View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk48-5 (Length: 472)

Name: R108-tnk48-5
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk48-5
R108-tnk48-5
[»] chr3 (5 HSPs)
chr3 (1-408)||(49613761-49614168)
chr3 (27-378)||(49618763-49619113)
chr3 (405-472)||(49613698-49613765)
chr3 (227-401)||(49617634-49617802)
chr3 (157-205)||(49617554-49617602)
[»] chr6 (25 HSPs)
chr6 (27-371)||(2934950-2935294)
chr6 (27-368)||(2937811-2938152)
chr6 (37-368)||(2927521-2927852)
chr6 (21-368)||(2996759-2997106)
chr6 (27-368)||(2929660-2930001)
chr6 (37-347)||(3003191-3003501)
chr6 (40-368)||(2974371-2974699)
chr6 (11-224)||(2658515-2658728)
chr6 (11-224)||(2964844-2965057)
chr6 (27-347)||(2952284-2952607)
chr6 (27-368)||(2983217-2983558)
chr6 (413-468)||(2658738-2658793)
chr6 (261-347)||(2965112-2965198)
chr6 (252-369)||(2658358-2658475)
chr6 (412-468)||(2937729-2937785)
chr6 (423-468)||(2974287-2974332)
chr6 (405-468)||(2927422-2927485)
chr6 (413-468)||(2934869-2934924)
chr6 (41-102)||(2985693-2985754)
chr6 (423-467)||(2964789-2964833)
chr6 (45-165)||(2979257-2979377)
chr6 (428-468)||(2983151-2983191)
chr6 (412-468)||(3003537-3003593)
chr6 (405-468)||(2952195-2952258)
chr6 (413-462)||(2997132-2997181)
[»] scaffold0024 (3 HSPs)
scaffold0024 (11-368)||(34628-34985)
scaffold0024 (411-468)||(34995-35052)
scaffold0024 (28-146)||(44539-44657)
[»] chr7 (2 HSPs)
chr7 (27-367)||(3339376-3339716)
chr7 (412-468)||(3339294-3339350)


Alignment Details
Target: chr3 (Bit Score: 392; Significance: 0; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 392; E-Value: 0
Query Start/End: Original strand, 1 - 408
Target Start/End: Original strand, 49613761 - 49614168
Alignment:
1 actaccccagtgagtcctacattacggattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatact 100  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49613761 actaccctagtgagtcctacattacggattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatact 49613860  T
101 ggtgaattggcttggggataatgattctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattcta 200  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
49613861 ggtgaattggcttggggatagtgattctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgtatttcagttctcagtactctattcta 49613960  T
201 tgtgaagacttgaatggtttttgtcatgatccttggcatagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttcca 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49613961 tgtgaagacttgaatggtttttgtcatgatccttggcatagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttcca 49614060  T
301 ttgctggaattttactacttattctctctttacttcaatcagtttgtgcagtgttgcaagttgtacaacaatataatgattcatagtaagttcaatcatt 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49614061 ttgctggaattttactacttattctctctttacttcaatcagtttgtgcagtgttgcaagttgtacaacaatataatgattcatagtaagttcaatcatt 49614160  T
401 ggtgaatt 408  Q
    | ||||||    
49614161 gttgaatt 49614168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 27 - 378
Target Start/End: Original strand, 49618763 - 49619113
Alignment:
27 gattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttggggataatgatt 126  Q
    |||||| || |||||||||||| |||||| ||||  || | ||||| |||||||||||||||||    ||||| ||  |||  |||||  || | |||||    
49618763 gattatatttctgttttggattaccttataaatatcggtagggatgcggatatacttgttcagagaggaatacaggataatatgcttgcagacagtgatt 49618862  T
127 ctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagacttgaatggtttttgtca 226  Q
    ||||||| ||||||| |||| ||||||||||||||||| ||||| | |||||||||||||| | || | ||||   | ||||||||| |||||||||| |    
