View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A3 (Length: 409)

Name: R108-tnk507-A3
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A3
R108-tnk507-A3
[»] chr3 (4 HSPs)
chr3 (7-327)||(39935656-39935976)
chr3 (324-382)||(39935289-39935347)
chr3 (98-191)||(48437538-48437631)
chr3 (143-238)||(50338261-50338356)
[»] chr4 (3 HSPs)
chr4 (141-220)||(29738143-29738222)
chr4 (143-238)||(9684906-9685001)
chr4 (161-238)||(7544725-7544803)
[»] chr6 (2 HSPs)
chr6 (143-238)||(31188072-31188167)
chr6 (143-238)||(31199916-31200011)
[»] chr2 (1 HSPs)
chr2 (145-232)||(7958809-7958896)
[»] chr1 (1 HSPs)
chr1 (187-238)||(26428904-26428955)
[»] chr7 (1 HSPs)
chr7 (123-238)||(16831737-16831852)


Alignment Details
Target: chr3 (Bit Score: 289; Significance: 1e-162; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 7 - 327
Target Start/End: Original strand, 39935656 - 39935976
Alignment:
7 aggaaataactggtttttaatatggattgtaaaataatctggatattttcaaaaaccgaaccatatatgattataaatcggttttgtaagcataaccggt 106  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||    
39935656 aggaaataactggtttttaatatggattgtaaaataatctggatattttcaaaaaccgaaccatatatgattataaatcgattttttaagcataatcggt 39935755  T
107 tatttatccataacaatatttatatctagtttcgtgaccggttcataataaaatatggtcgtggttatgaatccaaattcacataaatggtttataaatg 206  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
39935756 tatttatccataacaatatttatatctagtttcgtgaccagttcataataaaatatggtcatggttatgaatccaaattcacataaatggtttataaatg 39935855  T
207 aatatggtttggttggtcaaaatatccgaccacgcatatcctataagcaaatgccactgcaaattccaactatgttgatgtcatacctacaatttcgaac 306  Q
    |||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
39935856 aatatggtttggttggtcaaaatatccgaccacgcacaccctataagcaaatgccaatgcaaattccaactatgttgatgtcatacctacaatttcgaac 39935955  T
307 aacggaaagttgtatttatta 327  Q
    |||||||||||||||||||||    
39935956 aacggaaagttgtatttatta 39935976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 324 - 382
Target Start/End: Original strand, 39935289 - 39935347
Alignment:
324 attaatcaaatattctagaaaatcatagtttctattcatcattctagaaaacaagattc 382  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
39935289 attaatcaaatattctagaaaatcatagtttctattcatgattctagaaaacaagattc 39935347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 98 - 191
Target Start/End: Original strand, 48437538 - 48437631
Alignment:
98 ataaccggttatttatccataacaatatttatatctagtttcgtgaccggttcataataaaatatggtcgtggttatgaatccaaattcacata 191  Q
    ||||||| ||||||||||||||  |||||||||||  ||||||||||   || ||| ||||||| |||| |||||||| |||||||| ||||||    
48437538 ataaccgattatttatccataatcatatttatatccggtttcgtgactaatttatattaaaatacggtcatggttatggatccaaatccacata 48437631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 143 - 238
Target Start/End: Complemental strand, 50338356 - 50338261
Alignment:
143 accggttcataataaaatatggtcgtggttatgaatccaaattcacataaatggtttataaatgaatatggtttggttggtcaaaatatccgacca 238  Q
    ||||||| | |||||||||||||  |||||| |||||||||   | ||||||   ||||| ||| |||||||||||| ||||||||||||||||||    
50338356 accggtttacaataaaatatggttatggttaggaatccaaaactatataaattacttatatatggatatggtttggtcggtcaaaatatccgacca 50338261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 56; Significance: 4e-23; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 141 - 220
Target Start/End: Complemental strand, 29738222 - 29738143
Alignment:
141 tgaccggttcataataaaatatggtcgtggttatgaatccaaattcacataaatggtttataaatgaatatggtttggtt 220  Q
