View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A19 (Length: 248)

Name: R108-tnk507-A19
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A19
R108-tnk507-A19
[»] chr2 (4 HSPs)
chr2 (1-248)||(15275477-15275715)
chr2 (1-248)||(15263842-15264080)
chr2 (120-234)||(15251348-15251464)
chr2 (138-192)||(14431289-14431343)


Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 15275715 - 15275477
Alignment:
1 tttccgagagcgttttttcctaacctgataactgagttggaaaccggcattggcagggt-atcaagaagtcccttgagagggatacggaccttgccaatg 99  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
15275715 tttccgagagcgttttttcctaacctgataactgagttggaaaccggcattggcagggttatcaagaagtcccttgagagggatacggaccttgccaatg 15275616  T
100 gtactgcatgggaggaattttgggaggaattttcgata-gagatgagtttgacttcaagagagagacgattatagtaagcgagagattcgttgacagcaa 198  Q
    |||||||||||||||||            ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
15275615 gtactgcatgggaggaa------------ttttcgataggagatgagtttgacttcaagagagagacgattatagtaagcgagagattcgttgacagcga 15275528  T
199 acttgaccgggatgttcca-gtggggtttattccagcgtgacggtggatgt 248  Q
    ||||||||||||||||||| ||||||||| ||||||| |||||||||||||    
15275527 acttgaccgggatgttccatgtggggtttcttccagcatgacggtggatgt 15275477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 15264080 - 15263842
Alignment:
1 tttccgagagcgttttttcctaacctgataactgagttggaaaccggcattggcagggt-atcaagaagtcccttgagagggatacggaccttgccaatg 99  Q
    ||||| |||||||||||||||||| |||||||||| | |   |||||||| ||||| || |||||||||||||  |||||||||||||||||||||||||    
15264080 tttcccagagcgttttttcctaacttgataactgaatggatgaccggcataggcagagttatcaagaagtcccaagagagggatacggaccttgccaatg 15263981  T
100 gtactgcatgggaggaattttgggaggaattttcgata-gagatgagtttgacttcaagagagagacgattatagtaagcgagagattcgttgacagcaa 198  Q
    ||||||| |||||||||            ||||||||| || |||||||||| ||| |||||||||||||||| |||  |||||||||| ||||| || |    
15263980 gtactgcgtgggaggaa------------ttttcgataggaaatgagtttgatttcgagagagagacgattatggtagacgagagattccttgacggcga 15263893  T
199 acttgaccgggatgttcca-gtggggtttattccagcgtgacggtggatgt 248  Q
    ||||||  ||||||||||| || | |||| ||| |||||||| ||||||||    
15263892 acttgatggggatgttccatgtagcgtttcttctagcgtgacagtggatgt 15263842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 120 - 234
Target Start/End: Complemental strand, 15251464 - 15251348
Alignment:
120 tgggaggaattttcgatag-agatgagtttgacttcaagagagagacgattatagtaagcgagagattcgttgacagcaaacttgaccgggatgttcca- 217  Q
    ||||||||||||||||  | ||| |||||||||||| |||||||| | ||| | ||  ||||||||||| |||||    |||||||| |||||||||||     
15251464 tgggaggaattttcgacgggagaggagtttgacttcgagagagaggcaattctggttggcgagagattcattgacgatgaacttgacggggatgttccat 15251365  T
218 gtggggtttattccagc 234  Q
    ||||||||| |||||||    
15251364 gtggggtttcttccagc 15251348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 138 - 192
Target Start/End: Original strand, 14431289 - 14431343
Alignment:
138 gagatgagtttgacttcaagagagagacgattatagtaagcgagagattcgttga 192  Q
    |||||||||||||| || |||||||||||||| | || ||||||||| |||||||    
14431289 gagatgagtttgacctcgagagagagacgattctggttagcgagagaatcgttga 14431343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175964 times since January 2019
Visitors: 1577