View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A12 (Length: 225)

Name: R108-tnk507-A12
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A12
R108-tnk507-A12
[»] chr7 (1 HSPs)
chr7 (1-225)||(8340103-8340330)


Alignment Details
Target: chr7 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 8340330 - 8340103
Alignment:
1 gttgagaa-ttgtaaattggacatccaaattgcaatttgagagttatgaatacttttatttcaaatttcgatatagatgtctgtttac-acttccgccac 98  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||    
8340330 gttgagaacttgtaaattggacatccaaattgcaatttgagagttatgaatacttttatttcaaatttcgatatggatgtctgtttacaacttccgccac 8340231  T
99 ctctcaaattttaaaggcaaagttattttcttcacaacannnnnnnaacccctctcattaggggaagg-catttaaggttcatgttcctgatttaggtat 197  Q
    ||||||||||||||||| | |||||||||||||||||||       ||||||||||||| |||||||| |||||||||||||||||||||||||||||||    
8340230 ctctcaaattttaaaggaagagttattttcttcacaacatttttttaacccctctcattgggggaaggccatttaaggttcatgttcctgatttaggtat 8340131  T
198 taggttagatattgttttgatgcttgcc 225  Q
    ||||||||||||||||||||||||||||    
8340130 taggttagatattgttttgatgcttgcc 8340103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360222 times since January 2019
Visitors: 482