49618863 ctgtggcaaacttgtataatggtctttggaaaaatgtttcacatataaatttcagttctcatttctgtcttcttcctaaagacttga-tggtttttgtaa 49618961  T
227 tgatccttggcatagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttattctc 326  Q
    | |||||||||||| | ||||||| |||||||| ||||||||| |||  | ||||||||||||||||||||||||||||||||||||||||||| |||||    
49618962 taatccttggcataaactgaaggctactctcaggcgtgattatggcagtactccttggcaaactgctgcttccattgctggaattttactacttgttctc 49619061  T
327 tctttacttcaatcagtttgtgcagtgttgcaagttgtacaacaatataatg 378  Q
    ||||||||||||||||||||| |  | |||||||||||||| || |||||||    
49619062 tctttacttcaatcagtttgttctatcttgcaagttgtacagcagtataatg 49619113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 405 - 472
Target Start/End: Original strand, 49613698 - 49613765
Alignment:
405 aattgaaagttgaggattggactgaaattttgtttcggaatatggttgctttggagcaatgtcactac 472  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49613698 aattgaaagttgaggattggactgaaattttgtttcggaatatggttgctttggagcaatgtcactac 49613765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 227 - 401
Target Start/End: Original strand, 49617634 - 49617802
Alignment:
227 tgatccttggcatagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttattctc 326  Q
    |||| |||||| || ||||||||| |||||||| | ||||| |||||  |||   |||||| | ||||||||  ||||||||||||||||||||||  ||    
49617634 tgatgcttggcttaaattgaaggctactctcaggcatgatttttgcactagt---tggcaa-cagctgcttctgttgctggaattttactacttat--tc 49617727  T
327 tctttacttcaatcagtttgtgcagtgttgcaagttgtacaacaatataatgattcatagtaagttcaatcattg 401  Q
    ||||||||||||||||||| | | || |||| |||| |  | ||||||||||| || |||| |||||||||||||    
49617728 tctttacttcaatcagtttattctgtcttgcgagttatgaagcaatataatgactcctagtgagttcaatcattg 49617802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 49617554 - 49617602
Alignment:
157 aaaatgttacacatttgaatttcagttctcagtactctattctatgtga 205  Q
    |||||||| |||||||||||||| ||||||| |||||||||||||||||    
49617554 aaaatgttgcacatttgaatttctgttctcattactctattctatgtga 49617602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 169; Significance: 2e-90; HSPs: 25)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 27 - 371
Target Start/End: Original strand, 2934950 - 2935294
Alignment:
27 gattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttggggataatgatt 126  Q
    ||||||||||||||  |||||| |||||| |||||||| | |||||  ||||||||||||| |||  ||||||||   |||  ||||| ||||| |||||    
2934950 gattatgttgctgtcatggattaccttataaatactggtacggatgctgatatacttgttcggaacgaaatactgcataatatgcttgcggatagtgatt 2935049  T
127 ctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagacttgaatggtttttgtca 226  Q
    |||||||||||||||||||| |||||||||||||||||||||| |  ||| |||||||||| | ||||||||||||  ||||||| |||| ||||||| |    
2935050 ctgtggctaacttgtttaatggtctttggaaaaatgttacacaatctaatatcagttctcatttctctattctatgcaaagacttaaatgctttttgtaa 2935149  T
227 tgatccttggcatagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttattctc 326  Q
      ||||||||||||  |||||||| |||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||| ||||||||| |||||    
2935150 gaatccttggcataagttgaaggctactctcaggcgtgattattgcaaaactccttggcaaactgctgcttccattgctggaatcttactactttttctc 2935249  T
327 tctttacttcaatcagtttgtgcagtgttgcaagttgtacaacaa 371  Q
     |||||||||||||||||||| | || ||||||||||||||||||    
2935250 actttacttcaatcagtttgttctgtcttgcaagttgtacaacaa 2935294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 27 - 368
Target Start/End: Original strand, 2937811 - 2938152
