View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk48-8 (Length: 112)

Name: R108-tnk48-8
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk48-8
R108-tnk48-8
[»] chr7 (1 HSPs)
chr7 (24-112)||(6631409-6631497)


Alignment Details
Target: chr7 (Bit Score: 85; Significance: 5e-41; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 85; E-Value: 5e-41
Query Start/End: Original strand, 24 - 112
Target Start/End: Original strand, 6631409 - 6631497
Alignment:
24 aattctagaggcaagacacggcgataaggtttaaaattgaggtctgtaactgcaattctggttgtagcatacagattttaagatatttg 112  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6631409 aattcaagaggcaagacacggcgataaggtttaaaattgaggtctgtaactgcaattctggttgtagcatacagattttaagatatttg 6631497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 310958 times since January 2019
Visitors: 444