View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A20 (Length: 453)

Name: R108-tnk507-A20
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A20
R108-tnk507-A20
[»] chr6 (4 HSPs)
chr6 (1-198)||(20026858-20027058)
chr6 (122-169)||(12437049-12437096)
chr6 (123-165)||(6101991-6102033)
chr6 (123-165)||(32031097-32031139)
[»] chr3 (4 HSPs)
chr3 (123-165)||(10762281-10762323)
chr3 (123-165)||(49156174-49156216)
chr3 (123-165)||(24645085-24645127)
chr3 (127-165)||(42192859-42192897)
[»] scaffold0208 (1 HSPs)
scaffold0208 (123-165)||(10887-10929)
[»] chr7 (6 HSPs)
chr7 (107-165)||(8486384-8486442)
chr7 (107-165)||(8499450-8499508)
chr7 (107-165)||(8521193-8521251)
chr7 (123-165)||(350292-350334)
chr7 (123-165)||(3812792-3812834)
chr7 (120-162)||(35149621-35149663)
[»] chr5 (6 HSPs)
chr5 (123-165)||(12687804-12687846)
chr5 (123-165)||(28527008-28527050)
chr5 (107-165)||(41295757-41295815)
chr5 (123-165)||(32095837-32095879)
chr5 (123-164)||(19061345-19061386)
chr5 (106-165)||(35918082-35918142)
[»] chr2 (2 HSPs)
chr2 (123-165)||(23342078-23342120)
chr2 (127-165)||(13460523-13460561)
[»] chr1 (3 HSPs)
chr1 (123-165)||(38145500-38145542)
chr1 (127-165)||(25383174-25383212)
chr1 (123-165)||(31056540-31056582)
[»] chr4 (4 HSPs)
chr4 (108-160)||(3769091-3769143)
chr4 (123-165)||(5187319-5187361)
chr4 (107-165)||(26958447-26958504)
chr4 (123-165)||(48165671-48165713)
[»] chr8 (2 HSPs)
chr8 (123-165)||(10704302-10704344)
chr8 (123-165)||(39728868-39728910)


Alignment Details
Target: chr6 (Bit Score: 157; Significance: 3e-83; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 20027058 - 20026858
Alignment:
1 gattagtc-ttggtactggctaagggtttggggagaaaggggtttgctactgcaaccaagcaattggtgcatacgctctaggataaaa-catacaatgaa 98  Q
    |||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||    
20027058 gattagtcattggtactggataagggtttggggagaaaggggtttgctactgcaaccaagcaattggtgcatacgctctacgatgaaatcatacaatgaa 20026959  T
99 agagcggacataatttattgtcttttatgtcaattcatttacaactttattgatataactcttttgtc-taaccaaatgattcatttagaataatatcca 197  Q
    ||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
20026958 agagccgacataatttattgtcttttatgtcgattcatttacaactttattgatataactcttttgtcataaccaaatgattcatttagaataatatcca 20026859  T
198 a 198  Q
    |    
20026858 a 20026858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 122 - 169
Target Start/End: Complemental strand, 12437096 - 12437049
Alignment:
122 tttatgtcaattcatttacaactttattgatataactcttttgtctaa 169  Q
    |||||||||||| |||| |||||||||| |||||||||||||||||||    
12437096 tttatgtcaatttattttcaactttattaatataactcttttgtctaa 12437049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 123 - 165
Target Start/End: Complemental strand, 6102033 - 6101991
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| ||||||| ||||||||||||||||||||||||||    
6102033 ttatgtcatttcattttcaactttattgatataactcttttgt 6101991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 165
Target Start/End: Original strand, 32031097 - 32031139
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| || |||| ||||||||||||||||||||||||||    
32031097 ttatgtcattttattttcaactttattgatataactcttttgt 32031139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 39; Significance: 0.0000000000007; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 123 - 165
Target Start/End: Original strand, 10762281 - 10762323
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| ||||||||||||||||||||||||||||||||||    
10762281 ttatgtcatttcatttacaactttattgatataactcttttgt 10762323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 123 - 165
Target Start/End: Complemental strand, 49156216 - 49156174
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| ||||||||||||||||||||||||||||||||||    
49156216 ttatgtcatttcatttacaactttattgatataactcttttgt 49156174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 123 - 165
Target Start/End: Original strand, 24645085 - 24645127
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| ||||||| ||||||||||||||||||||||||||    
24645085 ttatgtcatttcattttcaactttattgatataactcttttgt 24645127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 127 - 165
Target Start/End: Original strand, 42192859 - 42192897
Alignment:
127 gtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||| ||||||| ||||||||||||||||||||||||||    
42192859 gtcatttcattttcaactttattgatataactcttttgt 42192897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0208 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0208
Description:

