View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk48-9-w (Length: 232)

Name: R108-tnk48-9-w
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk48-9-w
R108-tnk48-9-w
[»] chr1 (36 HSPs)
chr1 (1-215)||(26630389-26630603)
chr1 (46-133)||(7218086-7218173)
chr1 (32-134)||(4200186-4200288)
chr1 (28-134)||(9656603-9656709)
chr1 (27-119)||(27738206-27738298)
chr1 (51-119)||(35677453-35677521)
chr1 (51-131)||(44115919-44115999)
chr1 (28-96)||(49517023-49517091)
chr1 (32-79)||(7274005-7274052)
chr1 (46-105)||(25005837-25005896)
chr1 (30-101)||(34179916-34179987)
chr1 (28-134)||(4622046-4622152)
chr1 (28-134)||(44032010-44032116)
chr1 (28-97)||(1255479-1255548)
chr1 (28-80)||(36151570-36151622)
chr1 (28-79)||(15360847-15360898)
chr1 (28-79)||(15799657-15799708)
chr1 (46-105)||(17269221-17269280)
chr1 (46-105)||(25006074-25006133)
chr1 (29-103)||(6265048-6265122)
chr1 (32-122)||(6932984-6933074)
chr1 (28-134)||(31517751-31517857)
chr1 (51-129)||(33723398-33723476)
chr1 (32-101)||(4363676-4363745)
chr1 (28-105)||(5756726-5756803)
chr1 (28-69)||(14737781-14737822)
chr1 (46-98)||(23544686-23544739)
chr1 (28-129)||(25479534-25479635)
chr1 (28-69)||(26293182-26293223)
chr1 (28-73)||(35080142-35080187)
chr1 (54-119)||(44422678-44422743)
chr1 (28-97)||(48830124-48830193)
chr1 (34-118)||(49365788-49365870)
chr1 (28-119)||(30259512-30259604)
chr1 (28-129)||(38867847-38867950)
chr1 (32-92)||(40304107-40304167)
[»] chr7 (32 HSPs)
chr7 (28-134)||(28165044-28165150)
chr7 (55-134)||(38010694-38010773)
chr7 (29-104)||(46825052-46825127)
chr7 (28-134)||(40688997-40689103)
chr7 (32-105)||(28340884-28340957)
chr7 (28-120)||(30456475-30456567)
chr7 (31-105)||(5006549-5006623)
chr7 (46-119)||(44821930-44822003)
chr7 (28-79)||(35536060-35536111)
chr7 (28-75)||(39591537-39591584)
chr7 (28-130)||(12110313-12110415)
chr7 (28-134)||(48157131-48157237)
chr7 (28-97)||(992023-992092)
chr7 (28-105)||(21453247-21453324)
chr7 (46-119)||(29363489-29363562)
chr7 (39-119)||(6263389-6263469)
chr7 (32-120)||(22759143-22759231)
chr7 (28-79)||(49060493-49060544)
chr7 (28-130)||(27481309-27481411)
chr7 (37-119)||(27548225-27548307)
chr7 (32-73)||(1417221-1417262)
chr7 (46-119)||(3468585-3468658)
chr7 (61-134)||(4966142-4966215)
chr7 (56-105)||(18350747-18350796)
chr7 (30-79)||(23918912-23918961)
chr7 (89-134)||(39280983-39281028)
chr7 (57-134)||(40439036-40439113)
chr7 (46-134)||(22283755-22283843)
chr7 (28-72)||(30496657-30496701)
chr7 (56-124)||(30812129-30812197)
chr7 (28-76)||(45593788-45593836)
chr7 (51-119)||(47177612-47177680)
[»] chr8 (27 HSPs)
chr8 (28-119)||(13652168-13652259)
chr8 (28-119)||(13710811-13710902)
chr8 (28-134)||(4558751-4558857)
chr8 (28-134)||(12361145-12361251)
chr8 (25-130)||(11795042-11795147)
chr8 (46-134)||(43569131-43569219)
chr8 (28-79)||(13561378-13561429)
chr8 (32-119)||(30013175-30013262)
chr8 (34-129)||(38036128-38036223)
chr8 (52-134)||(38874623-38874705)
chr8 (46-119)||(6509329-6509402)
chr8 (28-129)||(11188171-11188272)
chr8 (28-105)||(31884547-31884624)
chr8 (27-119)||(34551072-34551164)
chr8 (28-97)||(35016536-35016606)
chr8 (83-134)||(43504759-43504810)
chr8 (51-117)||(9836882-9836948)
chr8 (89-134)||(2458577-2458622)
chr8 (28-73)||(25867039-25867084)
chr8 (41-78)||(32157074-32157111)
chr8 (36-105)||(34770853-34770922)
chr8 (46-98)||(787153-787205)
chr8 (78-134)||(20672753-20672809)
chr8 (30-114)||(31915300-31915384)
chr8 (28-104)||(34080307-34080383)
chr8 (28-72)||(37220269-37220313)
chr8 (27-79)||(42237488-42237540)
[»] chr5 (29 HSPs)
chr5 (28-139)||(28586772-28586883)
chr5 (28-134)||(39105417-39105523)
chr5 (28-134)||(14295459-14295565)
chr5 (46-119)||(41957477-41957550)
chr5 (28-119)||(32172606-32172697)
chr5 (51-96)||(40159795-40159840)
chr5 (31-115)||(12975303-12975387)
chr5 (28-116)||(18875314-18875402)
chr5 (28-134)||(37588371-37588477)
chr5 (46-119)||(35553214-35553287)
chr5 (51-107)||(7319382-7319438)
chr5 (55-119)||(32408618-32408682)
chr5 (30-98)||(39141923-39141991)
chr5 (46-105)||(3951586-3951645)
chr5 (32-79)||(4855655-4855702)
chr5 (54-129)||(16328845-16328919)
chr5 (28-134)||(9202759-9202865)
chr5 (28-134)||(37526210-37526316)
chr5 (28-93)||(6582884-6582949)
chr5 (46-119)||(12425542-12425615)
chr5 (29-98)||(26516354-26516423)
chr5 (89-134)||(30217096-30217141)
chr5 (51-132)||(38036072-38036153)
chr5 (28-93)||(42569032-42569097)
chr5 (31-79)||(2933717-2933765)
chr5 (28-68)||(10303754-10303794)
chr5 (28-72)||(12595813-12595857)
chr5 (34-114)||(38047886-38047966)
chr5 (28-112)||(42583102-42583186)
[»] chr2 (29 HSPs)
chr2 (28-136)||(42817385-42817493)
chr2 (35-134)||(11513858-11513957)
chr2 (55-134)||(22681196-22681275)
chr2 (28-134)||(25790079-25790185)
chr2 (38-107)||(18066091-18066160)
chr2 (32-120)||(18962063-18962151)
chr2 (28-79)||(3673760-3673811)
chr2 (28-79)||(37053547-37053598)
chr2 (29-127)||(15377719-15377817)
chr2 (42-107)||(1625867-1625932)
chr2 (32-105)||(28933781-28933854)
chr2 (35-80)||(41851968-41852013)
chr2 (28-104)||(17952742-17952818)
chr2 (28-80)||(33192146-33192198)
chr2 (51-118)||(8017410-8017477)
chr2 (51-134)||(43141847-43141930)
chr2 (29-119)||(33256694-33256784)
chr2 (51-105)||(37276722-37276776)
chr2 (57-134)||(3078651-3078728)
chr2 (28-105)||(10143125-10143202)
chr2 (28-69)||(29633025-29633066)
chr2 (23-68)||(37518901-37518946)
chr2 (46-131)||(43173193-43173278)
chr2 (26-98)||(6988066-6988138)
chr2 (28-80)||(11344349-11344401)
chr2 (46-134)||(15866679-15866767)
chr2 (46-134)||(28039343-28039431)
chr2 (62-134)||(39983329-39983401)
chr2 (55-119)||(43205289-43205353)
[»] chr6 (28 HSPs)
chr6 (28-134)||(24782012-24782118)
chr6 (28-118)||(33787772-33787862)
chr6 (31-134)||(281859-281962)
chr6 (28-93)||(29274281-29274346)
chr6 (57-133)||(8364988-8365064)
chr6 (58-129)||(28088238-28088309)
chr6 (28-105)||(1402949-1403026)
chr6 (28-119)||(24836228-24836316)
chr6 (70-134)||(8010352-8010416)
chr6 (28-99)||(4006667-4006738)
chr6 (28-79)||(6310290-6310341)
chr6 (54-105)||(22691560-22691611)
chr6 (32-103)||(22742323-22742394)
chr6 (28-107)||(24476555-24476634)
chr6 (65-131)||(3168275-3168341)
chr6 (28-130)||(9093571-9093673)
chr6 (28-98)||(25099996-25100066)
chr6 (65-134)||(6014525-6014594)
chr6 (30-79)||(10150318-10150367)
chr6 (32-105)||(14492259-14492332)
chr6 (46-119)||(25426141-25426214)
chr6 (25-134)||(30784507-30784615)
chr6 (28-69)||(31583654-31583695)
chr6 (89-138)||(32577993-32578042)
chr6 (46-103)||(33828617-33828674)
chr6 (28-119)||(6647342-6647431)
chr6 (33-73)||(7713983-7714023)
chr6 (25-73)||(29940746-29940794)
[»] chr3 (24 HSPs)
chr3 (38-134)||(41452486-41452582)
chr3 (46-112)||(1217833-1217899)
chr3 (28-130)||(24887298-24887400)
chr3 (28-134)||(38462234-38462340)
chr3 (28-79)||(43079695-43079746)
chr3 (28-134)||(36646393-36646499)
chr3 (28-134)||(45432950-45433056)
chr3 (51-119)||(37273107-37273178)
chr3 (28-92)||(1395624-1395688)
chr3 (30-134)||(28306113-28306217)
chr3 (46-133)||(21367638-21367725)
chr3 (28-98)||(3365358-3365428)
chr3 (28-98)||(29600772-29600842)
chr3 (28-98)||(52618956-52619026)
chr3 (28-73)||(10101548-10101593)
chr3 (28-73)||(10212473-10212518)
chr3 (34-75)||(33307650-33307691)
chr3 (28-73)||(49586988-49587033)
chr3 (28-77)||(51278225-51278274)
chr3 (28-72)||(15304420-15304464)
chr3 (67-119)||(24158529-24158581)
chr3 (28-112)||(33405200-33405284)
chr3 (51-119)||(48286836-48286904)
chr3 (83-127)||(49465683-49465727)
[»] chr4 (32 HSPs)
chr4 (28-134)||(54325048-54325154)
chr4 (32-105)||(10192241-10192314)
chr4 (52-129)||(18628559-18628636)
chr4 (29-101)||(3175905-3175977)
chr4 (43-134)||(7694021-7694112)
chr4 (48-107)||(20907320-20907379)
chr4 (28-126)||(19154699-19154797)
chr4 (28-97)||(4071835-4071904)
chr4 (28-93)||(8130127-8130192)
chr4 (46-103)||(24091434-24091491)
chr4 (29-134)||(30207582-30207686)
chr4 (46-95)||(31038917-31038966)
chr4 (26-94)||(53626727-53626795)
chr4 (52-119)||(2996550-2996617)
chr4 (63-114)||(8147880-8147931)
chr4 (28-79)||(21952914-21952965)
chr4 (46-129)||(26883966-26884049)
chr4 (28-79)||(30024653-30024704)
chr4 (28-134)||(30338602-30338709)
chr4 (60-127)||(36722687-36722754)
chr4 (28-79)||(49219092-49219143)
chr4 (28-134)||(6364102-6364208)
chr4 (51-133)||(21157744-21157826)
chr4 (28-102)||(26520272-26520346)
chr4 (28-132)||(49803164-49803265)
chr4 (57-134)||(17975380-17975457)
chr4 (89-134)||(19429723-19429768)
chr4 (77-134)||(21043246-21043303)
chr4 (46-119)||(23819060-23819133)
chr4 (28-117)||(44319903-44319991)
chr4 (54-134)||(43824262-43824342)
chr4 (28-132)||(45128323-45128427)
[»] scaffold0508 (1 HSPs)
scaffold0508 (28-78)||(9842-9892)
[»] scaffold0654 (1 HSPs)
scaffold0654 (28-119)||(6663-6754)
[»] scaffold0014 (1 HSPs)
scaffold0014 (28-119)||(116582-116673)
[»] scaffold0024 (1 HSPs)
scaffold0024 (28-72)||(27529-27573)


Alignment Details
Target: chr1 (Bit Score: 143; Significance: 3e-75; HSPs: 36)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 26630389 - 26630603
Alignment:
1 tcatataggttcttaagtaaacatctttttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcct 100  Q
    |||||||  ||||||||||||||||| |||||||||||||||||||||| |||| |||||||||||||||||| ||||||| ||||||||| ||||||||    
26630389 tcatataacttcttaagtaaacatctatttctataacaaaaaatgaaataaagtaaaattgttttcatataagctataaactgttttgatacgctatcct 26630488  T
101 ggagaacatatggaaataaacttaaaacagcttaaggatgttggttctttaagctctcctgaatagtctcgtaagtatttatgccaatagattagtttaa 200  Q
    ||||||||||||||||||||||||||| ||||| ||||||||| |||||||||||||| | ||||||||||||||| ||| ||| | |||||||||||||    
26630489 ggagaacatatggaaataaacttaaaaaagctttaggatgttgattctttaagctctcttaaatagtctcgtaagtgtttttgcgagtagattagtttaa 26630588  T
201 ataattaaatccaaa 215  Q
    |||| ||||||||||    
26630589 ataagtaaatccaaa 26630603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 46 - 133
Target Start/End: Complemental strand, 7218173 - 7218086
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctt 133  Q
    |||| ||||||||||||||||||||||| |||||   ||||| |||| |||||||||||||| |||| ||||||  | ||||||||||    
7218173 aaataaagtcaaattgttttcatataagctataagttgttttcataacctatcctggagaacttatgaaaataagttgaaaacagctt 7218086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 32 - 134
Target Start/End: Original strand, 4200186 - 4200288
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagc 131  Q
    |||||||||| || |||| ||||||| ||||||||||||||| |||| |  |||||  |||| ||||||||||  | |||| |||||| |||||||||||    
4200186 tataacaaaagataaaataaagtcaagttgttttcatataagctatatattgttttcgtaagatatcctggagggcttatgaaaataagcttaaaacagc 4200285  T
132 tta 134  Q
    |||    
4200286 tta 4200288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 134
Target Start/End: Original strand, 9656603 - 9656709
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||| |||||||| |||| |||| ||||| |||||||||||| ||||| | || || |||||||||||||||  |  |||| |||||| || ||||    
9656603 tttctatagcaaaaaataaaataaagttaaattattttcatataagctataagctgtgttcataagctatcctggatgaattatgaaaataagctcaaaa 9656702  T
128 cagctta 134  Q
    |||||||    
9656703 cagctta 9656709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 27 - 119
Target Start/End: Complemental strand, 27738298 - 27738206
Alignment:
27 ttttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    ||||||| ||||||| || |||| ||||||||||||||||||||||| |||||   ||||| ||||||||| | ||||| | |||||| ||||    
27738298 ttttctacaacaaaagataaaataaagtcaaattgttttcatataagctataatttgttttcataagctatacaggagagcttatggatataa 27738206  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 119
Target Start/End: Original strand, 35677453 - 35677521
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    ||||||||||||| | |||||| |||||||| ||||| | ||||||||||| ||||| |||||||||||    
35677453 aagtcaaattgttattatataacttataaactgttttcacaagctatcctgaagaacttatggaaataa 35677521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 51 - 131
Target Start/End: Complemental strand, 44115999 - 44115919
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagc 131  Q
    ||||||||||||||||||||||  ||||||| ||||| ||||||| || |||||| | ||||  |||||||| ||||||||    
44115999 aagtcaaattgttttcatataacatataaactgtttttataagctgtcttggagagcgtatgagaataaactgaaaacagc 44115919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 96
Target Start/End: Original strand, 49517023 - 49517091
