View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk48-2 (Length: 1655)

Name: R108-tnk48-2
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk48-2
R108-tnk48-2
[»] chr3 (4 HSPs)
chr3 (760-1655)||(47118584-47119477)
chr3 (1-469)||(47119473-47119935)
chr3 (489-763)||(47119978-47120252)
chr3 (950-1081)||(1585308-1585439)
[»] chr5 (2 HSPs)
chr5 (924-1043)||(34402567-34402684)
chr5 (940-1042)||(16612074-16612174)
[»] chr8 (1 HSPs)
chr8 (940-1039)||(33398156-33398255)
[»] chr7 (2 HSPs)
chr7 (940-1039)||(25810801-25810900)
chr7 (943-1038)||(4995128-4995223)
[»] chr4 (3 HSPs)
chr4 (925-1029)||(43340931-43341034)
chr4 (933-998)||(8947614-8947679)
chr4 (950-991)||(47295495-47295536)
[»] chr2 (1 HSPs)
chr2 (899-975)||(21770691-21770767)
[»] chr1 (2 HSPs)
chr1 (940-985)||(9429415-9429460)
chr1 (944-1038)||(23164168-23164262)


Alignment Details
Target: chr3 (Bit Score: 648; Significance: 0; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 648; E-Value: 0
Query Start/End: Original strand, 760 - 1655
Target Start/End: Original strand, 47118584 - 47119477
Alignment:
760 aattgtcaccttcatcgacgagaaagtcgtgacatntcttgaccgaacaaaagttttcaaa-gttgggaatgccaacttccatggatncattcaagcgtt 858  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||  |||||||| |||||||||||||||| |||||||| ||||||||||||    
47118584 aattgtcaccttcatcgacgagaaagtcgtgacat-tcttgaccgaacaaaccttttcaaacgttgggaatgccaactcccatggat-cattcaagcgtt 47118681  T
859 tataagggtacaatcgattgaaacacttgaaactttggtggtaatgaaaacatgtttcatttggcaacatattcacattgcgatacatgacatcatgtat 958  Q
    ||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||          |||||||||||    
47118682 tataagg-tacaatcgatttaaacacttgaaactttggtggtaatgaaaacatgtttcattagacaacatattcacatta---------acatcatgtat 47118771  T
959 caagtctccaaacaacttgttgacattttaaaatccatggctcaaaataagtttcaacaagccaagaatttggaggttgtgtgagttgattctggcgaca 1058  Q
     ||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||    
47118772 taagtctccaaacaacttgttgacatttaaaaatccatggttcaaaataagtttcaacaagtcaagaatttggaggttgtgtgagttgattctggtgaca 47118871  T
1059 atttaatcatcaacactccataagggtatgtaagggagccaattactggcaaacattttctcaacaatgccatctgatttctatacaatgccacgattga 1158  Q
    ||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||    
47118872 atttaatcatcaacactccataagg-tatgcaagggagccaattacaggcaaacattt-ctcagcaatgccatctgatttctatacaatgccacgattga 47118969  T
1159 tgattggggacaaccaatggttaatgacgttgttgatggaagctggattaagttgtggttgggtgagattcctcaactancatncttgtgcctcgggcga 1258  Q
    |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||    
47118970 tgattggggacaaccaatggctaatgatgttgttgatggaagctggattaagttgtggttgggtgagattcctcaactatcattcttgtgcctcgggcga 47119069  T
1259 ttaacaacgagggaggaattatatatccagttgtgggttcccaaactactctagttaagagttaggtacaattatttttgagnnnnnnnagctacactaa 1358  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||       |||||||||||    
47119070 ttaacaacgagggaggaattatatatccagttgtgggctcccaaactactttagttaagagttaggtacaattatttttgagtttttttagctacactaa 47119169  T
1359 aaaatgcataaataaaagcaaactttccctttctaccctcctatgaccccaccaaaacttatctatgatgcttttaatctctttgcaacaa--------- 1449  Q
    |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||             
47119170 aaaatgcataaataaaagcaaacttt-cctttcta-cctcctatgaccccaccaaaacttatctatgatgctttaaatctctttgcaacaatcctctagg 47119267  T