Alignment:
27 gattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttggggataatgatt 126  Q
    |||||||||| ||||||||||| |||||| ||||| || ||||||| || ||||||||||  ||| ||||||||||  ||||||||||| || | |||||    
2937811 gattatgttgttgttttggattaccttataaataccggtaaggatgcgggtatacttgtttggaacaaaatactggaaaattggcttggagacagtgatt 2937910  T
127 ctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagacttgaatggtttttgtca 226  Q
    |||||||||| ||||||||| ||||||| |||||||||  | |||   || |||||||||| | ||||||||| ||  |||| || |||| ||| ||       
2937911 ctgtggctaatttgtttaatggtctttgcaaaaatgttgtatattctgatatcagttctcaattctctattctttgcaaagaattaaatgctttctgcag 2938010  T
227 tgatccttggcatagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttattctc 326  Q
    | ||||||||||||  |||||||| ||||| || ||||||||| |||| | ||||||||||||||||||||||||||||||||| |||||||||||||||    
2938011 taatccttggcataagttgaaggctactctgaggcgtgattatggcaaaactccttggcaaactgctgcttccattgctggaatcttactacttattctc 2938110  T
327 tctttacttcaatcagtttgtgcagtgttgcaagttgtacaa 368  Q
     |||||||||||||||||||| | || |||||||||||||||    
2938111 actttacttcaatcagtttgttctgtcttgcaagttgtacaa 2938152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 37 - 368
Target Start/End: Original strand, 2927521 - 2927852
Alignment:
37 ctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttggggataatgattctgtggctaa 136  Q
    |||||||||||| |||||| |||||||| ||||||||||||||||||||||||| | |||||||||  |||  |||||| ||   |||||||||||||||    
2927521 ctgttttggattaccttataaatactggtaaggatgtggatatacttgttcagagggaaatactggaaaatatgcttggagacggtgattctgtggctaa 2927620  T
137 cttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagacttgaatggtttttgtcatgatccttgg 236  Q
    |||||||||| ||||| | ||||||||||||| ||  |   |||||||||| | ||||||||| ||  ||||||| |||| || |||| |  ||||  |     
2927621 cttgtttaatggtcttggtaaaaatgttacacgttctacaatcagttctcaattctctattctttgcaaagacttaaatgcttattgtaagaatccacga 2927720  T
237 catagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttattctctctttacttc 336  Q
    ||||  |||||||| |||||||| |||||||||||||| | ||||||||||||||||||||||||||| ||||| ||||||||| ||||| |||||||||    
2927721 cataagttgaaggctactctcaggcgtgattattgcaaaactccttggcaaactgctgcttccattgcgggaatcttactacttgttctcactttacttc 2927820  T
337 aatcagtttgtgcagtgttgcaagttgtacaa 368  Q
    ||||||||||| | || |||||||||||||||    
2927821 aatcagtttgttctgtcttgcaagttgtacaa 2927852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 136; E-Value: 9e-71
Query Start/End: Original strand, 21 - 368
Target Start/End: Complemental strand, 2997106 - 2996759
Alignment:
21 attacggattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttggggata 120  Q
    ||||| ||||||||| |||||||||||| |||||| || ||||| |||||||| |||||||||||||| ||  |||||||||  ||||||||||| || |    
2997106 attactgattatgtttctgttttggattaccttataaacactggtaaggatgttgatatacttgttcacaaagaaatactggaaaattggcttggagaca 2997007  T
121 atgattctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagacttgaatggttt 220  Q
     ||||||||||||||||||||||||| ||||||| | |||||||  ||||   ||| |||||||||| | ||||||||| ||  | ||||| |||| |||    
2997006 gtgattctgtggctaacttgtttaatggtctttgcataaatgttgtacataccaatatcagttctcaattctctattctttgcaaggacttaaatgcttt 2996907  T
221 ttgtcatgatccttggcatagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactactt 320  Q
    ||||    ||||||||||||  |||||||| |||||||| ||||||||| |||| | |||||||||| ||||||||||| ||||||||||| ||||||||    
2996906 ttgtaggaatccttggcataagttgaaggctactctcaggcgtgattatggcaagactccttggcaagctgctgcttcctttgctggaattgtactactt 2996807  T