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagcta 96  Q
    |||||||||||||| || |||| |||||||||||||||||| |||| ||||| | ||||| ||||||||    
49517023 tttctataacaaaagataaaataaagtcaaattgttttcatttaagctataagctgttttcataagcta 49517091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 79
Target Start/End: Complemental strand, 7274052 - 7274005
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    |||||||||| ||||||| ||||||||||||||||||| |||||||||    
7274052 tataacaaaagatgaaataaagtcaaattgttttcatacaagttataa 7274005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 46 - 105
Target Start/End: Complemental strand, 25005896 - 25005837
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||||||||||| ||||||||||||||| |||||   ||||| |||||||||||||||||    
25005896 aaatgaagtcaacttgttttcatataagctataagttgttttcataagctatcctggaga 25005837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 30 - 101
Target Start/End: Complemental strand, 34179987 - 34179916
Alignment:
30 tctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctg 101  Q
    |||||||||||| || |||| ||||||||||||||| || |||| ||||||| ||||| |||| ||||||||    
34179987 tctataacaaaagataaaataaagtcaaattgttttaatctaagctataaactgttttcataaactatcctg 34179916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 134
Target Start/End: Original strand, 4622046 - 4622152
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||||||||| || ||||||| ||||| | |||||||||||| ||||| | ||||  ||| |||||| |||||| | | || |||||| || ||||    
4622046 tttctataacaaaagatcaaatgaattcaaactcttttcatataagctataagctgtttccatatgctatcttggagagcttgtgaaaataagctaaaaa 4622145  T
128 cagctta 134  Q
    |||||||    
4622146 cagctta 4622152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 134
Target Start/End: Complemental strand, 44032116 - 44032010
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||||||||||||  | |||| ||||||||||||||||||||||| |||||||  ||||  |||| |||| || ||| | ||||||||| | || ||||    
44032116 tttctataacaaaagctaaaataaagtcaaattgttttcatataagctataaactattttcttaagttatcttgaagagcttatggaaattagctgaaaa 44032017  T
128 cagctta 134  Q
     ||||||    
44032016 tagctta 44032010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 97
Target Start/End: Complemental strand, 1255548 - 1255479
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctat 97  Q
    ||||||||  |||| |||||||||||||||||| |||||||| ||||||||| | ||||| || ||||||    
1255548 tttctatagtaaaagatgaaatgaagtcaaattcttttcatacaagttataagctgttttcattagctat 1255479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 80
Target Start/End: Complemental strand, 36151622 - 36151570
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaa 80  Q
    |||| ||||||||| || |||| |||||||||||||||| |||||||||||||    
36151622 tttcaataacaaaagataaaataaagtcaaattgttttcgtataagttataaa 36151570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 15360847 - 15360898
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    |||||||||||||| || |||| |||||||| |||||||||||||| |||||    
15360847 tttctataacaaaagataaaataaagtcaaactgttttcatataagctataa 15360898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 15799657 - 15799708
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    ||||| |||||||||| ||||| |||||||| |||||||||||||| |||||    
15799657 tttctttaacaaaaaaagaaataaagtcaaactgttttcatataagctataa 15799708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 105
Target Start/End: Original strand, 17269221 - 17269280
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||| |||||||||||||||||||||||  ||||   ||||| |||||||||||||||||    
17269221 aaataaagtcaaattgttttcatataagcaataagttgttttcataagctatcctggaga 17269280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 105
Target Start/End: Complemental strand, 25006133 - 25006074
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||| ||||||||||||||||||||||| |||||   ||||| |||||||||| ||||||    
25006133 aaataaagtcaaattgttttcatataagctataagttgttttcataagctatcttggaga 25006074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 103
Target Start/End: Original strand, 6265048 - 6265122
Alignment:
29 ttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctgga 103  Q
    |||||||||||||||| |||| ||||||||||||||| | || |  ||||| ||||||| ||||| |||| ||||    
6265048 ttctataacaaaaaataaaataaagtcaaattgtttttacattaactataagccgttttcataagttatcatgga 6265122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 122
Target Start/End: Complemental strand, 6933074 - 6932984
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaact 122  Q
    |||||||||| || |||| ||||||||||||||||||| ||||||| |    |||| ||||| | ||||| ||| | ||||||||||||||    
6933074 tataacaaaacataaaataaagtcaaattgttttcatagaagttattagttcttttcataagttgtcctgaagagcttatggaaataaact 6932984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 134
Target Start/End: Complemental strand, 31517857 - 31517751
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||| ||||||| || |||| |||| |||||| ||||||||||| ||||| | || || |||| || || |||||| | |||| |||||| || ||||    
31517857 tttctacaacaaaagataaaataaagttaaattgatttcatataagctataagctgtcttcataatctgtcttggagagcttatgaaaataagctgaaaa 31517758  T
128 cagctta 134  Q
    |||||||    
31517757 cagctta 31517751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 129
Target Start/End: Complemental strand, 33723476 - 33723398
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaaca 129  Q
    ||||||||||||||||||||||  ||| ||| ||||| |||||||| |||| | | | ||||||||||| || ||||||    
33723476 aagtcaaattgttttcatataaactatgaactgttttcataagctaccctgtaaagcttatggaaataagctgaaaaca 33723398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 101
Target Start/End: Complemental strand, 4363745 - 4363676
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctg 101  Q
    |||||||||| || |||| | |||||| |||||||||||||| ||||| |  |||| |||||||||||||    
4363745 tataacaaaagattaaataatgtcaaactgttttcatataagctataacctattttcataagctatcctg 4363676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 105
Target Start/End: Complemental strand, 5756803 - 5756726
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||||||||||||| |||| || |||| ||| ||||||||||||| ||||||   |||||  ||||||| ||||||||    
5756803 tttctataacaaaagatgatataaagttaaactgttttcatataaattataagttgttttcgtaagctagcctggaga 5756726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 69
Target Start/End: Complemental strand, 14737822 - 14737781
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcata 69  Q
    |||||||||||||| || |||| |||||||||||||||||||    
14737822 tttctataacaaaagataaaataaagtcaaattgttttcata 14737781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 98
Target Start/End: Complemental strand, 23544739 - 23544686
Alignment:
46 aaatgaagtcaaattgttttcatataagtta-taaaccgttttgataagctatc 98  Q
    |||| ||||||||||||||||||||||| || ||||| ||||| ||||||||||    
23544739 aaattaagtcaaattgttttcatataagctattaaactgttttcataagctatc 23544686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 129
Target Start/End: Original strand, 25479534 - 25479635
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||||| ||| || |||| | |||||||||| |||||||| | |||||   ||||| |||||||||||| |||| | |||| |||||| || ||||    
25479534 tttctataaccaaagataaaataacgtcaaattgtcttcatataggctataagttgttttcataagctatcctagagagcttatgaaaataagctgaaaa 25479633  T
128 ca 129  Q
    ||    
25479634 ca 25479635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 69
Target Start/End: Complemental strand, 26293223 - 26293182
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcata 69  Q
    ||||||||||||||| | |||| |||||||||||||||||||    
26293223 tttctataacaaaaagtaaaataaagtcaaattgttttcata 26293182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 73
Target Start/End: Complemental strand, 35080187 - 35080142
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataag 73  Q
    ||||||||||||||||| |||| |||||||| ||||| ||||||||    
35080187 tttctataacaaaaaataaaataaagtcaaactgtttccatataag 35080142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 54 - 119
Target Start/End: Original strand, 44422678 - 44422743
Alignment:
54 tcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    ||||| |||||||||||||| ||||| |  |||| ||||||||||||||||| | |||| ||||||    
44422678 tcaaactgttttcatataagctataagctatttttataagctatcctggagagcttatgaaaataa 44422743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 97
Target Start/End: Complemental strand, 48830193 - 48830124
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctat 97  Q
    ||||||| || ||| || |||| |||||||| | |||||||||||| ||||||| ||||| |||||||||    
48830193 tttctattaccaaagataaaataaagtcaaactattttcatataagctataaactgttttcataagctat 48830124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 34 - 118
Target Start/End: Complemental strand, 49365870 - 49365788
Alignment:
34 taacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaata 118  Q
    |||||||| || ||||  |||||||||||||||||| ||| ||||||| ||||  |||||||||| || ||| | ||||||||||    
49365870 taacaaaagataaaatagagtcaaattgttttcatacaagctataaactgttt--ataagctatcttgaagagcttatggaaata 49365788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 119
Target Start/End: Complemental strand, 30259604 - 30259512
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgat-aagctatcctggagaacatatggaaataa 119  Q
    |||||||||||||| || |||| |||||||| || ||| ||||||| ||||| | ||||  || |||||||| |||||| | |||||||||||    
30259604 tttctataacaaaatataaaataaagtcaaactgctttgatataagctataagctgtttgcataaagctatcatggagagcttatggaaataa 30259512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 129
Target Start/End: Complemental strand, 38867950 - 38867847
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttca--tataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaa 125  Q
    |||||||| ||||| || |||| |||||||| ||||||||  |||||| | ||||| ||||| ||||| |||| || ||||| |||| |||||| || ||    
38867950 tttctataccaaaagattaaataaagtcaaaatgttttcatatataagctttaaactgttttcataagttatcttgaagaacttatgaaaataagctaaa 38867851  T
126 aaca 129  Q
    ||||    
38867850 aaca 38867847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 92
Target Start/End: Complemental strand, 40304167 - 40304107
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataa 92  Q
    |||||||||| || |||| || ||| |||||||||||||||||||||| | ||||| ||||    
40304167 tataacaaaagataaaataaaatcacattgttttcatataagttataagctgttttcataa 40304107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 55; Significance: 9e-23; HSPs: 32)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 28 - 134
Target Start/End: Original strand, 28165044 - 28165150
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||||||||| || |||||||||||||||||||| ||||||| ||||||| || || |||||||||| |||||| | |||||||||||  | ||||    
28165044 tttctataacaaaagataaaatgaagtcaaattgttttaatataagctataaactgtctttataagctatcatggagagcttatggaaataagttgaaaa 28165143  T
128 cagctta 134  Q
    |||||||    
28165144 cagctta 28165150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 55 - 134
Target Start/End: Original strand, 38010694 - 38010773
Alignment:
55 caaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||||||||||||||||| ||||| | ||||| |||| ||||||| |||||| ||||||||||| || |||||||||||    
38010694 caaattgttttcatataagctataagctgttttcataatctatcctagagaacttatggaaataagctaaaaacagctta 38010773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 29 - 104
Target Start/End: Original strand, 46825052 - 46825127
Alignment:
29 ttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggag 104  Q
    |||||||| |||| || |||| |||||||||||||||||||||||  |||||||||||| |||||||||| |||||    
46825052 ttctataaaaaaagataaaataaagtcaaattgttttcatataagccataaaccgttttcataagctatcttggag 46825127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 134
Target Start/End: Complemental strand, 40689103 - 40688997
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||| ||||| || |||| |||| ||||| |||||||||||| ||||| | || || ||||||||||||||| ||| |||| |||||| || ||||    
40689103 tttctatagcaaaagataaaataaagttaaattattttcatataagctataagctgtgttcataagctatcctggataacttatgaaaataagctcaaaa 40689004  T
128 cagctta 134  Q
    |||||||    
40689003 cagctta 40688997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 32 - 105
Target Start/End: Complemental strand, 28340957 - 28340884