1450 ----tgtacaactaatgatgtagttaggaatcgcttaagctactgctttaatcgaaacttcatcaccttctcttgaacgaaatgcctcatgtcgtccatt 1545  Q
        ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47119268 agcttgtacaactaatgatgtagttaggaatcgcttaagctactgctttaatcgaaacttcatcaccttctcttgaacgaaatgcctcatgtcgtccatt 47119367  T
1546 tagctacttccagactcagtcaaccgaaaaggagttttgttttggaagaggtgaaacgttcatcgatatccttaaagatatatcttactcttcaattnca 1645  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||| ||    
47119368 tagcttcttccagactcagtcaaccgaaaaggagttttgttttggaagaggtgaaacgttcatcgatttccttaaagatatatctttctcttcaatttca 47119467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 410; E-Value: 0
Query Start/End: Original strand, 1 - 469
Target Start/End: Original strand, 47119473 - 47119935
Alignment:
1 ctttgcttcatttttctcgtccatatcatcacaatccttgattagatgcttgtttcatccatatacaaatcaaaaagtggttcattgtatttaagtggac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
47119473 ctttgcttcatttttctcgtccatatcatcacaatccttgattagatgcttgtttcatccatatacaaattaaaaagtggttcattgtatttaagtggac 47119572  T
101 acgaaggtttttaccttggtatttgaccacaatttattttgcaaggcgcttaaaaagatcaacatatgcatgctttggcacaaatgaacttctccactat 200  Q
     ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
47119573 gcgaaggtttttaccttggtatttgaccgcaatttattttgcaaggcgcttaaaaagatcaacatatgcatgctttggcacaaatgaacttgtccactat 47119672  T
201 atatcattccttgttatctaccctcgtaaacttccccaagtttcttcgctattgcattcaattttaatttaaagggcatatcataaatcctcactcaaag 300  Q
    |||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
47119673 atatcattccttgttatccaccctcgtaaacttccctaagtttcttcgctattgcattcaattttaatttaaagggcatatcataaatcctcacacaaag 47119772  T
301 ttcacctgattgcatctctaaatcagaaggttgattgtcctcgaagagtaatttcaaaacaataatgtttcaatttcaatcaactctccaaaagccattc 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||      |||||||||||||||||||||||||||    
47119773 ttcacctgattgcatctctaaatcagaaggttgattgtcctcgaagagtaatttcaaaacaatgatg------tttcaatcaactctccaaaagccattc 47119866  T
401 atgaggaccaaatccacatccctctttgttatgtcccatacctatactgagtttttaatctccaagctt 469  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
47119867 atgaggaccaaatccacatccctctttgttatgtcccagacctatactgagtttttaatctccaagctt 47119935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 489 - 763
Target Start/End: Original strand, 47119978 - 47120252
Alignment:
489 gacaagagatttgacgaagatttcgtccccacaactctcaatatcttctgcttcaaccctctcctccgcttcttcctttgtgagttccacctttttgcaa 588  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
47119978 gacaagagatttgacgaagatttcgtcaccacaactctcaatatcttctgcttcaaccctctcctctgcttcttcctttgtgagttccacctttttgcaa 47120077  T
589 ctatccattgagaagagaaacaacaagaacctattaagaagaaacaaatttcatgtcatgaggaccaaatttattggcatgaaagccttcgcaaaccaat 688  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
47120078 ctatccattgagaagagaaacaacaagaacctattaagaagaaacaaatttcatgtcatgaggaccaaatttactggcatgaaagccttcgcaaaccaat 47120177  T
689 taaagaaaacctgatttggttagagagagttagacttcactctaaaacacatttttatttatttatttatgaatt 763  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47120178 taaagaaaacctgatttggttagagagagttagacttcactctaaaacacatttttatttatttatttatgaatt 47120252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.00000004
