtaatcgcgacctcattgtcgaacatcctgatccagaaattgacaaaggttcgatgagtgc-aaatgagaagcgtgacgaaaaaaaggagt 25116407  T
204 gtcatacaggtgaaggttacatgattattatagtgaactcatttaagtacgatttgtttattactttaagacatggcattttcagttatgtcgagtgaag 303  Q
    ||||||||||||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||| | ||  ||||||||||||||||||||||||    
25116408 gtcatacaggtgaaggttacatgatcattatagtgaactcatttacgttcgatttgtttattactttaaaatatttcattttcagttatgtcgagtgaag 25116507  T
304 cgttttcttacctgaacaaagtcacagagaggttaggaatactcgaggattaccaaaaatttgagaagtccctacatagctacagaatgggaacaattac 403  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25116508 cgttttcttacctgaacaaagtcacagagaggttaggaatactcgaggattaccaaaaatttgagaagtccctacatagctacagaatgggaacaattac 25116607  T
404 aagagaagaactacaaacaatggtaatgttgtttatacatccaaattttcagaagttacatttttggattttctgtcacatcctataactcttgaattga 503  Q
    ||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
25116608 aagagaagaactacaaaaaatggtaatattgtttatacatccaaattttcagaagttacattttttgattttctgtcacatcctataactcttgaattga 25116707  T
504 atatggcttgcattgaacattaaactttaatacaaaaattatgtt-aaaataccgaaacggagaagaatt 572  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||| | ||||||||||||||    
25116708 atatggcttgcattgaacattaaactttaatacaaaaattatgttaaaaatactgtaacggagaagaatt 25116777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 1 - 105
Target Start/End: Original strand, 25116179 - 25116283
Alignment:
1 ctgagtaccgagaaggccaacgatttgcaaggtgatcatgatctcattgccaaaaatcttgatccagaatttaacaaaggtttgataagtgcagaggtgt 100  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
25116179 ctgagtaccgagaaggccaaagatttgcaaggtgatcatgatctcattgccaaaaatcttgatccagaatttaacaaaggtttgatgagtgcagaggtgt 25116278  T
101 ctgat 105  Q
    |||||    
25116279 ctgat 25116283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 753 - 830
Target Start/End: Original strand, 25116106 - 25116183
Alignment:
753 tgataatggtgtttgaatttcttgaaattgataatcttttaaatgctttttcattaggaatttgtttgtcggactgag 830  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
25116106 tgataatggtgtttgaatttcttgaaattgataatcttttaaatgctttttcattaggaatttgtttgtcgaactgag 25116183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 111; Significance: 1e-55; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 632 - 746
Target Start/End: Original strand, 11459938 - 11460052
Alignment:
632 aattggtgttgagtgctaatctctttgttaaactattggtgtagtctaacattgcctatcccttgctgtttcactaaaatacgaaaactatccaaaaaca 731  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11459938 aattggtgttgagtgctaatctctttgttaaactattggtgtagtctaacattgcctatcccttgctgtttcactaaaatacgaaaactatccaaaaaca 11460037  T
732 cttagtagaattcaa 746  Q
    ||||| |||||||||    
11460038 cttagcagaattcaa 11460052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 632 - 746
Target Start/End: Original strand, 11464920 - 11465034
Alignment:
632 aattggtgttgagtgctaatctctttgttaaactattggtgtagtctaacattgcctatcccttgctgtttcactaaaatacgaaaactatccaaaaaca 731  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11464920 aattggtgttgagtgctaatctctttgttaaactattggtgtagtctaacattgcctatcccttgctgtttcactaaaatacgaaaactatccaaaaaca 11465019  T
732 cttagtagaattcaa 746  Q
    ||||| |||||||||    
11465020 cttagcagaattcaa 11465034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 569 - 635
Target Start/End: Complemental strand, 504939 - 504873
Alignment:
569 aattgctagtacacttattgtgattcccaatacaagaatcaaaataggtacaagtatccatagaatt 635  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
504939 aattgctagtacacttattgtgattcccaatacaagaatcaaaataggtacaagtatccatagaatt 504873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 67; Significance: 2e-29; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 569 - 635
Target Start/End: Complemental strand, 6928871 - 6928805
Alignment:
569 aattgctagtacacttattgtgattcccaatacaagaatcaaaataggtacaagtatccatagaatt 635  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6928871 aattgctagtacacttattgtgattcccaatacaagaatcaaaataggtacaagtatccatagaatt 6928805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 67; Significance: 2e-29; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 569 - 635
Target Start/End: Complemental strand, 14541436 - 14541370
Alignment:
569 aattgctagtacacttattgtgattcccaatacaagaatcaaaataggtacaagtatccatagaatt 635  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14541436 aattgctagtacacttattgtgattcccaatacaagaatcaaaataggtacaagtatccatagaatt 14541370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 67; Significance: 2e-29; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 569 - 635
Target Start/End: Original strand, 53091966 - 53092032
Alignment:
569 aattgctagtacacttattgtgattcccaatacaagaatcaaaataggtacaagtatccatagaatt 635  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53091966 aattgctagtacacttattgtgattcccaatacaagaatcaaaataggtacaagtatccatagaatt 53092032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 569 - 603
Target Start/End: Original strand, 53091926 - 53091960
Alignment:
569 aattgctagtacacttattgtgattcccaatacaa 603  Q
    ||||||||||||| |||||||||||||||||||||    
53091926 aattgctagtacaattattgtgattcccaatacaa 53091960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110913 times since January 2019
Visitors: 1335