321 attctctctttacttcaatcagtttgtgcagtgttgcaagttgtacaa 368  Q
     ||||| ||||  |||||||||||||| | || |||||||||||||||    
2996806 gttctcacttttattcaatcagtttgttctgtcttgcaagttgtacaa 2996759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 27 - 368
Target Start/End: Original strand, 2929660 - 2930001
Alignment:
27 gattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttggggataatgatt 126  Q
    ||||||||| || || ||||||| ||||| |||||||| ||||| |  ||||||||| |||||||  |||||||||  |||||| |||| || ||| |||    
2929660 gattatgttactattatggattttcttataaatactggtaaggacgccgatatacttattcagaaagaaatactggaaaattggtttggagacaatcatt 2929759  T
127 ctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagacttgaatggtttttgtca 226  Q
    ||||||||||| |||||||| || |||| ||| || ||| |||||  ||| ||||| |||| | ||||||||||||  ||||||| |||| ||||||| |    
2929760 ctgtggctaacatgtttaatggtttttgcaaatatattatacattctaatatcagtcctcatttctctattctatgcaaagacttaaatgctttttgtta 2929859  T
227 tgatccttggcatagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttattctc 326  Q
      ||||||||||||| |||||||| |||||||| ||||||||||| |  | ||||||||||||||||||||||||||||||| | ||||||||| |||||    
2929860 gaatccttggcataggttgaaggctactctcaggcgtgattattgaagtactccttggcaaactgctgcttccattgctggattcttactactttttctc 2929959  T
327 tctttacttcaatcagtttgtgcagtgttgcaagttgtacaa 368  Q
     |||||||||||||||||||| | || |||||||||||||||    
2929960 actttacttcaatcagtttgttctgtcttgcaagttgtacaa 2930001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 37 - 347
Target Start/End: Complemental strand, 3003501 - 3003191
Alignment:
37 ctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttggggataatgattctgtggctaa 136  Q
    |||||||||||| |||||| |||||||  |||||||||||||||||||||||||   |||||||||  |||  |||||| || | |||||||||||||||    
3003501 ctgttttggattaccttataaatactgctaaggatgtggatatacttgttcagagcgaaatactggaaaatatgcttggagacagtgattctgtggctaa 3003402  T
137 cttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagacttgaatggtttttgtcatgatccttgg 236  Q
    |||||||||| ||||| | ||| || ||| || ||  |   |||||||||| | |||||||||  |  ||||||| |||| || |||| |  |||| |||    
3003401 cttgtttaatggtcttggcaaagatattatacgttctacaatcagttctcaattctctattcttggcaaagacttaaatgcttattgtaagaatccatgg 3003302  T
237 catagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttattctctctttacttc 336  Q
    ||||  |||||||| |||||||| |||||||||||||| | ||| ||||||||||||||||||||||||||||| ||||| |||  |||| |||||||||    
3003301 cataagttgaaggctactctcaggcgtgattattgcaaaactccctggcaaactgctgcttccattgctggaatcttactccttgctctcactttacttc 3003202  T
337 aatcagtttgt 347  Q
    || ||||||||    
3003201 aaacagtttgt 3003191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 40 - 368
Target Start/End: Original strand, 2974371 - 2974699
Alignment:
40 ttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttggggataatgattctgtggctaactt 139  Q
    ||||||||| |||||| |||||| | | |||||||||||||||||||| ||  || ||||||   ||||||||||| || | ||||||||| |||| |||    
2974371 ttttggattaccttataaatactagtacggatgtggatatacttgttcggagcaatatactgcaaaattggcttggagacagtgattctgttgctatctt 2974470  T
140 gtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagacttgaatggtttttgtcatgatccttggcat 239  Q
     |||||| ||||| |  ||||| ||||| |||  ||| |||||||||| | ||||||||| ||  |||| ||||||| || ||||    |||||||||||    
2974471 atttaatggtcttggagaaaatattacaaattctaatatcagttctcatttctctattctttgcaaagaattgaatgcttattgtaggaatccttggcat 2974570  T
240 agattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttattctctctttacttcaat 339  Q
