View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk48-9-i (Length: 389)

Name: R108-tnk48-9-i
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk48-9-i
R108-tnk48-9-i
[»] chr7 (2 HSPs)
chr7 (24-288)||(23149322-23149585)
chr7 (355-389)||(23149262-23149296)


Alignment Details
Target: chr7 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 24 - 288
Target Start/End: Original strand, 23149322 - 23149585
Alignment:
24 taaccatgatggggctctttatactattatggaaaatactccgtgcatttttcttgtgactaacaagattgaataatgggaagaataaatgtttattttt 123  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23149322 taaccatgatggggctctttatactattatggaaaatactccatgcatttttcttgtgactaacaagattgaataatgggaagaataaatgtttattttt 23149421  T
124 cgacaaatatagtgtaaag-aaaaaactatgtatctccaacatcattaaaattcaagattgaataatctagaatttggactttaatttatcaaataaaaa 222  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||    
23149422 cgacaaatatagtgtaaagaaaaaaactatgtatctccaacatcattaaaattcaagattgaataatctag-atttgtactttaatttatcaaataaaaa 23149520  T
223 tctgcatttttatagaatggtttgatcaaagaccggaatgtctactaatattattgaaaatataat 288  Q
    ||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||    
23149521 tctgcatttttatag-attgtttgatcaaagaccggaatgtctactaatattattgaaaatataat 23149585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 355 - 389
Target Start/End: Original strand, 23149262 - 23149296
Alignment:
355 gaattcgtacagatttaccaaagatatggatcaac 389  Q
    ||||||||| |||||||||||||||||||||||||    
23149262 gaattcgtatagatttaccaaagatatggatcaac 23149296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108341 times since January 2019
Visitors: 1329