Target: scaffold0208; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 123 - 165
Target Start/End: Complemental strand, 10929 - 10887
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| ||||||| ||||||||||||||||||||||||||    
10929 ttatgtcatttcattttcaactttattgatataactcttttgt 10887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 35; Significance: 0.0000000002; HSPs: 6)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 107 - 165
Target Start/End: Complemental strand, 8486442 - 8486384
Alignment:
107 cataatttattgtcttttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||||||  |||| ||||||||| |||| |||||||| |||||||||||||||||    
8486442 cataatttattaactttaatgtcaatttattttcaactttactgatataactcttttgt 8486384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 107 - 165
Target Start/End: Complemental strand, 8499508 - 8499450
Alignment:
107 cataatttattgtcttttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||||||  |||| ||||||||| |||| |||||||| |||||||||||||||||    
8499508 cataatttattaactttaatgtcaatttattttcaactttactgatataactcttttgt 8499450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 107 - 165
Target Start/End: Complemental strand, 8521251 - 8521193
Alignment:
107 cataatttattgtcttttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||||||  |||| ||||||||| |||| |||||||| |||||||||||||||||    
8521251 cataatttattaactttaatgtcaatttattttcaactttactgatataactcttttgt 8521193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 165
Target Start/End: Complemental strand, 350334 - 350292
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| || |||| ||||||||||||||||||||||||||    
350334 ttatgtcattttattttcaactttattgatataactcttttgt 350292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 165
Target Start/End: Original strand, 3812792 - 3812834
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| || |||| ||||||||||||||||||||||||||    
3812792 ttatgtcattttattttcaactttattgatataactcttttgt 3812834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 120 - 162
Target Start/End: Original strand, 35149621 - 35149663
Alignment:
120 cttttatgtcaattcatttacaactttattgatataactcttt 162  Q
    |||| ||||||||| |||| |||||||||||||||||||||||    
35149621 ctttaatgtcaatttattttcaactttattgatataactcttt 35149663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.0000000002; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 123 - 165
Target Start/End: Original strand, 12687804 - 12687846
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| ||||||| ||||||||||||||||||||||||||    
12687804 ttatgtcatttcattttcaactttattgatataactcttttgt 12687846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 123 - 165
Target Start/End: Original strand, 28527008 - 28527050
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| |||||||||||||||||| |||||||||||||||    
28527008 ttatgtcatttcatttacaactttattaatataactcttttgt 28527050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 107 - 165
Target Start/End: Complemental strand, 41295815 - 41295757
Alignment:
107 cataatttattgtcttttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    ||||| |||||  |||| ||||||||| |||| ||||||||||||||||||||||||||    
41295815 cataacttattaactttaatgtcaatttattttcaactttattgatataactcttttgt 41295757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 165
Target Start/End: Original strand, 32095837 - 32095879
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||| | ||||||| ||||||||||||||||||||||||||    
32095837 ttatgtaatttcattttcaactttattgatataactcttttgt 32095879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 123 - 164
Target Start/End: Original strand, 19061345 - 19061386
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttg 164  Q
    |||||||| ||||||| ||||||||||||||||| |||||||    
19061345 ttatgtcatttcattttcaactttattgatataagtcttttg 19061386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 106 - 165
Target Start/End: Original strand, 35918082 - 35918142
Alignment:
106 acataatttattgtcttttatgtc-aattcatttacaactttattgatataactcttttgt 165  Q
    |||||||||||| ||||||||||  ||||  ||||||| |||||| |||||||||||||||    
35918082 acataatttattatcttttatgttgaatttgtttacaattttattaatataactcttttgt 35918142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 123 - 165
Target Start/End: Complemental strand, 23342120 - 23342078
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| ||||||| ||||||||||||||||||||||||||    
23342120 ttatgtcatttcattttcaactttattgatataactcttttgt 23342078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 127 - 165
Target Start/End: Complemental strand, 13460561 - 13460523
Alignment:
127 gtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||| ||||||| ||||||||||||||||||||||||||    
13460561 gtcatttcattttcaactttattgatataactcttttgt 13460523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 35; Significance: 0.0000000002; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 123 - 165
Target Start/End: Original strand, 38145500 - 38145542
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| ||||||| ||||||||||||||||||||||||||    
38145500 ttatgtcatttcattttcaactttattgatataactcttttgt 38145542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 127 - 165
Target Start/End: Original strand, 25383174 - 25383212
Alignment:
127 gtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||| ||||||| ||||||||||||||||||||||||||    
25383174 gtcatttcattttcaactttattgatataactcttttgt 25383212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 165
Target Start/End: Complemental strand, 31056582 - 31056540
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| || |||| ||||||||||||||||||||||||||    
31056582 ttatgtcattttattttcaactttattgatataactcttttgt 31056540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000003; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 108 - 160
Target Start/End: Complemental strand, 3769143 - 3769091
Alignment:
108 ataatttattgtcttttatgtcaattcatttacaactttattgatataactct 160  Q
    |||||||||| |||||| |||||||| |||| ||||||||| |||||||||||    
3769143 ataatttattatcttttttgtcaatttattttcaactttatcgatataactct 3769091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 165
Target Start/End: Complemental strand, 5187361 - 5187319
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| ||||||| ||||||||||||||||| ||||||||    
5187361 ttatgtcatttcattttcaactttattgatataattcttttgt 5187319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 107 - 165
Target Start/End: Original strand, 26958447 - 26958504
Alignment:
107 cataatttattgtcttttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||||||  |||| ||||||||| |||| |||||| |||||||||||||||||||    
26958447 cataatttattaactttaatgtcaatttattttcaactt-attgatataactcttttgt 26958504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 165
Target Start/End: Complemental strand, 48165713 - 48165671
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| || |||| ||||||||||||||||||||||||||    
48165713 ttatgtcattttattttcaactttattgatataactcttttgt 48165671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000004; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 165
Target Start/End: Complemental strand, 10704344 - 10704302
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| || |||| ||||||||||||||||||||||||||    
10704344 ttatgtcattttattttcaactttattgatataactcttttgt 10704302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 123 - 165
Target Start/End: Original strand, 39728868 - 39728910
Alignment:
123 ttatgtcaattcatttacaactttattgatataactcttttgt 165  Q
    |||||||| ||||||| ||||||||||| ||||||||||||||    
39728868 ttatgtcatttcattttcaactttattggtataactcttttgt 39728910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108363 times since January 2019
Visitors: 1329