    || ||||||||  |||| || |||||||||||||| | ||||||||| |||||||||||||||||||||||||| |||||| ||||| || || |||||     
2974571 aggttgaaggctgctctaaggcgtgattattgcaatactccttggcacactgctgcttccattgctggaatttttctacttgttctcactataattcaaa 2974670  T
340 cagtttgtgcagtgttgcaagttgtacaa 368  Q
     ||||||| | || |||||||| ||||||    
2974671 gagtttgttctgtcttgcaagtagtacaa 2974699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 11 - 224
Target Start/End: Complemental strand, 2658728 - 2658515
Alignment:
11 tgagtcctacattacggattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattgg 110  Q
    |||||| || ||||| |||||||||||||||||||||| |||||| |||||||| ||||||||||||||||||||||  || ||||||||||  ||||||    
2658728 tgagtcatatattactgattatgttgctgttttggattaccttataaatactggtaaggatgtggatatacttgttccaaacaaaatactggaaaattgg 2658629  T
111 cttggggataatgattctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagact 210  Q
    ||||| || | ||||||||||||||||||||||| | ||||||| ||||||||||| ||||  |||  |||| |||| | | ||||||| ||||||||||    
2658628 cttggagacagtgattctgtggctaacttgtttactggtctttgcaaaaatgttactcattgtaatagcagtcctcatttcactattctttgtgaagact 2658529  T
211 tgaatggtttttgt 224  Q
    | || | |||||||    
2658528 taaaagatttttgt 2658515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 11 - 224
Target Start/End: Original strand, 2964844 - 2965057
Alignment:
11 tgagtcctacattacggattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattgg 110  Q
    |||||| || ||||| || ||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| ||||||||||  |||  |    
2964844 tgagtcatatattactgactatgttgctgttttggattaccttataaatactggcaaggatgtggatatacttgttcagaacaaaatactggaaaatatg 2964943  T
111 cttggggataatgattctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagact 210  Q
    ||||| |||| ||||||||||||||||||||||||| ||||||  ||| |||||| |||||  ||| |||||  ||| | ||||||||| ||  |||| |    
2964944 cttggagatagtgattctgtggctaacttgtttaatggtctttccaaatatgttatacattctaatatcagtcttcaattctctattctttgcaaagatt 2965043  T
211 tgaatggtttttgt 224  Q
    |||||| |||||||    
2965044 tgaatgctttttgt 2965057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 27 - 347
Target Start/End: Original strand, 2952284 - 2952607
Alignment:
27 gattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttgggga---taatg 123  Q
    |||||||||| ||||||||||| | |||| |||||||| |  ||||||||||||||||||| || | | ||||| |  |||  |||||| ||   || ||    
2952284 gattatgttgttgttttggattacattataaatactggtaccgatgtggatatacttgttcggagggatatactagataatatgcttggagaaagtagtg 2952383  T
124 attctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagacttgaatggtttttg 223  Q
    ||||||||||||||  ||||||| || |||| |||||||||  | |||  ||| |||||||||| | ||||||| |  |  ||||  | ||||  |||||    
2952384 attctgtggctaacaggtttaatggtatttgcaaaaatgttgtatattctaatatcagttctcaattctctattattggcaaagaaataaatgcattttg 2952483  T
224 tcatgatccttggcatagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttatt 323  Q
    |  | |||||||| |||  ||||| || ||||| || ||||||||| |||| | |||||||||||||||||||||||||||||||||  |||| |||  |    
2952484 tagtaatccttggaataagttgaaagccactctgaggcgtgattatggcaaaactccttggcaaactgctgcttccattgctggaatcgtactccttgct 2952583  T
324 ctctctttacttcaatcagtttgt 347  Q
    ||| ||||||||||| ||||||||    
2952584 ctcactttacttcaaacagtttgt 2952607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 27 - 368
Target Start/End: Original strand, 2983217 - 2983558
Alignment:
27 gattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttggggataatgatt 126  Q