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    ||||| |||| ||||||||||||||||||||| ||||||||| ||||| | ||||| |||||||||||| ||||    
28340957 tataataaaagatgaaatgaagtcaaattgttgtcatataagctataagctgttttcataagctatcctagaga 28340884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 28 - 120
Target Start/End: Complemental strand, 30456567 - 30456475
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaa 120  Q
    |||||| ||||||| || |||| |||||||||||||||||||||||||||||   ||||| |||| ||||| |||||| | |||| |||||||    
30456567 tttctaaaacaaaagataaaataaagtcaaattgttttcatataagttataagtggttttcataaactatcttggagagcttatgaaaataaa 30456475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 31 - 105
Target Start/End: Complemental strand, 5006623 - 5006549
Alignment:
31 ctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    ||||||||||| || |||| |||||||| |||||||||||||| ||||||  ||||| |||||||| ||||||||    
5006623 ctataacaaaagataaaataaagtcaaactgttttcatataaggtataaattgttttcataagctaccctggaga 5006549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 46 - 119
Target Start/End: Original strand, 44821930 - 44822003
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||| |||||||||||||||  |||||||||||| | ||||| ||||||||| ||||||||| |||| ||||||    
44821930 aaataaagtcaaattgtttttgtataagttataagctgttttcataagctattctggagaacttatgaaaataa 44822003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 35536060 - 35536111
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    ||||||||||| || || |||| |||||||||||||||||||||||||||||    
35536060 tttctataacataagataaaataaagtcaaattgttttcatataagttataa 35536111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 75
Target Start/End: Complemental strand, 39591584 - 39591537
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagtt 75  Q
    |||||||||||||| || |||| |||||||||||||||||||||||||    
39591584 tttctataacaaaagataaaataaagtcaaattgttttcatataagtt 39591537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 130
Target Start/End: Original strand, 12110313 - 12110415
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||||| ||| || || |||| |||||||||||||||  |||||| ||||| | ||||| |||||||||| || ||||| |||| |||||| || ||||    
12110313 tttctattacacaagataaaataaagtcaaattgttttggtataagctataagctgttttcataagctatcttgaagaacttatgaaaataatctaaaaa 12110412  T
128 cag 130  Q
    |||    
12110413 cag 12110415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 134
Target Start/End: Complemental strand, 48157237 - 48157131
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||||||| |||| || |||| |||| |||||||||| ||||||| |||||   ||||| | ||||||| | ||||| | ||||||||||| || ||||    
48157237 tttctataataaaagataaaataaagtgaaattgttttaatataagctataatttgttttcacaagctattcgggagatcttatggaaataagctgaaaa 48157138  T
128 cagctta 134  Q
    |||||||    
48157137 cagctta 48157131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 97
Target Start/End: Original strand, 992023 - 992092
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctat 97  Q
    ||||||||||||||||| |||| ||| |||| | |||||||||||| |||||||  |||| |||||||||    
992023 tttctataacaaaaaataaaataaagacaaaatattttcatataaggtataaacttttttcataagctat 992092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 105
Target Start/End: Original strand, 21453247 - 21453324
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    ||||| |||||||| || | || ||||||| ||||| ||||||||| ||||||| ||||| |||||||||||| ||||    
21453247 tttctgtaacaaaagataagataaagtcaagttgttctcatataagctataaactgttttcataagctatcctagaga 21453324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 119
Target Start/End: Original strand, 29363489 - 29363562
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||| |||||||| ||||||||||| |||||||| | ||| | ||||| ||||||||||| | |||||||||||    
29363489 aaataaagtcaaactgttttcatattagttataagctgttatcataagttatcctggagagcttatggaaataa 29363562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 39 - 119
Target Start/End: Complemental strand, 6263469 - 6263389
Alignment:
39 aaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||||| |||| || | |||| ||||||||||||||||||| | | ||| |||||||||  |||||| |||||||||||||    
6263469 aaaaataaaattaaataaaatggttttcatataagttataagctgatttcataagctattatggagagcatatggaaataa 6263389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 32 - 120
Target Start/End: Original strand, 22759143 - 22759231
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaa 120  Q
    |||||||||| || |||| |||  |||||||||||||||||| || || | | ||| ||||||||||| ||||| | ||||||||||||    
22759143 tataacaaaagataaaataaaggaaaattgttttcatataagctaaaagctgatttcataagctatccaggagagcttatggaaataaa 22759231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 49060493 - 49060544
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    ||||||||||||||||| |||| |||||||||| |||| ||||||| |||||    
49060493 tttctataacaaaaaataaaataaagtcaaattatttttatataagctataa 49060544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 130
Target Start/End: Complemental strand, 27481411 - 27481309
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||||||||  || ||| ||||||||| ||||| |||||||| |||||    |||| |||||||||| |||| | | |||||||||||||  ||||    
27481411 tttctataacaaaggataaaacgaagtcaaactgtttccatataagctataagttattttcataagctatcatggatagcttatggaaataaacccaaaa 27481312  T
128 cag 130  Q
    |||    
27481311 cag 27481309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 119
Target Start/End: Original strand, 27548225 - 27548307
Alignment:
37 caaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    ||||| || |||| ||||| |||||||||||| |||| ||||| | ||||| |||||||||| |||| ||| |||||| ||||    
27548225 caaaagataaaataaagtctaattgttttcatttaagctataagctgttttcataagctatcttggataacttatggagataa 27548307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 73
Target Start/End: Original strand, 1417221 - 1417262
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataag 73  Q
    |||||||||| || |||| |||||||||||||||||||||||    
1417221 tataacaaaagataaaataaagtcaaattgttttcatataag 1417262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 119
Target Start/End: Original strand, 3468585 - 3468658
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    ||||||||||||| | ||||| |||||||||||| |  |||| |||| ||||||| |||||| | |||||||||    
3468585 aaatgaagtcaaactattttcgtataagttataagcttttttcataatctatcctagagaacttgtggaaataa 3468658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 61 - 134
Target Start/End: Original strand, 4966142 - 4966215
Alignment:
61 gttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||||||||| || ||||| | ||||| |||||| |||||| ||| | |||||||||||||| |||||| ||||    
4966142 gttttcatattaggtataagctgttttcataagccatcctgaagagcttatggaaataaactgaaaacaactta 4966215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 56 - 105
Target Start/End: Complemental strand, 18350796 - 18350747
Alignment:
56 aaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    ||||||||||| |||||||||||| | ||||| |||||||||| ||||||    
18350796 aaattgttttcgtataagttataagctgttttcataagctatcatggaga 18350747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 30 - 79
Target Start/End: Original strand, 23918912 - 23918961
Alignment:
30 tctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    ||||| |||||| || |||| ||||||||||||||||||||||| |||||    
23918912 tctattacaaaagataaaataaagtcaaattgttttcatataagctataa 23918961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 89 - 134
Target Start/End: Original strand, 39280983 - 39281028
Alignment:
89 ataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||||||||| |||||||||||||||||||| || |||||| ||||    
39280983 ataagctatcttggagaacatatggaaataagctgaaaacaactta 39281028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 134
Target Start/End: Original strand, 40439036 - 40439113
Alignment:
57 aattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||||||||||||| |||||||   ||||| || |||||||||| ||| | |||||||||||  | |||||||||||    
40439036 aattgttttcatatatgttataagttgttttcattagctatcctgaagagcttatggaaataagttaaaaacagctta 40439113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 134
Target Start/End: Complemental strand, 22283843 - 22283755
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||| |||| ||||||||||  ||| || ||||||| ||||| |||| | ||| | |||||| ||||||||||| || |||||||||||    
22283843 aaataaagttaaattgtttttgtatcagctataaactgttttcataaaccatcttagagaacttatggaaataagctgaaaacagctta 22283755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 72
Target Start/End: Original strand, 30496657 - 30496701
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataa 72  Q
    |||||||||||||| || |||| |||||||||||||||| |||||    
30496657 tttctataacaaaatataaaataaagtcaaattgttttcgtataa 30496701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 124
Target Start/End: Original strand, 30812129 - 30812197
Alignment:
56 aaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaactta 124  Q
    ||||||||||| |||||| ||||| | ||||| || ||||||| |||||| | ||||||||||| ||||    
30812129 aaattgttttcgtataagctataagctgttttcattagctatcatggagagcttatggaaataagctta 30812197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 76
Target Start/End: Complemental strand, 45593836 - 45593788
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagtta 76  Q
    ||||| |||||||| || |||| |||||||| |||||||||||||||||    
45593836 tttctgtaacaaaacataaaataaagtcaaactgttttcatataagtta 45593788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 119
Target Start/End: Original strand, 47177612 - 47177680
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||| |||||||||||||||||| ||||| | ||||| | |||||||| |||||||  |||| ||||||    
47177612 aagttaaattgttttcatataagctataagctgttttcaaaagctatcttggagaatttatgaaaataa 47177680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 48; Significance: 1e-18; HSPs: 27)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 28 - 119
Target Start/End: Original strand, 13652168 - 13652259
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||||||| ||||| ||| |||||||| |||||||||||||||||||||||||  ||||| ||||||||| ||||||| | || ||||||||    
13652168 tttctatagcaaaagatggaatgaagtgaaattgttttcatataagttataaattgtttttataagctattctggagagcttaaggaaataa 13652259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 28 - 119
Target Start/End: Original strand, 13710811 - 13710902
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||||||| ||||| ||| |||||||| |||||||||||||||||||||||||  ||||| ||||||||| ||||||| | || ||||||||    
13710811 tttctatagcaaaagatggaatgaagtgaaattgttttcatataagttataaattgtttttataagctattctggagagcttaaggaaataa 13710902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 134
Target Start/End: Original strand, 4558751 - 4558857
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||||||| |||| || |||| |||| ||||| |||||||||| | ||||| | ||||  |||||||||||| |||| | |||||||||||||| ||||    
4558751 tttctataataaaagataaaataaagttaaattattttcatatatgctataagctgtttccataagctatcctagagagcttatggaaataaactaaaaa 4558850  T
128 cagctta 134  Q
    || ||||    
4558851 caactta 4558857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 134
Target Start/End: Original strand, 12361145 - 12361251
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||||  ||| || |||||||||||||||||||||||||||| ||||| | ||||| ||||| ||| | ||||| |  ||||||||||  | ||||    
12361145 tttctataaataaagataaaatgaagtcaaattgttttcatataagctataagctgttttcataagttattcaggagagctaatggaaataagttgaaaa 12361244  T
128 cagctta 134  Q
    |||||||    
12361245 cagctta 12361251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 25 - 130
Target Start/End: Original strand, 11795042 - 11795147
Alignment:
25 ctttttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaactta 124  Q
    |||||||||| |||||| ||  ||| |||||| | |||||||||||||||||||| | | ||| |||||||||  |||||| | ||||||||||| || |    
11795042 ctttttctatgacaaaacatacaataaagtcacactgttttcatataagttataagctgatttcataagctattatggagagcttatggaaataagctga 11795141  T
125 aaacag 130  Q
    ||||||    
11795142 aaacag 11795147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 46 - 134
Target Start/End: Original strand, 43569131 - 43569219
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||| |||||||| ||||||| |||||| |||||||| |||  |||||||||||||||||||  |||||||| |  | |||||||||||    
43569131 aaattaagtcaaaatgttttcctataagctataaaccatttccataagctatcctggagaactaatggaaattagttgaaaacagctta 43569219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 79