Query Start/End: Original strand, 950 - 1081
Target Start/End: Original strand, 1585308 - 1585439
Alignment:
950 atcatgtatcaagtctccaaacaacttgttgacattttaaaatccatggctcaaaataagtttcaacaagccaagaatttggaggttgtgtgagttgatt 1049  Q
    |||||||||||||||| ||||||| ||| ||| ||| | |||   |||||| | |||||  |||||||||||||| | |||||||||||  |||   |||    
1585308 atcatgtatcaagtcttcaaacaaattgatgaaattattaaactaatggcttacaataaagttcaacaagccaaggaattggaggttgtacgagccaatt 1585407  T
1050 ctggcgacaatttaatcatcaacactccataa 1081  Q
    |||| || |||||| ||| |||| ||||||||    
1585408 ctggtgaaaatttagtcaccaacgctccataa 1585439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 52; Significance: 4e-20; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 52; E-Value: 4e-20
Query Start/End: Original strand, 924 - 1043
Target Start/End: Complemental strand, 34402684 - 34402567
Alignment:
924 aacatattcacattgcgatacatgacatcatgtatcaagtctccaaacaacttgttgacattttaaaatccatggctcaaaataagtttcaacaagccaa 1023  Q
    |||||||| |||| | |||||||||||| ||||||||||||||||||||||||||||||| | | ||| | |||| || ||| |||||||||||||||||    
34402684 aacatattgacatggagatacatgacat-atgtatcaagtctccaaacaacttgttgacactatgaaacctatggttc-aaacaagtttcaacaagccaa 34402587  T
1024 gaatttggaggttgtgtgag 1043  Q
      ||||||||| ||||||||    
34402586 atatttggaggctgtgtgag 34402567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.0000000002
Query Start/End: Original strand, 940 - 1042
Target Start/End: Complemental strand, 16612174 - 16612074
Alignment:
940 gatacatgacatcatgtatcaagtctccaaacaacttgttgacattttaaaatccatggctcaaaataagtttcaacaagccaagaatttggaggttgtg 1039  Q
    ||||| ||||||||||||| |  | ||||||||||||| ||||||| | ||| | |||| | ||||| ||||||||||||||||| ||||||| ||| ||    
16612174 gatacgtgacatcatgtataa--tttccaaacaacttgctgacattgtgaaaccaatggttaaaaatgagtttcaacaagccaaggatttggaagttatg 16612077  T
1040 tga 1042  Q
    |||    
16612076 tga 16612074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 0.000000000000003; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 0.000000000000003
Query Start/End: Original strand, 940 - 1039
Target Start/End: Original strand, 33398156 - 33398255
Alignment:
940 gatacatgacatcatgtatcaagtctccaaacaacttgttgacattttaaaatccatggctcaaaataagtttcaacaagccaagaatttggaggttgtg 1039  Q
    ||||||||||||| ||||||||| ||| |||||||||||| ||||| | |||  ||||  |||||||||| |||||||| ||||| |||| |||||||||    
33398156 gatacatgacatcgtgtatcaagcctctaaacaacttgtttacattatgaaactcatgtttcaaaataagattcaacaaaccaaggatttcgaggttgtg 33398255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 44; Significance: 0.000000000000003; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 44; E-Value: 0.000000000000003
Query Start/End: Original strand, 940 - 1039
Target Start/End: Original strand, 25810801 - 25810900
Alignment:
940 gatacatgacatcatgtatcaagtctccaaacaacttgttgacattttaaaatccatggctcaaaataagtttcaacaagccaagaatttggaggttgtg 1039  Q
    ||||||||||| | ||||||| |||||||||||||||| ||||||| | ||| |||||  ||||||| |||||||| |||||||  ||||||||| ||||    
25810801 gatacatgacaccgtgtatcatgtctccaaacaacttgctgacattgtgaaacccatgattcaaaatgagtttcaagaagccaaagatttggaggatgtg 25810900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.00000004
Query Start/End: Original strand, 943 - 1038
Target Start/End: Complemental strand, 4995223 - 4995128