    |||||||||  ||||||||||| |||||| |||| ||| |||||||||||| ||||| |||||||| ||||||| |  || | |||||| ||   | | |    
2983217 gattatgttcttgttttggattaccttataaataatggtaaggatgtggatgtacttattcagaagcaaatactagaaaacttgcttggagacggtcaat 2983316  T
127 ctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagacttgaatggtttttgtca 226  Q
    || |||||| |||||||||| ||||||| |||||||||  | | |  ||  |||||| ||| | |   | ||| |   | || ||| ||| ||||||| |    
2983317 ctatggctatcttgtttaatggtctttgcaaaaatgttgtaaaatctaaactcagttatcatttcgtaagtctttccaatgaattggatgctttttgtaa 2983416  T
227 tgatccttggcatagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttattctc 326  Q
    | ||||| || |||  |||||||| |||||||| ||||||||| |||| | ||||||| ||| |||||||||| |||||||| | ||||||||| |||||    
2983417 taatcctaggaataagttgaaggccactctcaggcgtgattatggcaatactccttggaaaattgctgcttccgttgctggagtcttactacttgttctc 2983516  T
327 tctttacttcaatcagtttgtgcagtgttgcaagttgtacaa 368  Q
     || || ||||| |||||||| | || |||||| | ||||||    
2983517 actataattcaaacagtttgttctgtcttgcaaatagtacaa 2983558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 413 - 468
Target Start/End: Complemental strand, 2658793 - 2658738
Alignment:
413 gttgaggattggactgaaattttgtttcggaatatggttgctttggagcaatgtca 468  Q
    ||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||||    
2658793 gttgacgataggactgaaattttgtttcgaaatatggttgctttggagcaatgtca 2658738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 261 - 347
Target Start/End: Original strand, 2965112 - 2965198
Alignment:
261 cgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttattctctctttacttcaatcagtttgt 347  Q
    |||||||| ||||  | |||||||||| ||||||||||| |||||||||| ||||||||| ||||| ||||| ||||| ||||||||    
2965112 cgtgattactgcagtactccttggcaagctgctgcttcctttgctggaatcttactacttgttctcactttaattcaaacagtttgt 2965198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 252 - 369
Target Start/End: Complemental strand, 2658475 - 2658358
Alignment:
252 actctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttattctctctttacttcaatcagtttgtgcag 351  Q
    ||||| || |||||||||||||  | ||||||| || ||| ||||||| |||||||||| ||||||||||||||| || || ||||| |||||||| | |    
2658475 actctgaggcgtgattattgcagtactccttggaaagctggtgcttcctttgctggaatcttactacttattctcactataattcaaacagtttgttctg 2658376  T
352 tgttgcaagttgtacaac 369  Q
    | || ||||| |||||||    
2658375 tctttcaagtagtacaac 2658358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 412 - 468
Target Start/End: Original strand, 2937729 - 2937785
Alignment:
412 agttgaggattggactgaaattttgtttcggaatatggttgctttggagcaatgtca 468  Q
    ||||||||||| ||| |||||||||||| |||||||||||||||||||||| |||||    
2937729 agttgaggattcgaccgaaattttgttttggaatatggttgctttggagcagtgtca 2937785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 423 - 468
Target Start/End: Original strand, 2974287 - 2974332
Alignment:
423 ggactgaaattttgtttcggaatatggttgctttggagcaatgtca 468  Q
    |||| ||||||||||||||||||||||||||||||||||| |||||    
2974287 ggaccgaaattttgtttcggaatatggttgctttggagcagtgtca 2974332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 405 - 468
Target Start/End: Original strand, 2927422 - 2927485
Alignment:
405 aattgaaagttgaggattggactgaaattttgtttcggaatatggttgctttggagcaatgtca 468  Q
    |||| |||||| |||||| |||||||| ||| || ||||||||||||||||||||||| |||||    
2927422 aattaaaagttcaggattcgactgaaactttattacggaatatggttgctttggagcagtgtca 2927485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 413 - 468
Target Start/End: Original strand, 2934869 - 2934924