Target Start/End: Complemental strand, 13561429 - 13561378
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    ||||||||||| ||||| |||| |||||||||||||||||||||| ||||||    
13561429 tttctataacagaaaattaaataaagtcaaattgttttcatataaattataa 13561378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 32 - 119
Target Start/End: Original strand, 30013175 - 30013262
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    ||||||||||  | |||| |||||||| ||||| |||||||| ||||| | ||||| ||||||||||||| |||||  ||||||||||    
30013175 tataacaaaaggtcaaattaagtcaaactgtttccatataagctataagctgttttcataagctatcctgtagaactaatggaaataa 30013262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 129
Target Start/End: Complemental strand, 38036223 - 38036128
Alignment:
34 taacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaaca 129  Q
    ||||||||||| |||| || ||||||||||||  | |||| ||||||| |||||||| ||||||| |||||| | ||| ||||||| || ||||||    
38036223 taacaaaaaataaaataaattcaaattgtttttgtgtaagctataaactgttttgattagctatcttggagagcttattgaaataagctgaaaaca 38036128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 52 - 134
Target Start/End: Original strand, 38874623 - 38874705
Alignment:
52 agtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||||||| |||||||||||| | ||| | ||||| |||||||||  ||||||||||||| |||||| || |||| ||||||    
38874623 agtcaaattcttttcatataagctctaagctgttttcataagctattttggagaacatatgaaaataagctaaaaatagctta 38874705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 119
Target Start/End: Complemental strand, 6509402 - 6509329
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||| |||||||||||| || ||||||| ||||| | ||||| ||||||||||||||||| | ||| |||||||    
6509402 aaataaagtcaaattgtatttatataagctataagctgttttcataagctatcctggagagcttattgaaataa 6509329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 129
Target Start/End: Complemental strand, 11188272 - 11188171
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||||||||| || |||| ||  |||| | |||| |||| ||||||||||  ||||||||||||||||| ||||   ||||| |||||||| ||||    
11188272 tttctataacaaaagataaaataaaaccaaactatttttatattagttataaactattttgataagctatcctagagagtttatggtaataaactgaaaa 11188173  T
128 ca 129  Q
    ||    
11188172 ca 11188171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 105
Target Start/End: Original strand, 31884547 - 31884624
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||||||||||||| || |||| || |  ||||||||||||||||| ||||||  ||||| |||||||||| ||||||    
31884547 tttctataacaaaatataaaatcaaattgaattgttttcatataagctataaattgttttcataagctatcatggaga 31884624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 27 - 119
Target Start/End: Original strand, 34551072 - 34551164
Alignment:
27 ttttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||| |||||||||| || | || |||||||||||||||||| ||||||||||   |||||  |||| ||||||||||| | |||| ||||||    
34551072 ttttatataacaaaagataacatcaagtcaaattgttttcatttaagttataagttgttttcttaagttatcctggagagcttatgaaaataa 34551164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 97
Target Start/End: Original strand, 35016536 - 35016606
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataag---ttataaaccgttttgataagctat 97  Q
    ||||||||||||||  | ||||||||||||| ||||||||||||||   |||||||| ||||| |||||||||    
35016536 tttctataacaaaa--ttaaatgaagtcaaaatgttttcatataagttattataaactgttttcataagctat 35016606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 83 - 134
Target Start/End: Original strand, 43504759 - 43504810
Alignment:
83 gttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||| |||||||||| |||||||| ||||||||||| || |||||||||||    
43504759 gtttttataagctatcttggagaacttatggaaataagctgaaaacagctta 43504810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 117
Target Start/End: Complemental strand, 9836948 - 9836882
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaat 117  Q
    |||||||| | ||||||||||||||| || | ||||| |||||||||| |||||| | |||||||||    
9836948 aagtcaaactattttcatataagttacaacctgttttcataagctatcttggagagcttatggaaat 9836882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 89 - 134
Target Start/End: Complemental strand, 2458622 - 2458577
Alignment:
89 ataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||||||||||| |||| | |||||||||||||| |||||||||||    
2458622 ataagctatcctagagagcttatggaaataaactgaaaacagctta 2458577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 73
Target Start/End: Original strand, 25867039 - 25867084
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataag 73  Q
    |||||||||||||| ||||||| |||||||| | ||||||||||||    
25867039 tttctataacaaaagatgaaataaagtcaaaatattttcatataag 25867084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 41 - 78
Target Start/End: Complemental strand, 32157111 - 32157074
Alignment:
41 aaatgaaatgaagtcaaattgttttcatataagttata 78  Q
    |||| |||||||||||||||||||||||||| ||||||    
32157111 aaattaaatgaagtcaaattgttttcatataggttata 32157074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 36 - 105
Target Start/End: Original strand, 34770853 - 34770922
Alignment:
36 acaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||||| || |||| |||||||||||||||||| |||| |||||   ||||| |||||||||||| ||||    
34770853 acaaaagataaaataaagtcaaattgttttcatttaagctataagttgttttcataagctatcctagaga 34770922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 98
Target Start/End: Complemental strand, 787205 - 787153
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatc 98  Q
    |||| ||||||||||||| ||||||||| ||||||| ||||| ||||| ||||    
787205 aaataaagtcaaattgttatcatataagctataaactgttttcataagttatc 787153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 134
Target Start/End: Original strand, 20672753 - 20672809
Alignment:
78 aaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||| ||||| ||||||||||||||||| | |||| |||||| || |||||||||||    
20672753 aaactgtttttataagctatcctggagagcttatgaaaataagctgaaaacagctta 20672809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 114
Target Start/End: Complemental strand, 31915384 - 31915300
Alignment:
30 tctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatgga 114  Q
    |||||||||||| ||  ||| ||||||||||||||||||| ||| |||||   || ||  |||||||||||||||| | ||||||    
31915384 tctataacaaaagatagaataaagtcaaattgttttcatacaaggtataagatgtctttgtaagctatcctggagagcttatgga 31915300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 104
Target Start/End: Complemental strand, 34080383 - 34080307
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggag 104  Q
    ||||| |||||||| || ||||||||||||| ||||  | |||||| ||||| | ||||| ||| ||||||||||||    
34080383 tttctttaacaaaagataaaatgaagtcaaactgttaccgtataagctataagctgttttcatacgctatcctggag 34080307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 72
Target Start/End: Original strand, 37220269 - 37220313
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataa 72  Q
    |||||||||||||||||||||| || |||| |||| |||||||||    
37220269 tttctataacaaaaaatgaaattaactcaagttgtgttcatataa 37220313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 79
Target Start/End: Complemental strand, 42237540 - 42237488
Alignment:
27 ttttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    |||| |||||||||| || |||| |||| |||||||||||||||||| |||||    
42237540 ttttttataacaaaagataaaataaagttaaattgttttcatataagctataa 42237488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 1e-18; HSPs: 29)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 28 - 139
Target Start/End: Complemental strand, 28586883 - 28586772
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||||||||| || |||| |||||||| ||||||||||||| |||||| | |||||||  ||||||||| |||| | ||| ||||||| || ||||    
28586883 tttctataacaaaagataaaataaagtcaaactgttttcatataaattataagctgttttgacgagctatcctagagagcttatcgaaataagctgaaaa 28586784  T
128 cagcttaaggat 139  Q
    ||||||| ||||    
28586783 cagcttacggat 28586772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 28 - 134
Target Start/End: Original strand, 39105417 - 39105523
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||| | ||| |||||||||||| ||||||||||| |||||| ||||| | ||||| |||||||||| |||||||| |||| |||||| || ||||    
39105417 tttctatagctaaatatgaaatgaagttaaattgttttcgtataagctataatctgttttcataagctatcttggagaacttatgaaaataagctaaaaa 39105516  T
128 cagctta 134  Q
     ||||||    
39105517 tagctta 39105523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 134
Target Start/End: Original strand, 14295459 - 14295565
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||||||||| || |||| |||||||| |||||||||||||| ||||| | |||||  |||||||||||||||| | | | ||| ||| || ||||    
14295459 tttctataacaaaagataaaataaagtcaaactgttttcatataagctataagctgttttcgtaagctatcctggagagcttttagaagtaagctgaaaa 14295558  T
128 cagctta 134  Q
    |||||||    
14295559 cagctta 14295565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 46 - 119
Target Start/End: Complemental strand, 41957550 - 41957477
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    ||||||||| ||||||||||||| |||||||||| | ||||| |||||||||||| |||||| |||| ||||||    
41957550 aaatgaagttaaattgttttcatgtaagttataagctgttttcataagctatccttgagaacttatgaaaataa 41957477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 28 - 119
Target Start/End: Original strand, 32172606 - 32172697
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||||| ||||||| || |||||||||||| |||||| |||||||| ||||| | ||||| |||||||||| || |||||  ||||||||||    
32172606 tttctacaacaaaagataaaatgaagtcaagttgtttacatataagctataagctgttttcataagctatcatgaagaactaatggaaataa 32172697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 51 - 96
Target Start/End: Original strand, 40159795 - 40159840
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagcta 96  Q
    |||||||||||||||||||||||||||||| |||||| ||||||||    
40159795 aagtcaaattgttttcatataagttataaatcgttttcataagcta 40159840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 115
Target Start/End: Original strand, 12975303 - 12975387
Alignment:
31 ctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaa 115  Q
    |||||||||| ||| |||| || |||||||||||||||||||| ||||| | || || |||||||||| |||||| | |||||||    
12975303 ctataacaaagaataaaataaaatcaaattgttttcatataagctataagctgtgttcataagctatcttggagagcttatggaa 12975387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 28 - 116
Target Start/End: Original strand, 18875314 - 18875402
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaa 116  Q
    |||||||| ||||| |  |||| ||||||||||| ||||||| ||||||||| | ||||| ||||| ||||||||||| | ||||||||    
18875314 tttctatatcaaaagacaaaataaagtcaaattgatttcatacaagttataagctgttttaataagatatcctggagagcttatggaaa 18875402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 134
Target Start/End: Complemental strand, 37588477 - 37588371
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||||||| |||| || |||| || |||||  ||||||||||||| |||||   ||||| ||||| ||| ||||||| | ||||||||||| || ||||    
37588477 tttctataataaaagataaaatcaaatcaaaaagttttcatataagctataagttgttttcataagttattctggagagcttatggaaataagctgaaaa 37588378  T
128 cagctta 134  Q
    |||||||    
37588377 cagctta 37588371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 119
Target Start/End: Complemental strand, 35553287 - 35553214
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||| |||||||||| |||||||||||| |||||||  |||| ||| ||||| ||||||| | |||||||||||    
35553287 aaattaagtcaaattcttttcatataagctataaactattttcatacgctattctggagagcttatggaaataa 35553214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 51 - 107
Target Start/End: Original strand, 7319382 - 7319438
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaac 107  Q
    |||| |||||||||||||||||| ||||||| |||||  ||||||||| ||||||||    
7319382 aagttaaattgttttcatataagctataaactgttttcgtaagctatcttggagaac 7319438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 55 - 119
Target Start/End: Complemental strand, 32408682 - 32408618
Alignment:
55 caaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||||| |||||||||||| |||||||  |||| ||||||||||||| ||| | |||||||||||    
32408682 caaattattttcatataagctataaactattttcataagctatcctgaagagcttatggaaataa 32408618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 39141923 - 39141991
Alignment:
30 tctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatc 98  Q