Alignment:
943 acatgacatcatgtatcaagtctccaaacaacttgttgacattttaaaatccatggctcaaaataagtttcaacaagccaagaatttggaggttgt 1038  Q
    |||||||||||||| | |||||| ||||||||||| ||| | | | ||| |||||| ||||||| ||||||||| || || |  ||||||||||||    
4995223 acatgacatcatgttttaagtcttcaaacaacttgctgaaaatgtgaaacccatggttcaaaatgagtttcaacgagacatgggtttggaggttgt 4995128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.00000000004; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.00000000004
Query Start/End: Original strand, 925 - 1029
Target Start/End: Complemental strand, 43341034 - 43340931
Alignment:
925 acatattcacattgcgatacatgacatcatgtatcaagtctccaaacaacttgttgacattttaaaatccatggctcaaaataagtttcaacaagccaag 1024  Q
    ||||||| |||| | |||||||||||| |||||| |||||||||||||| ||| | ||||| |  || ||||||  ||||||||||||||| ||| ||||    
43341034 acatattgacatggagatacatgacattatgtat-aagtctccaaacaatttgctcacattatgtaacccatggtccaaaataagtttcaataagtcaag 43340936  T
1025 aattt 1029  Q
    |||||    
43340935 aattt 43340931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 933 - 998
Target Start/End: Complemental strand, 8947679 - 8947614
Alignment:
933 acattgcgatacatgacatcatgtatcaagtctccaaacaacttgttgacattttaaaatccatgg 998  Q
    |||||| | ||||||||||| |||||||||| |||||| |||||||||||||| | ||| ||||||    
8947679 acattggggtacatgacatcctgtatcaagtatccaaagaacttgttgacattgtgaaacccatgg 8947614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000006
Query Start/End: Original strand, 950 - 991
Target Start/End: Complemental strand, 47295536 - 47295495
Alignment:
950 atcatgtatcaagtctccaaacaacttgttgacattttaaaa 991  Q
    |||||||||||||||| ||||||||||| ||||||| |||||    
47295536 atcatgtatcaagtcttcaaacaacttgctgacattgtaaaa 47295495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 37; Significance: 0.00000000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000004
Query Start/End: Original strand, 899 - 975
Target Start/End: Original strand, 21770691 - 21770767
Alignment:
899 gtaatgaaaacatgtttcatttggcaacatattcacattgcgatacatgacatcatgtatcaagtctccaaacaact 975  Q
    ||||||| ||| | ||||||| | || |||||| |||| | ||||||||||||||||||||| ||||||||||||||    
21770691 gtaatgacaacgtctttcattagacatcatattgacatggagatacatgacatcatgtatcatgtctccaaacaact 21770767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.000000002; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.000000002
Query Start/End: Original strand, 940 - 985
Target Start/End: Original strand, 9429415 - 9429460
Alignment:
940 gatacatgacatcatgtatcaagtctccaaacaacttgttgacatt 985  Q
    |||||||||||| ||||||| |||||||||| ||||||||||||||    
9429415 gatacatgacataatgtatcgagtctccaaaaaacttgttgacatt 9429460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.0000002
Query Start/End: Original strand, 944 - 1038
Target Start/End: Original strand, 23164168 - 23164262
Alignment:
944 catgacatcatgtatcaagtctccaaacaacttgttgacattttaaaatccatggctcaaaataagtttcaacaagccaagaatttggaggttgt 1038  Q
    ||||||||| |||||||||||||||||||||||| || |||| | ||| ||| ||  || |||| |||||| | ||||| | |||||||| ||||    
23164168 catgacatcgtgtatcaagtctccaaacaacttgatgtcattgtgaaacccaaggtccataataggtttcatctagccatgtatttggagattgt 23164262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 311737 times since January 2019
Visitors: 444