Alignment:
413 gttgaggattggactgaaattttgtttcggaatatggttgctttggagcaatgtca 468  Q
    ||||| ||| |||||||||||| |||||| |||||||||||||||||||| |||||    
2934869 gttgacgataggactgaaatttcgtttcgaaatatggttgctttggagcagtgtca 2934924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 41 - 102
Target Start/End: Original strand, 2985693 - 2985754
Alignment:
41 tttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactgg 102  Q
    |||||||| |||||| |||||| | ||||||| ||||||||||||||||||  |||||||||    
2985693 tttggattaccttataaatactagtaaggatgcggatatacttgttcagaaccaaatactgg 2985754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 423 - 467
Target Start/End: Original strand, 2964789 - 2964833
Alignment:
423 ggactgaaattttgtttcggaatatggttgctttggagcaatgtc 467  Q
    |||| |||||| |||||||||||||||||||||||||||| ||||    
2964789 ggaccgaaattatgtttcggaatatggttgctttggagcagtgtc 2964833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 45 - 165
Target Start/End: Original strand, 2979257 - 2979377
Alignment:
45 gatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttggggataatgattctgtggctaacttgttta 144  Q
    |||| |||||| ||||| || | |||||||||||||||||||| ||  ||||||||||  |||| |||||| || | | ||||||  ||||| |||||||    
2979257 gattaccttataaataccggtacggatgtggatatacttgttcggagcaaaatactggaaaatttgcttggagacagtcattctgctgctaaattgttta 2979356  T
145 atagtctttggaaaaatgtta 165  Q
    ||  ||||||  |||||||||    
2979357 atgatctttgcgaaaatgtta 2979377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 428 - 468
Target Start/End: Original strand, 2983151 - 2983191
Alignment:
428 gaaattttgtttcggaatatggttgctttggagcaatgtca 468  Q
    ||||||||||||||||||||| ||||||||||||| |||||    
2983151 gaaattttgtttcggaatatgattgctttggagcattgtca 2983191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 412 - 468
Target Start/End: Complemental strand, 3003593 - 3003537
Alignment:
412 agttgaggattggactgaaattttgtttcggaatatggttgctttggagcaatgtca 468  Q
    ||||| ||||| ||| |||| ||| |||||||||||||||||||||||||| |||||    
3003593 agttgcggattcgaccgaaactttatttcggaatatggttgctttggagcagtgtca 3003537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 405 - 468
Target Start/End: Original strand, 2952195 - 2952258
Alignment:
405 aattgaaagttgaggattggactgaaattttgtttcggaatatggttgctttggagcaatgtca 468  Q
    |||| |||||| ||||||  || |||| ||| |||||||||||||||||||||||||| |||||    
2952195 aattaaaagttcaggattcaaccgaaactttatttcggaatatggttgctttggagcagtgtca 2952258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 413 - 462
Target Start/End: Complemental strand, 2997181 - 2997132
Alignment:
413 gttgaggattggactgaaattttgtttcggaatatggttgctttggagca 462  Q
    ||||||||| |||| |||  ||| ||||||||||||||||||||||||||    
2997181 gttgaggatcggaccgaagctttatttcggaatatggttgctttggagca 2997132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 150; Significance: 4e-79; HSPs: 3)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 150; E-Value: 4e-79
Query Start/End: Original strand, 11 - 368
Target Start/End: Complemental strand, 34985 - 34628
Alignment:
11 tgagtcctacattacggattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattgg 110  Q
    |||||| || ||||| |||||||||| |||||||||||||||||| |||||||| ||||||| |||||||||||||| |||  ||||||||   |||| |    
34985 tgagtcatatattactgattatgttgttgttttggatttccttataaatactggtaaggatgcggatatacttgttcggaaagaaatactgactaatttg 34886  T
111 cttggggataatgattctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagact 210  Q