    |||||||||||| || ||||  |||||||||  ||||||||||| ||||||| ||||| ||||||||||    
39141923 tctataacaaaacataaaatatagtcaaattaatttcatataagctataaacagttttcataagctatc 39141991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 105
Target Start/End: Original strand, 3951586 - 3951645
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    ||||||| ||||||| ||||||||| || ||||| | ||||| |||||||||||||||||    
3951586 aaatgaaatcaaattattttcatattagctataagctgtttttataagctatcctggaga 3951645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 79
Target Start/End: Original strand, 4855655 - 4855702
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    ||||||||||||| |||| |||| |||||||| |||||||||||||||    
4855655 tataacaaaaaataaaataaagttaaattgttatcatataagttataa 4855702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 129
Target Start/End: Original strand, 16328845 - 16328919
Alignment:
54 tcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaaca 129  Q
    ||||| ||||||||||||| |||||||| |||||  ||||||| |||||||| | ||||||||||| || ||||||    
16328845 tcaaactgttttcatataaattataaactgttttcgtaagcta-cctggagagcttatggaaataagctgaaaaca 16328919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 134
Target Start/End: Complemental strand, 9202865 - 9202759
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||| || ||||| || |||| |||| ||||||||||||||||||  |||| | ||||| ||||| |||| || ||||| |||| |||||| ||  |||    
9202865 tttctgtagcaaaagataaaataaagttaaattgttttcatataagcaataagctgttttcataagttatcttgaagaacttatgaaaataagctggaaa 9202766  T
128 cagctta 134  Q
    |||||||    
9202765 cagctta 9202759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 134
Target Start/End: Complemental strand, 37526316 - 37526210
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||||||| |||| || |||| || |||||  ||||||||||||| |||||   ||||| ||||| | | ||||||| | ||||||||||| || ||||    
37526316 tttctataataaaagataaaatcaaatcaaaaagttttcatataagctataagttgttttcataagttgttctggagagcttatggaaataagctgaaaa 37526217  T
128 cagctta 134  Q
    |||||||    
37526216 cagctta 37526210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 93
Target Start/End: Complemental strand, 6582949 - 6582884
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataag 93  Q
    |||||| |||||||  | ||||||||| ||||| ||||| |||||||||||||| ||||| |||||    
6582949 tttctacaacaaaagctaaaatgaagttaaatttttttcttataagttataaactgttttcataag 6582884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 119
Target Start/End: Original strand, 12425542 - 12425615
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||| |||| ||||||||||| |||||| ||||| | ||||| | |||||||| |||||||| |||| ||||||    
12425542 aaataaagttaaattgttttcgtataagctataagctgttttcacaagctatcttggagaacttatgaaaataa 12425615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 98
Target Start/End: Original strand, 26516354 - 26516423
Alignment:
29 ttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatc 98  Q
    |||| |||||| | || |||| |||||||| |  ||||||||||||||||||| ||||| ||||||||||    
26516354 ttctctaacaatagataaaataaagtcaaactactttcatataagttataaactgttttcataagctatc 26516423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 89 - 134
Target Start/End: Original strand, 30217096 - 30217141
Alignment:
89 ataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||||||||||||||| | ||||||||||||| ||||||| ||||    
30217096 ataagctatcctggagagcttatggaaataaacctaaaacaactta 30217141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 51 - 132
Target Start/End: Complemental strand, 38036153 - 38036072
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagct 132  Q
    |||||||| |||||| ||||||  ||| ||| |||||  ||| ||||| |||||||||||| |||||||| | |||||||||    
38036153 aagtcaaactgtttttatataaactatgaactgttttcttaacctatcttggagaacatatagaaataaattgaaaacagct 38036072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 93
Target Start/End: Complemental strand, 42569097 - 42569032
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataag 93  Q
    |||||||| ||||| || |||| ||||| |||||||||| |||||| ||||| | |||||||||||    
42569097 tttctatagcaaaagataaaataaagtctaattgttttcgtataagctataatctgttttgataag 42569032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 79
Target Start/End: Complemental strand, 2933765 - 2933717
Alignment:
31 ctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    |||||| |||| || ||||||||| ||| ||||||||||||||||||||    
2933765 ctataataaaagataaaatgaagttaaactgttttcatataagttataa 2933717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 68
Target Start/End: Original strand, 10303754 - 10303794
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcat 68  Q
    |||||||||||||| || |||| ||||||||||||||||||    
10303754 tttctataacaaaagataaaataaagtcaaattgttttcat 10303794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 72
Target Start/End: Complemental strand, 12595857 - 12595813
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataa 72  Q
    |||||||||||||| || |||| |||| |||||||||||||||||    
12595857 tttctataacaaaagataaaataaagttaaattgttttcatataa 12595813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 114
Target Start/End: Complemental strand, 38047966 - 38047886
Alignment:
34 taacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatgga 114  Q
    |||||||| || |||| |||||||||| ||||||||||   ||||  | ||||| ||||||||||||||||| | ||||||    
38047966 taacaaaagataaaataaagtcaaattattttcatatatactatatgctgttttcataagctatcctggagagcttatgga 38047886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 112
Target Start/End: Original strand, 42583102 - 42583186
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatg 112  Q
    |||||||||||||| ||||||| |||| ||||||||||| | ||||  |||| | ||||| ||||  |||| |||||||| ||||    
42583102 tttctataacaaaagatgaaataaagttaaattgttttcgtgtaagggataagctgttttcataatttatcgtggagaacttatg 42583186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 45; Significance: 9e-17; HSPs: 29)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 28 - 136
Target Start/End: Complemental strand, 42817493 - 42817385
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||| ||||| || ||||||||||||  ||||||||||||||| |||||| ||||| ||||||||| ||| ||| | ||||||| ||| || ||||    
42817493 tttctataccaaaagataaaatgaagtcaagctgttttcatataagtaataaactgttttcataagctattctgaagagcttatggaagtaagctaaaaa 42817394  T
128 cagcttaag 136  Q
    || ||||||    
42817393 caacttaag 42817385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 35 - 134
Target Start/End: Original strand, 11513858 - 11513957
Alignment:
35 aacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||||| || |||| ||||||||||||||||||||||| |||||   ||||| |||||||||| |||||||| | ||||||||| || |||| ||||||    
11513858 aacaaaagataaaataaagtcaaattgttttcatataagctataagttgttttcataagctatcatggagaacttttggaaataagctgaaaatagctta 11513957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 55 - 134
Target Start/End: Complemental strand, 22681275 - 22681196
Alignment:
55 caaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||||||||||||||||| ||||| | ||||| |||| ||||||| |||||| ||||||||||| || |||||||||||    
22681275 caaattgttttcatataagctataagctgttttcataatctatcctagagaacttatggaaataagctaaaaacagctta 22681196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 134
Target Start/End: Original strand, 25790079 - 25790185
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||||||| |||| || || |||||||||| |||||||||||||| || |||  |||| ||||| |||||||||||| | |||| ||||||  | ||||    
25790079 tttctataaaaaaagataaagtgaagtcaaactgttttcatataagctacaaattgtttggataatctatcctggagagcttatgaaaataagttcaaaa 25790178  T
128 cagctta 134  Q
    |||||||    
25790179 cagctta 25790185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 38 - 107
Target Start/End: Original strand, 18066091 - 18066160
Alignment:
38 aaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaac 107  Q
    |||| ||||||| |||| |||||||||||||||||| ||||| | ||||| |||||||||| ||||||||    
18066091 aaaatatgaaataaagttaaattgttttcatataagctataagctgttttcataagctatcttggagaac 18066160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 120
Target Start/End: Complemental strand, 18962151 - 18962063
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaa 120  Q
    |||||||||| || |||| |||| ||| |||||||||||||| |||||||  |||| |||||||||| ||||||   ||||||||||||    
18962151 tataacaaaagataaaataaagttaaactgttttcatataagctataaactattttcataagctatcatggagagactatggaaataaa 18962063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 3673760 - 3673811
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    |||||||||||||| || |||| |||| ||||||||||||||||||||||||    
3673760 tttctataacaaaatataaaataaagttaaattgttttcatataagttataa 3673811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 37053547 - 37053598
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    ||||||||||| ||||| |||| |||||||| ||||||||||||||||||||    
37053547 tttctataacagaaaataaaataaagtcaaactgttttcatataagttataa 37053598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 29 - 127
Target Start/End: Original strand, 15377719 - 15377817
Alignment:
29 ttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||||| ||||  || |||| |||| | |||||||||||||||||||||| | ||||| ||||||||| |||  || | |||| ||||||||||||||    
15377719 ttctataccaaaggataaaataaagttagattgttttcatataagttataagctgttttcataagctattctgaggagcttatgaaaataaacttaaaa 15377817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 42 - 107
Target Start/End: Original strand, 1625867 - 1625932
Alignment:
42 aatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaac 107  Q
    |||||||| |||| ||||||||||| ||||||||||||   ||||| |||||||||| ||||||||    
1625867 aatgaaataaagttaaattgttttcgtataagttataagttgttttcataagctatcttggagaac 1625932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 32 - 105
Target Start/End: Original strand, 28933781 - 28933854
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||||||||| || |||| || ||||||| ||||||| |||||||||||  ||||| |||||||||||| ||||    
28933781 tataacaaaagataaaatcaaatcaaattattttcatttaagttataaattgttttcataagctatcctagaga 28933854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 80
Target Start/End: Complemental strand, 41852013 - 41851968
Alignment:
35 aacaaaaaatgaaatgaagtcaaattgttttcatataagttataaa 80  Q
    ||||||| || |||| ||||||||||||||||||||||||||||||    
41852013 aacaaaagataaaattaagtcaaattgttttcatataagttataaa 41851968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 104
Target Start/End: Complemental strand, 17952818 - 17952742
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggag 104  Q
    |||||||||||||| || |||| |||||||| | |||||||||||| || ||   ||||| ||||||||||||||||    
17952818 tttctataacaaaagataaaataaagtcaaactattttcatataagctacaagatgttttcataagctatcctggag 17952742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 80
Target Start/End: Original strand, 33192146 - 33192198
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaa 80  Q
    ||||||||||| || || |||| |||||||| |||||||||||||||||||||    
33192146 tttctataacataagataaaataaagtcaaactgttttcatataagttataaa 33192198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 118
Target Start/End: Original strand, 8017410 - 8017477
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaata 118  Q
    |||| ||||| |||||||||||| | ||||| ||||| |||||||||| |||||||| |||| |||||    
8017410 aagttaaattattttcatataagctgtaaactgttttcataagctatcttggagaacttatgaaaata 8017477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 51 - 134
Target Start/End: Original strand, 43141847 - 43141930
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||||||||||||| |||||||| |||||   ||||| ||||||||||||| |||   |||||||||||| | |||||| ||||    
43141847 aagtcaaattgtttccatataagctataagatgttttcataagctatcctgaagagtttatggaaataaaatgaaaacaactta 43141930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 29 - 119
Target Start/End: Original strand, 33256694 - 33256784
Alignment:
29 ttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    ||||||||||| | || |||| |||||||| |||||||||||||  ||||| | ||||| |||||| |||||| ||| | |||| ||||||    
33256694 ttctataacaatagataaaataaagtcaaactgttttcatataaactataagcagttttcataagccatcctgaagaccgtatgaaaataa 33256784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 105
Target Start/End: Original strand, 37276722 - 37276776