    ||||||||| ||||||| |||||||| |||||||||||| |||||||||||| ||||||||||||| |||||||||||||    
29738222 tgaccggtttataataagatatggtcctggttatgaatctaaattcacataagtggtttataaatggatatggtttggtt 29738143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 143 - 238
Target Start/End: Complemental strand, 9685001 - 9684906
Alignment:
143 accggttcataataaaatatggtcgtggttatgaatccaaattcacataaatggtttataaatgaatatggtttggttggtcaaaatatccgacca 238  Q
    ||||||| | |||||||||||||  ||||||||||||||||  || ||||  | |||||| ||| ||||||||| || ||||||||||||||||||    
9685001 accggtttacaataaaatatggtaatggttatgaatccaaaaccatataagagatttatatatgtatatggttttgtaggtcaaaatatccgacca 9684906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 161 - 238
Target Start/End: Original strand, 7544725 - 7544803
Alignment:
161 atggtcgtggttatgaatccaaattcacataaatggtttataaat-gaatatggtttggttggtcaaaatatccgacca 238  Q
    |||||| ||||||||||||||||| || |||| || ||||||||| | |||| ||||||| ||||| ||||| ||||||    
7544725 atggtcatggttatgaatccaaatccatataagtgatttataaatgggatattgtttggtcggtcagaatattcgacca 7544803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 143 - 238
Target Start/End: Original strand, 31188072 - 31188167
Alignment:
143 accggttcataataaaatatggtcgtggttatgaatccaaattcacataaatggtttataaatgaatatggtttggttggtcaaaatatccgacca 238  Q
    ||||||| | |||||||||||||| |||||| |||||||||  || |||| ||||||||| ||| |||||||||||| ||||||||||||| ||||    
31188072 accggtttacaataaaatatggtcttggttaggaatccaaaaccatataagtggtttatatatggatatggtttggtcggtcaaaatatccaacca 31188167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 143 - 238
Target Start/End: Original strand, 31199916 - 31200011
Alignment:
143 accggttcataataaaatatggtcgtggttatgaatccaaattcacataaatggtttataaatgaatatggtttggttggtcaaaatatccgacca 238  Q
    ||||||| | |||||||||||||| |||||| |||||||||  || |||| ||||||||| ||| |||||||||||| ||||||||||||| ||||    
31199916 accggtttacaataaaatatggtcctggttaggaatccaaaaccatataagtggtttatatatggatatggtttggtcggtcaaaatatccaacca 31200011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 6e-16; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 145 - 232
Target Start/End: Complemental strand, 7958896 - 7958809
Alignment:
145 cggttcataataaaatatggtcgtggttatgaatccaaattcacataaatggtttataaatgaatatggtttggttggtcaaaatatc 232  Q
    ||||| |||||||||||||||  |||||||||||||||||  | |||| || |||||| ||| |||||||||||| ||||||||||||    
7958896 cggtttataataaaatatggttatggttatgaatccaaatctatataagtgatttatatatggatatggtttggtcggtcaaaatatc 7958809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 187 - 238
Target Start/End: Original strand, 26428904 - 26428955
Alignment:
187 acataaatggtttataaatgaatatggtttggttggtcaaaatatccgacca 238  Q
    ||||||||||||||||||| ||||| ||||  ||||||||||||||||||||    
26428904 acataaatggtttataaataaatatagtttaattggtcaaaatatccgacca 26428955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 123 - 238
Target Start/End: Original strand, 16831737 - 16831852
Alignment:
123 tatttatatctagtttcgtgaccggttcataataaaatatggtcgtggttatgaatccaaattcacataaatggtttataaatgaatatggtttggttgg 222  Q
    |||||||||| | ||| |||||| ||| ||||||||| ||| |  ||||||  ||| |||||  | ||||||  |||||||||| ||||  |||| ||||    
16831737 tatttatatccaatttggtgaccagtttataataaaacatgattatggttagaaattcaaatctatataaataatttataaatgtatataatttgattgg 16831836  T
223 tcaaaatatccgacca 238  Q
    ||||||||||||||||    
16831837 tcaaaatatccgacca 16831852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108062 times since January 2019
Visitors: 1329