    ||||| || | ||||||||||||||||||||||||| ||||||| |||||||||| ||||   ||| |||||||||| | ||||||||| ||  || |||    
34885 cttggagacagtgattctgtggctaacttgtttaatcgtctttgcaaaaatgttatacatcataatatcagttctcatttctctattctttgcaaaaact 34786  T
211 tgaatggtttttgtcatgatccttggcatagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaat 310  Q
    | ||||  ||||||  | |||||||| |||| ||||||||  ||||||| ||||||||| |||| | |||||||||||||||||||||| ||||||||||    
34785 taaatgcattttgtagtaatccttggaataggttgaaggcttctctcaggcgtgattatggcaaaactccttggcaaactgctgcttccgttgctggaat 34686  T
311 tttactacttattctctctttacttcaatcagtttgtgcagtgttgcaagttgtacaa 368  Q
    |||||||||| ||||| |||| ||||||||||||||| | || |||||||| ||||||    
34685 tttactacttgttctcactttgcttcaatcagtttgttctgtcttgcaagtagtacaa 34628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 411 - 468
Target Start/End: Complemental strand, 35052 - 34995
Alignment:
411 aagttgaggattggactgaaattttgtttcggaatatggttgctttggagcaatgtca 468  Q
    ||||||||||| |||| ||||||||||||||||||||||||||||||||||| |||||    
35052 aagttgaggatgggaccgaaattttgtttcggaatatggttgctttggagcagtgtca 34995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 28 - 146
Target Start/End: Complemental strand, 44657 - 44539
Alignment:
28 attatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttggggataatgattc 127  Q
    ||||||||||| ||||||||| |||||| |||||||| |||||||  ||||||| ||||| ||  ||||||||||  |||| |||||| || | | |||     
44657 attatgttgctattttggattaccttataaatactggtaaggatgcagatatacatgttcggagcaaaatactggaaaatttgcttggagacagtcatta 44558  T
128 tgtggctaacttgtttaat 146  Q
    ||||||||| |||||||||    
44557 tgtggctaatttgtttaat 44539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 137; Significance: 2e-71; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 137; E-Value: 2e-71
Query Start/End: Original strand, 27 - 367
Target Start/End: Original strand, 3339376 - 3339716
Alignment:
27 gattatgttgctgttttggatttccttattaatactggcaaggatgtggatatacttgttcagaagaaaatactggtgaattggcttggggataatgatt 126  Q
    |||||||||||| |||||||||||||||| |||||| | | ||||||||||||||||||| |||   ||||||| |  ||||||||||  || | |||||    
3339376 gattatgttgcttttttggatttccttataaatactagtatggatgtggatatacttgttaagagcgaaatactagaaaattggcttgcagacagtgatt 3339475  T
127 ctgtggctaacttgtttaatagtctttggaaaaatgttacacatttgaatttcagttctcagtactctattctatgtgaagacttgaatggtttttgtca 226  Q
    |||||||||| ||||||||| ||||||| ||||||||||  ||||  | | | |||||||| | | ||| |||  |  ||||||| |||| ||||||| |    
3339476 ctgtggctaaattgtttaatggtctttgcaaaaatgttatgcattctagtgtaagttctcatttccctactcttggcaaagacttaaatgatttttgtaa 3339575  T
227 tgatccttggcatagattgaaggcgactctcagacgtgattattgcaacagtccttggcaaactgctgcttccattgctggaattttactacttattctc 326  Q
      ||||||||||||| |||||||| |||||||| |||||||||||||| | |||||||||||||||||||||||||||||||||| |||||||| |||||    
3339576 gaatccttggcataggttgaaggccactctcaggcgtgattattgcaatactccttggcaaactgctgcttccattgctggaattgtactacttgttctc 3339675  T
327 tctttacttcaatcagtttgtgcagtgttgcaagttgtaca 367  Q
     |||||||||||||||||||| | || |||||||| |||||    
3339676 actttacttcaatcagtttgttctgtcttgcaagtagtaca 3339716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 412 - 468
Target Start/End: Original strand, 3339294 - 3339350
Alignment:
412 agttgaggattggactgaaattttgtttcggaatatggttgctttggagcaatgtca 468  Q
    |||||| ||| |||| ||||||||||||||||||||||||||||||||||| |||||    
3339294 agttgacgatgggaccgaaattttgtttcggaatatggttgctttggagcagtgtca 3339350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108015 times since January 2019
Visitors: 1329