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||||||| ||||||||||||||||||||   ||||| ||||| |||||||||||    
37276722 aagtcaaactgttttcatataagttataagttgttttcataagttatcctggaga 37276776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 134
Target Start/End: Complemental strand, 3078728 - 3078651
Alignment:
57 aattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||||||||||||| || |||| | ||||| |||||||||| |||||| | | ||||||||| || |||||| ||||    
3078728 aattgttttcatatatgtaataagctgtttttataagctatcttggagagcttctggaaataagctaaaaacaactta 3078651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 105
Target Start/End: Original strand, 10143125 - 10143202
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||||||||||||| || |||| |||||||| |||||| ||||||| |||||    |||| |||||||||| ||||||    
10143125 tttctataacaaaagataaaattaagtcaaactgtttttatataagctataagtttttttcataagctatcatggaga 10143202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 69
Target Start/End: Original strand, 29633025 - 29633066
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcata 69  Q
    |||||||||||||||||  ||| |||||||||||||||||||    
29633025 tttctataacaaaaaatagaataaagtcaaattgttttcata 29633066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 23 - 68
Target Start/End: Complemental strand, 37518946 - 37518901
Alignment:
23 atctttttctataacaaaaaatgaaatgaagtcaaattgttttcat 68  Q
    |||| |||||||||||||||||||  |||||| |||||||||||||    
37518946 atctatttctataacaaaaaatgatgtgaagtaaaattgttttcat 37518901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 131
Target Start/End: Original strand, 43173193 - 43173278
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagc 131  Q
    |||| |||||||||| |||||||||||| ||||    ||||| ||| |||||| |||||| | |||||||||||  ||||||||||    
43173193 aaataaagtcaaattattttcatataagctatattttgtttttataggctatcttggagatcttatggaaataagtttaaaacagc 43173278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 98
Target Start/End: Original strand, 6988066 - 6988138
Alignment:
26 tttttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatc 98  Q
    |||||||||||||||| || |||| |||||||||| ||||| ||  ||||||||   ||||| ||||||||||    
6988066 tttttctataacaaaagataaaataaagtcaaattattttcttactagttataagttgttttcataagctatc 6988138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 80
Target Start/End: Complemental strand, 11344401 - 11344349
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaa 80  Q
    |||||||||||||| || |||  ||||||||||||||||||| ||| ||||||    
11344401 tttctataacaaaagataaaagaaagtcaaattgttttcatacaagctataaa 11344349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 134
Target Start/End: Complemental strand, 15866767 - 15866679
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||| ||||| | ||||||||||||||| ||||| ||  ||| ||||||||||||||||| | |||| ||| || || |||||| ||||    
15866767 aaataaagtcgacttgttttcatataagctataagccactttcataagctatcctggagagcttatgtaaacaagctgaaaacacctta 15866679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 46 - 134
Target Start/End: Complemental strand, 28039431 - 28039343
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||| ||||| ||||||||||||||||  ||||| |  |||| ||||||| || |||| ||  ||||||||||| || |||||||||||    
28039431 aaataaagtccaattgttttcatataaactataagcaattttcataagctttcttggaaaagttatggaaataagctgaaaacagctta 28039343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 134
Target Start/End: Original strand, 39983329 - 39983401
Alignment:
62 ttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||||||||||| |||||   ||||| ||||||||||||||||| |  ||| ||||||||| |||| ||||||    
39983329 ttttcatataagctataagttgttttcataagctatcctggagagctaatgaaaataaactgaaaatagctta 39983401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 55 - 119
Target Start/End: Original strand, 43205289 - 43205353
Alignment:
55 caaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||| |||||||||||||| ||||| | ||||| ||||||||||  ||||| | |||||||||||    
43205289 caaactgttttcatataagatataatctgttttcataagctatcacggagagcttatggaaataa 43205353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 28)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 134
Target Start/End: Original strand, 24782012 - 24782118
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||||||||| || |||| || |||||||||||||||||||||||||| |   ||| |||| ||||||| |||| | |||| ||||||||| ||||    
24782012 tttctataacaaaagataaaatcaaatcaaattgttttcatataagttataagctactttaataaactatccttgagagcttatgaaaataaactaaaaa 24782111  T
128 cagctta 134  Q
     ||||||    
24782112 tagctta 24782118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 28 - 118
Target Start/End: Complemental strand, 33787862 - 33787772
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaata 118  Q
    |||||||||||||| || |||  ||||||||||| ||||||||||||||||| | ||||| ||||| |||| |||||| | ||||||||||    
33787862 tttctataacaaaatataaaacaaagtcaaattgatttcatataagttataagctgttttcataagttatcttggagagcttatggaaata 33787772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 31 - 134
Target Start/End: Complemental strand, 281962 - 281859
Alignment:
31 ctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacag 130  Q
    ||||||||||| || |||| ||||||| ||||||||||||||| ||||| | || || |||||||||||| |||| |  |||||||||| || ||||||     
281962 ctataacaaaagataaaataaagtcaacttgttttcatataagctataagctgtgttcataagctatcctagagagctcatggaaataagctgaaaacaa 281863  T
131 ctta 134  Q
    ||||    
281862 ctta 281859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 28 - 93
Target Start/End: Complemental strand, 29274346 - 29274281
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataag 93  Q
    |||||||| ||||| || |||| ||||||||||||||||||||||| ||||||| ||||| |||||    
29274346 tttctatagcaaaagataaaataaagtcaaattgttttcatataagctataaactgttttcataag 29274281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 133
Target Start/End: Complemental strand, 8365064 - 8364988
Alignment:
57 aattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctt 133  Q
    ||||||||| ||||||||||||||| ||||| |||||||||| ||| ||||  ||| |||||| || ||||||||||    
8365064 aattgtttttatataagttataaactgttttcataagctatcatggtgaactgatgaaaataagctgaaaacagctt 8364988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 58 - 129
Target Start/End: Complemental strand, 28088309 - 28088238
Alignment:
58 attgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaaca 129  Q
    |||||||||||||||| ||||||| ||||| |||||||||| |||||| |  |||||||||| || ||||||    
28088309 attgttttcatataagctataaactgttttcataagctatcatggagagctcatggaaataagctcaaaaca 28088238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 105
Target Start/End: Original strand, 1402949 - 1403026
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||||||||||||| || |||| |||| ||| | |||||||||||| ||||||  ||||| |||||||||| ||||||    
1402949 tttctataacaaaagataaaataaagttaaactattttcatataagctataaattgttttcataagctatcatggaga 1403026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 119
Target Start/End: Complemental strand, 24836316 - 24836228
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||||||||||||| || |||| |||||||||||||||| |||||  |||||   |||||  ||||||||| |||||| | |||||||||||    
24836316 tttctataacaaaagataaaataaagtcaaattgttttcgtataaactataa---gttttcgtaagctatcatggagagcttatggaaataa 24836228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 70 - 134
Target Start/End: Original strand, 8010352 - 8010416
Alignment:
70 taagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||||||||| | ||||| ||||| ||||||||||||| ||| |||||||||| |||| ||||||    
8010352 taagttataagctgttttaataagttatcctggagaacttatagaaataaactgaaaatagctta 8010416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 99
Target Start/End: Original strand, 4006667 - 4006738
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcc 99  Q
    |||||||||||||  || |||| ||||||||||||||| ||||||| |||||   ||||| |||||||||||    
4006667 tttctataacaaatgataaaataaagtcaaattgtttttatataagctataagttgttttcataagctatcc 4006738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 79
Target Start/End: Complemental strand, 6310341 - 6310290
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    |||||||||||||| ||||| | ||||| ||||||||||||||||| |||||    
6310341 tttctataacaaaagatgaagtaaagtctaattgttttcatataagctataa 6310290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 54 - 105
Target Start/End: Complemental strand, 22691611 - 22691560
Alignment:
54 tcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||||||||||||||||||||||||| |  |||| |||| ||||||||||||    
22691611 tcaaattgttttcatataagttataacctattttcataacctatcctggaga 22691560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 32 - 103
Target Start/End: Original strand, 22742323 - 22742394
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctgga 103  Q
    |||||||||  || |||| ||||||||||||||||||||||| ||||| |  |||| ||||| |||||||||    
22742323 tataacaaaggataaaataaagtcaaattgttttcatataagctataagctatttttataagttatcctgga 22742394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 107
Target Start/End: Original strand, 24476555 - 24476634
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaac 107  Q
    |||||||| ||||| || ||||| ||| ||||| ||||||||||||  |||| | |||||||||||||||  ||||||||    
24476555 tttctatagcaaaagataaaatgtagttaaattattttcatataagcgataagcagttttgataagctattttggagaac 24476634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 131
Target Start/End: Complemental strand, 3168341 - 3168275
Alignment:
65 tcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagc 131  Q
    ||||||||| ||||||| |||||  |||||||||||||||| | || |||||||| || ||||||||    
3168341 tcatataagctataaactgttttcttaagctatcctggagagcttaaggaaataagctgaaaacagc 3168275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 130
Target Start/End: Complemental strand, 9093673 - 9093571
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||| ||||| || |||| |||| ||||||||||| |||||| ||||| | ||||| ||||||| || | |||||| || | |||||| || ||||    
9093673 tttctatatcaaaagataaaataaagttaaattgttttcgtataagctataagctgttttcataagctgtcttagagaacttaagaaaataagctgaaaa 9093574  T
128 cag 130  Q
    |||    
9093573 cag 9093571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 98
Target Start/End: Original strand, 25099996 - 25100066
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatc 98  Q
    |||||| | ||||| |||||||  |||||||||||||||||| |||||||||   ||||| ||||||||||    
25099996 tttctaaagcaaaatatgaaatagagtcaaattgttttcatagaagttataagttgttttcataagctatc 25100066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 134
Target Start/End: Original strand, 6014525 - 6014594
Alignment:
65 tcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||||| |||||||||| ||||  ||||| |||| || ||||| ||||||||||| || |||||||||||    
6014525 tcatattagttataaactgtttccataagttatcttgaagaacctatggaaataatctcaaaacagctta 6014594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 30 - 79
Target Start/End: Complemental strand, 10150367 - 10150318
Alignment:
30 tctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    |||||||||||| || |||| || ||||||||||||||||| ||||||||    
10150367 tctataacaaaatataaaatcaaatcaaattgttttcatatcagttataa 10150318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 105
Target Start/End: Original strand, 14492259 - 14492332
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||| ||||| || |||||||||||||||||||| ||| ||| ||||| | ||||| ||||| |||||| ||||    
14492259 tataccaaaagataaaatgaagtcaaattgttttgatacaagctataagctgttttcataagttatcctagaga 14492332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 119
Target Start/End: Original strand, 25426141 - 25426214
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||| ||||||||||| |||||| |||| ||||| |  |||| ||||||||||||||||||  ||| |||||||    
25426141 aaataaagtcaaattgctttcatgtaagctataagctatttttataagctatcctggagaatttatagaaataa 25426214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 25 - 134
Target Start/End: Original strand, 30784507 - 30784615
Alignment:
25 ctttttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaactta 124  Q
    ||||||||||||||||| || |||| |||||||| |  |||||| |||  || || || |||| ||||| |||| ||||| || ||||||||||| || |    
30784507 ctttttctataacaaaagataaaataaagtcaaactactttcatgtaaactacaagccattttcataagttatcttggag-acctatggaaataagctca 30784605  T
125 aaacagctta 134  Q
    ||||||||||    
30784606 aaacagctta 30784615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 69
Target Start/End: Original strand, 31583654 - 31583695
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcata 69  Q
    |||||||||||| | || ||||||||||||||||||||||||    
31583654 tttctataacaagagataaaatgaagtcaaattgttttcata 31583695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 89 - 138
Target Start/End: Complemental strand, 32578042 - 32577993
Alignment:
89 ataagctatcctggagaacatatggaaataaacttaaaacagcttaagga 138  Q
    ||||||||||||| ||| ||||||||||||| || ||||||||| |||||    
32578042 ataagctatcctgaagagcatatggaaataagctgaaaacagctcaagga 32577993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 103
Target Start/End: Original strand, 33828617 - 33828674
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctgga 103  Q
    |||| |||||||||||||||| ||||||||||||   ||||| |||||||||| ||||    
33828617 aaataaagtcaaattgttttcgtataagttataagttgttttaataagctatcatgga 33828674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 119
Target Start/End: Original strand, 6647342 - 6647431
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||||||||||||||||  ||| ||||||||||  ||| ||||| ||||||| | ||||| |||||||||| | |||| | |||| ||||||    
6647342 tttctataacaaaaaat--aataaagtcaaattactttaatataggttataatctgttttcataagctatcttagagagcttatgaaaataa 6647431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 33 - 73
Target Start/End: Original strand, 7713983 - 7714023
Alignment:
33 ataacaaaaaatgaaatgaagtcaaattgttttcatataag 73  Q
    ||||||||| || |||| |||||||||||||||||||||||    
7713983 ataacaaaagataaaataaagtcaaattgttttcatataag 7714023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 73
Target Start/End: Original strand, 29940746 - 29940794
Alignment:
25 ctttttctataacaaaaaatgaaatgaagtcaaattgttttcatataag 73  Q
    ||||||||||||||||| || |||| ||||||| |||||||||| ||||    
29940746 ctttttctataacaaaagataaaataaagtcaatttgttttcatttaag 29940794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 24)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 38 - 134
Target Start/End: Original strand, 41452486 - 41452582
Alignment:
38 aaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||| |||||| |||||||| ||||||||||| |||| ||| | ||||| ||||||||||||||||||  | |||||||||  | |||||||||||    
41452486 aaaaattgaaataaagtcaaactgttttcatattagttgtaagctgttttcataagctatcctggagaagttgtggaaataaggtgaaaacagctta 41452582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 46 - 112
Target Start/End: Complemental strand, 1217899 - 1217833
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatg 112  Q
    ||||||||| ||||||||||||| |||||||||| | ||||| |||||||||||| |||||| ||||    
1217899 aaatgaagttaaattgttttcatgtaagttataagctgttttcataagctatccttgagaacttatg 1217833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 130
Target Start/End: Complemental strand, 24887400 - 24887298
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||||||| | || |||| |||||||| ||| |||||||||| || || | ||||| ||||||||||||||||| | ||||| ||||| || ||||    
24887400 tttctataacaatagataaaataaagtcaaactgtattcatataagctaaaagctgttttcataagctatcctggagagcttatgggaataagctgaaaa 24887301  T
128 cag 130  Q
    |||    
24887300 cag 24887298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 134
Target Start/End: Original strand, 38462234 - 38462340
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||| ||||| || |||| |||||||| |||||||||||| | ||||||| ||||| |||||||||||  || | | ||||||||||| || ||||    
38462234 tttctataccaaaagataaaataaagtcaaactgttttcatatatgctataaactgttttcataagctatccaagatagcttatggaaataagctgaaaa 38462333  T
128 cagctta 134  Q
    || ||||    
38462334 caactta 38462340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 43079695 - 43079746
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    ||||||||||||||||| ||| ||||| |||| |||||||||||||||||||    
43079695 tttctataacaaaaaataaaaggaagttaaatcgttttcatataagttataa 43079746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 134
Target Start/End: Complemental strand, 36646499 - 36646393
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||||| |||||| || |||| ||||  |||||||||||||||||||||||   ||||| |||||||||||| ||||   ||| |||||||  | ||||    
36646499 tttctatgacaaaagataaaataaagtataattgttttcatataagttataacttgttttcataagctatcctagagagtttatagaaataagatgaaaa 36646400  T
128 cagctta 134  Q
    |||||||    
36646399 cagctta 36646393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 134
Target Start/End: Complemental strand, 45433056 - 45432950
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||||||| |||| || ||||||||| ||||||||||||||| || ||||||  ||||| | |||  |||||| ||| | ||||||||||| || ||||    
45433056 tttctataagaaaagataaaatgaagttaaattgttttcatatgagctataaattgttttcacaagtcatcctgtagagcttatggaaataagctgaaaa 45432957  T
128 cagctta 134  Q
    || ||||    
45432956 caactta 45432950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 51 - 119
Target Start/End: Original strand, 37273107 - 37273178
Alignment:
51 aagtcaaattgttttcatataagttataa---accgttttgataagctatcctggagaacatatggaaataa 119  Q
    ||||||||||||||| ||||||| |||||   || ||||| |||||||||| |||||||| |||||||||||    
37273107 aagtcaaattgtttttatataagatataataaactgttttcataagctatcttggagaacttatggaaataa 37273178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 28 - 92
Target Start/End: Original strand, 1395624 - 1395688
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataa 92  Q
    |||||||||||||| || |||| |||||||||| |||||||||||| ||| ||| ||||| ||||    
1395624 tttctataacaaaagataaaataaagtcaaattattttcatataagctatgaactgttttcataa 1395688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 134
Target Start/End: Original strand, 28306113 - 28306217
Alignment:
30 tctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaaca 129  Q
    ||||||||||||| | |||| |||||||| ||||||||||||||||| ||   ||||| ||||||||| | | ||| | ||  ||||||| ||||||||     
28306113 tctataacaaaaagtaaaataaagtcaaactgttttcatataagttacaagttgttttcataagctatacagaagagcttacagaaataagcttaaaact 28306212  T
130 gctta 134  Q
    |||||    
28306213 gctta 28306217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 133
Target Start/End: Original strand, 21367638 - 21367725
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctt 133  Q
    |||| |||| ||||||||||| |||||  |||||   ||||| |||||||||| |||||||| |||| |||||| || ||||||||||    
21367638 aaataaagttaaattgttttcgtataatgtataagttgttttcataagctatcttggagaacttatgaaaataagctgaaaacagctt 21367725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 98
Target Start/End: Original strand, 3365358 - 3365428
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatc 98  Q
    ||||||||||| || || |||| ||||||| ||||||| |||||| || ||||| ||||| ||||||||||    
3365358 tttctataacataagataaaattaagtcaagttgtttttatataaattgtaaactgttttcataagctatc 3365428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 98
Target Start/End: Complemental strand, 29600842 - 29600772
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatc 98  Q
    |||||||| ||||| || |||| || |||| ||||||||| ||||| ||||||||||||| |||| |||||    
29600842 tttctatagcaaaacataaaataaaatcaatttgttttcaaataagctataaaccgttttcataacctatc 29600772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 98
Target Start/End: Original strand, 52618956 - 52619026
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatc 98  Q
    |||||| ||||||  || |||| |||| |||||||||||||||||||||||| | ||||| | ||||||||    
52618956 tttctaaaacaaatgattaaataaagttaaattgttttcatataagttataagctgttttcacaagctatc 52619026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 73
Target Start/End: Complemental strand, 10101593 - 10101548
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataag 73  Q
    |||||||||||||| || |||| |||| ||||||||||||||||||    
10101593 tttctataacaaaagataaaataaagttaaattgttttcatataag 10101548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 73
Target Start/End: Complemental strand, 10212518 - 10212473
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataag 73  Q
    |||||||||||||| || |||| |||| ||||||||||||||||||    
10212518 tttctataacaaaagataaaataaagttaaattgttttcatataag 10212473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 34 - 75
Target Start/End: Complemental strand, 33307691 - 33307650
Alignment:
34 taacaaaaaatgaaatgaagtcaaattgttttcatataagtt 75  Q
    |||||||| ||||||| |||||||||| ||||||||||||||    
33307691 taacaaaatatgaaataaagtcaaattattttcatataagtt 33307650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 73
Target Start/End: Complemental strand, 49587033 - 49586988
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataag 73  Q
    |||||||||||||| || |||| |||||||| ||||||||||||||    
49587033 tttctataacaaaagataaaataaagtcaaactgttttcatataag 49586988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 77
Target Start/End: Complemental strand, 51278274 - 51278225
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttat 77  Q
    |||||||||||||| || |||| |||||||| ||||||||| ||||||||    
51278274 tttctataacaaaatattaaataaagtcaaactgttttcatttaagttat 51278225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 72
Target Start/End: Complemental strand, 15304464 - 15304420
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataa 72  Q
    |||||||||||||| || |||| |||| |||||||||||||||||    
15304464 tttctataacaaaagataaaataaagttaaattgttttcatataa 15304420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 67 - 119
Target Start/End: Complemental strand, 24158581 - 24158529
Alignment:
67 atataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||||||| |||| | ||||| ||||||||||||||||| | |||||||||||    
24158581 atataagtaataagctgttttcataagctatcctggagagcttatggaaataa 24158529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 112
Target Start/End: Complemental strand, 33405284 - 33405200
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatg 112  Q
    |||||||| |||||  | |||| |||| || ||||||||||||||| ||||| | ||||| |||||||||| || ||||| ||||    
33405284 tttctatagcaaaaggtaaaataaagttaatttgttttcatataagctataagctgttttcataagctatcttgaagaacttatg 33405200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 119
Target Start/End: Complemental strand, 48286904 - 48286836
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||| ||||||||| |||||||||||||||| ||||| ||||| |||| || ||| | ||| |||||||    
48286904 aagttaaattgtttccatataagttataaactgttttcataagttatcatgtagagcttatagaaataa 48286836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 83 - 127
Target Start/End: Complemental strand, 49465727 - 49465683
Alignment:
83 gttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||| ||||||||| ||||||||| ||||||||||| |||||||    
49465727 gttttcataagctatactggagaacttatggaaataagcttaaaa 49465683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 32)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 28 - 134
Target Start/End: Complemental strand, 54325154 - 54325048
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||||| |||||| || |||| |||||||| |||||||||||||| ||||| |  |||| | |||||||| ||||||   |||||| ||||||| ||||    
54325154 tttctattacaaaagataaaataaagtcaaactgttttcatataagctataagctattttcaaaagctatcatggagagtttatggagataaactgaaaa 54325055  T
128 cagctta 134  Q
    |||||||    
54325054 cagctta 54325048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 32 - 105
Target Start/End: Original strand, 10192241 - 10192314
Alignment:
32 tataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggaga 105  Q
    |||||||||| ||  ||| |||||||||||||||||||||||||||||   ||||| | |||||||||||||||    
10192241 tataacaaaagatagaataaagtcaaattgttttcatataagttataagttgttttcaaaagctatcctggaga 10192314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 52 - 129
Target Start/End: Complemental strand, 18628636 - 18628559
Alignment:
52 agtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaaca 129  Q
    ||||||| |||||| ||||||||||||||| ||||| ||||| |||| |||||| | ||||||||||| || ||||||    
18628636 agtcaaactgtttttatataagttataaactgttttcataagttatcttggagagcttatggaaataagctgaaaaca 18628559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 29 - 101
Target Start/End: Original strand, 3175905 - 3175977
Alignment:
29 ttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctg 101  Q
    ||||||| ||||| || |||| |||||||||||||||||  |||||||||| | ||||| |||||||||||||    
3175905 ttctatagcaaaagataaaataaagtcaaattgttttcaagtaagttataagctgttttcataagctatcctg 3175977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 134
Target Start/End: Complemental strand, 7694112 - 7694021
Alignment:
43 atgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    |||||||||||||||| ||||||  |||||| ||||| | ||||| ||||| |||||||||||   ||||||||||| || |||||| ||||    
7694112 atgaaatgaagtcaaactgtttttgtataagctataagctgttttcataagttatcctggagagtttatggaaataagctgaaaacaactta 7694021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 48 - 107
Target Start/End: Original strand, 20907320 - 20907379
Alignment:
48 atgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaac 107  Q
    ||||| |||||||||||||||||||| ||||||| ||||| | ||||||||||| |||||    
20907320 atgaaatcaaattgttttcatataagctataaactgttttcacaagctatcctgaagaac 20907379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 126
Target Start/End: Original strand, 19154699 - 19154797
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaa 126  Q
    |||||| ||||||| |  |||| || |||||||| ||||||||||| ||||||| ||||| ||| | |||||| |||||| || |||||||||| ||||    
19154699 tttctaaaacaaaagaaaaaatcaaatcaaattgctttcatataagctataaactgttttcatacggtatcctagagaacttagggaaataaacataaa 19154797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 97
Target Start/End: Original strand, 4071835 - 4071904
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctat 97  Q
    |||||||||||||| || |||| |||||||||| |||||||||||| |||||   ||| |||||||||||    
4071835 tttctataacaaaagataaaataaagtcaaattattttcatataagctataagttgttatgataagctat 4071904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 28 - 93
Target Start/End: Original strand, 8130127 - 8130192
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataag 93  Q
    |||||||||||||| || | || |||||||||| |||||||||||| ||||||| ||||| |||||    
8130127 tttctataacaaaagataacataaagtcaaattattttcatataagctataaactgttttcataag 8130192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 103
Target Start/End: Original strand, 24091434 - 24091491
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctgga 103  Q
    |||| |||||||||| |||||||||||| ||||||| ||||| ||||| |||||||||    
24091434 aaataaagtcaaattattttcatataagctataaactgttttcataagttatcctgga 24091491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 29 - 134
Target Start/End: Complemental strand, 30207686 - 30207582
Alignment:
29 ttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaac 128  Q
    |||||||||||||||| |||| || ||||| |||||||||||||| |||||   ||||| |||||||| | | ||||   ||||||||||| || |||||    
30207686 ttctataacaaaaaataaaataaa-tcaaactgttttcatataagctataagttgttttcataagctaccttagagagattatggaaataagctgaaaac 30207588  T
129 agctta 134  Q
    ||||||    
30207587 agctta 30207582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 46 - 95
Target Start/End: Complemental strand, 31038966 - 31038917
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagct 95  Q
    |||| ||||||||||||||||||||||||||||| || |||| |||||||    
31038966 aaataaagtcaaattgttttcatataagttataagccatttttataagct 31038917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 94
Target Start/End: Original strand, 53626727 - 53626795
Alignment:
26 tttttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagc 94  Q
    |||||||||||||||| || |||| || ||||| |||||||||||||| ||||| | ||||| ||||||    
53626727 tttttctataacaaaagataaaataaattcaaaatgttttcatataagctataagctgttttcataagc 53626795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 52 - 119
Target Start/End: Original strand, 2996550 - 2996617
Alignment:
52 agtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    |||||||||||||| |||||||||||||   ||||| |||||||||| |||||| | |||| ||||||    
2996550 agtcaaattgtttttatataagttataagttgttttcataagctatcttggagagcgtatgaaaataa 2996617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 63 - 114
Target Start/End: Original strand, 8147880 - 8147931
Alignment:
63 tttcatataagttataaaccgttttgataagctatcctggagaacatatgga 114  Q
    |||||||||||||||| || ||||| |||||||||||| |||||| ||||||    
8147880 tttcatataagttatatactgttttcataagctatcctagagaacttatgga 8147931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 21952914 - 21952965
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    |||||||||||| || | |||| ||||||||||||||||||||||| |||||    
21952914 tttctataacaacaagtaaaataaagtcaaattgttttcatataagctataa 21952965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 46 - 129
Target Start/End: Original strand, 26883966 - 26884049
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaaca 129  Q
    ||||||||| |||||||||||||||||| |||||  ||||||  ||| || |  |||||||| |||| ||||||||| ||||||    
26883966 aaatgaagttaaattgttttcatataagctataagtcgttttcgtaaactttattggagaacctatgaaaataaactgaaaaca 26884049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 30024653 - 30024704
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    |||||||||||||| || |||| |||| |||||||||||||||||| |||||    
30024653 tttctataacaaaagataaaataaagtaaaattgttttcatataagctataa 30024704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 134
Target Start/End: Complemental strand, 30338709 - 30338602
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccg-ttttgataagctatcctggagaacatatggaaataaacttaaa 126  Q
    |||||||||||||| ||  ||| |||| ||| |||||||||||||| ||||||| | |||| ||||||| || ||||||   |||| |||||| | ||||    
30338709 tttctataacaaaagatagaataaagttaaactgttttcatataagctataaactgtttttcataagctctcttggagagtttatgaaaataagcataaa 30338610  T
127 acagctta 134  Q
    ||||||||    
30338609 acagctta 30338602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 127
Target Start/End: Complemental strand, 36722754 - 36722687
Alignment:
60 tgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    ||||||||||||||||||||   ||||||||||| ||||||| ||| | |||| |||||| |||||||    
36722754 tgttttcatataagttataagttgttttgataagttatcctgaagagcttatgaaaataagcttaaaa 36722687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 79
Target Start/End: Original strand, 49219092 - 49219143
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataa 79  Q
    |||||||||||||| || |||| |||||||||| |||||||||||| |||||    
49219092 tttctataacaaaatataaaataaagtcaaattattttcatataagctataa 49219143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 134
Target Start/End: Original strand, 6364102 - 6364208
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||||||||| || |||| |||| ||||| | |||| ||||| ||||| |  |||| |||||||||  |||||||| || | |||||| || ||||    
6364102 tttctataacaaaagataaaataaagtgaaattctgttcacataagctataagcaattttcataagctataatggagaacttacgaaaataagctgaaaa 6364201  T
128 cagctta 134  Q
    |||||||    
6364202 cagctta 6364208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 51 - 133
Target Start/End: Original strand, 21157744 - 21157826
Alignment:
51 aagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctt 133  Q
    |||||||| ||||||||| |||| |||||   ||||| ||| ||||||||| ||| | ||||||||||| || ||||||||||    
21157744 aagtcaaactgttttcatgtaagctataagatgttttcatatgctatcctgaagagcttatggaaataagctaaaaacagctt 21157826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 102
Target Start/End: Complemental strand, 26520346 - 26520272
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctgg 102  Q
    |||||||||||||| ||||||| |||| ||||||||||| | |||| ||||| |  |||| ||| ||||||||||    
26520346 tttctataacaaaagatgaaataaagttaaattgttttcgtgtaagctataagctatttttatatgctatcctgg 26520272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 132
Target Start/End: Original strand, 49803164 - 49803265
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||| ||||| || ||||||||| |||||||||||| ||||||| ||    ||||||||||||| || |||||||| || |  ||||| || ||||    
49803164 tttctatagcaaaagataaaatgaagttaaattgttttcacataagttgta---tgttttgataagctttcttggagaacttaagacaataagctgaaaa 49803260  T
128 cagct 132  Q
    |||||    
49803261 cagct 49803265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 57 - 134
Target Start/End: Complemental strand, 17975457 - 17975380
Alignment:
57 aattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||||||||||||| || |||| | ||||| |||||||||| |||||| | | ||||||||| || |||||| ||||    
17975457 aattgttttcatatatgtaataagctgtttttataagctatcttggagagcttctggaaataagctaaaaacaactta 17975380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 89 - 134
Target Start/End: Original strand, 19429723 - 19429768
Alignment:
89 ataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||||||||||||||| | ||||||||||| || |||||||||||    
19429723 ataagctatcctggagagcttatggaaataagctgaaaacagctta 19429768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 77 - 134
Target Start/End: Complemental strand, 21043303 - 21043246
Alignment:
77 taaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||| ||||| ||||||||||||| ||| |||||| ||||| ||| |||||||||||    
21043303 taaactgttttcataagctatcctgaagagcatatgaaaatacactgaaaacagctta 21043246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 46 - 119
Target Start/End: Original strand, 23819060 - 23819133
Alignment:
46 aaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    ||||| ||||||| ||||||||||||||||||||   ||||| |||||||||| || ||| | ||| |||||||    
23819060 aaatgtagtcaaactgttttcatataagttataacatgttttcataagctatcttgaagagcttatagaaataa 23819133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 117
Target Start/End: Original strand, 44319903 - 44319991
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaat 117  Q
    ||||||||| |||| || |||| ||||| || |||||||||||||| || || |  ||||||||||||||||| |||||| |||| ||||    
44319903 tttctataa-aaaagataaaataaagtcgaactgttttcatataagctacaagctattttgataagctatcctagagaacttatgaaaat 44319991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 134
Target Start/End: Original strand, 43824262 - 43824342
Alignment:
54 tcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaacagctta 134  Q
    ||||||| |||||||||||||||||| |  ||||  |||| ||||||||| | | ||||||||||| || |||||| ||||    
43824262 tcaaattcttttcatataagttataagcttttttcgtaagttatcctggaaagcttatggaaataagctgaaaacaactta 43824342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 132
Target Start/End: Complemental strand, 45128427 - 45128323
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataaacttaaaa 127  Q
    |||||||||||||| || |||| || ||||||| || ||||||||| ||||||  ||||| |||| || ||||  | | | ||||||||||| || ||||    
45128427 tttctataacaaaagataaaatcaaatcaaattattctcatataagctataaattgttttcataaactgtcctataaagcttatggaaataagctgaaaa 45128328  T
128 cagct 132  Q
    |||||    
45128327 cagct 45128323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0508 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0508
Description:

Target: scaffold0508; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 28 - 78
Target Start/End: Complemental strand, 9892 - 9842
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttata 78  Q
    ||||||||||||||||| |||| ||||||||  ||||||||||||||||||    
9892 tttctataacaaaaaataaaattaagtcaaaaagttttcatataagttata 9842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0654 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0654
Description:

Target: scaffold0654; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 119
Target Start/End: Complemental strand, 6754 - 6663
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    ||||||||||||||||| || | ||||||||||||||||||| | |||| ||   ||||||||||| |||  || ||| | |||||||||||    
6754 tttctataacaaaaaataaacttaagtcaaattgttttcatagaggttaaaagttgttttgataagttattatgcagagcttatggaaataa 6663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 28 - 119
Target Start/End: Complemental strand, 116673 - 116582
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataagttataaaccgttttgataagctatcctggagaacatatggaaataa 119  Q
    ||||||||||||||||| || | ||||||||||||||||||| | |||| ||   ||||||||||| |||  || ||| | |||||||||||    
116673 tttctataacaaaaaataaacttaagtcaaattgttttcatagaggttaaaagttgttttgataagttattatgcagagcttatggaaataa 116582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 72
Target Start/End: Original strand, 27529 - 27573
Alignment:
28 tttctataacaaaaaatgaaatgaagtcaaattgttttcatataa 72  Q
    ||||||||||| || || |||| ||||||||||||||||||||||    
27529 tttctataacagaagataaaataaagtcaaattgttttcatataa 27573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 308304 times since January 2019
Visitors: 441