View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A30 (Length: 597)

Name: R108-tnk507-A30
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A30
R108-tnk507-A30
[»] chr4 (56 HSPs)
chr4 (1-330)||(51791528-51791861)
chr4 (331-450)||(53337370-53337490)
chr4 (329-450)||(47833609-47833731)
chr4 (329-450)||(3372119-3372241)
chr4 (329-450)||(48336261-48336383)
chr4 (330-450)||(3904693-3904814)
chr4 (331-450)||(6121903-6122023)
chr4 (331-450)||(20538696-20538816)
chr4 (328-450)||(43900546-43900669)
chr4 (329-450)||(3992974-3993096)
chr4 (331-448)||(24704370-24704488)
chr4 (329-450)||(42797730-42797852)
chr4 (331-450)||(5986876-5986996)
chr4 (331-450)||(46797725-46797845)
chr4 (329-450)||(51894592-51894714)
chr4 (337-450)||(52756681-52756795)
chr4 (330-446)||(7579309-7579426)
chr4 (330-450)||(40913199-40913320)
chr4 (330-450)||(47838627-47838748)
chr4 (327-450)||(41469776-41469900)
chr4 (340-450)||(33621805-33621916)
chr4 (343-455)||(41615681-41615794)
chr4 (343-450)||(3422073-3422180)
chr4 (330-441)||(33551200-33551312)
chr4 (330-419)||(26231576-26231666)
chr4 (330-419)||(25855082-25855172)
chr4 (331-385)||(4780371-4780425)
chr4 (337-445)||(17344219-17344328)
chr4 (331-377)||(42797816-42797862)
chr4 (342-399)||(29845656-29845713)
chr4 (329-377)||(3422144-3422192)
chr4 (329-377)||(41469764-41469812)
chr4 (329-377)||(47838615-47838663)
chr4 (337-399)||(17236849-17236912)
chr4 (330-385)||(24704446-24704501)
chr4 (337-387)||(5986950-5987000)
chr4 (331-377)||(6121893-6121939)
chr4 (331-377)||(46797809-46797855)
chr4 (331-377)||(47833695-47833741)
chr4 (346-447)||(50430431-50430533)
chr4 (331-377)||(51894582-51894628)
chr4 (330-375)||(3904682-3904727)
chr4 (336-377)||(40913194-40913235)
chr4 (331-375)||(20538686-20538730)
chr4 (329-377)||(33621880-33621928)
chr4 (329-377)||(48336347-48336395)
chr4 (330-377)||(3993060-3993107)
chr4 (330-377)||(53337454-53337501)
chr4 (331-377)||(3372205-3372251)
chr4 (331-377)||(7579394-7579440)
chr4 (331-377)||(43900633-43900679)
chr4 (331-377)||(44900080-44900126)
chr4 (460-519)||(51791862-51791923)
chr4 (342-399)||(6924746-6924802)
chr4 (338-387)||(41615683-41615732)
chr4 (345-385)||(32822285-32822325)
[»] scaffold0009 (2 HSPs)
scaffold0009 (328-450)||(49502-49625)
scaffold0009 (331-387)||(49579-49635)
[»] chr6 (42 HSPs)
chr6 (329-455)||(33052799-33052926)
chr6 (329-450)||(8382979-8383101)
chr6 (330-450)||(2830334-2830455)
chr6 (330-450)||(11572155-11572276)
chr6 (331-450)||(6330115-6330235)
chr6 (331-450)||(26602323-26602443)
chr6 (329-450)||(13853603-13853725)
chr6 (330-450)||(8099529-8099650)
chr6 (329-450)||(6068564-6068686)
chr6 (330-450)||(35031011-35031132)
chr6 (331-450)||(9644696-9644816)
chr6 (331-450)||(9650713-9650833)
chr6 (329-450)||(8417803-8417925)
chr6 (330-446)||(6143553-6143670)
chr6 (347-449)||(28747145-28747248)
chr6 (331-419)||(13043758-13043847)
chr6 (331-450)||(22896471-22896582)
chr6 (361-450)||(17992018-17992108)
chr6 (346-448)||(7596989-7597092)
chr6 (339-399)||(6069002-6069062)
chr6 (327-377)||(9644780-9644830)
chr6 (327-377)||(9650797-9650847)
chr6 (330-387)||(3788111-3788168)
chr6 (328-377)||(8099614-8099663)
chr6 (329-377)||(26602407-26602455)
chr6 (329-450)||(3788034-3788157)
chr6 (330-377)||(6330199-6330246)
chr6 (330-377)||(11572144-11572191)
chr6 (330-377)||(13853592-13853639)
chr6 (331-377)||(2830419-2830465)
chr6 (350-388)||(6549902-6549940)
chr6 (328-450)||(8186366-8186487)
chr6 (331-377)||(8382969-8383015)
chr6 (336-424)||(14936493-14936582)
chr6 (330-375)||(35031000-35031045)
chr6 (330-377)||(6068650-6068697)
chr6 (331-377)||(8417793-8417839)
chr6 (342-375)||(12473651-12473684)
chr6 (328-377)||(33052791-33052840)
chr6 (400-441)||(33393165-33393206)
chr6 (394-422)||(8162714-8162742)
chr6 (331-375)||(17992074-17992118)
[»] chr1 (47 HSPs)
chr1 (329-450)||(26471075-26471197)
chr1 (329-450)||(12483638-12483760)
chr1 (329-450)||(27159368-27159490)
chr1 (329-450)||(44668103-44668225)
chr1 (330-450)||(9981646-9981767)
chr1 (327-450)||(11795929-11796053)
chr1 (331-450)||(31842805-31842925)
chr1 (331-450)||(39401976-39402096)
chr1 (328-450)||(14984834-14984957)
chr1 (331-446)||(47216713-47216829)
chr1 (339-450)||(47777491-47777603)
chr1 (330-446)||(34042695-34042812)
chr1 (331-450)||(1050888-1051008)
chr1 (331-450)||(44955216-44955336)
chr1 (331-440)||(23278021-23278131)
chr1 (329-445)||(47588352-47588469)
chr1 (329-450)||(25694317-25694439)
chr1 (337-450)||(47969700-47969815)
chr1 (330-450)||(17556751-17556873)
chr1 (330-450)||(11897053-11897174)
chr1 (346-450)||(11989796-11989901)
chr1 (330-450)||(16448118-16448239)
chr1 (330-453)||(12213481-12213605)
chr1 (328-377)||(11897138-11897187)
chr1 (331-450)||(37552141-37552261)
chr1 (330-385)||(37552217-37552272)
chr1 (329-387)||(12483626-12483684)
chr1 (342-446)||(12047117-12047223)
chr1 (329-377)||(14984921-14984969)
chr1 (330-453)||(25694326-25694450)
chr1 (337-377)||(44955212-44955252)
chr1 (330-377)||(17556837-17556884)
chr1 (326-377)||(47777476-47777527)
chr1 (331-377)||(11796017-11796063)
chr1 (331-377)||(27159358-27159404)
chr1 (331-377)||(31842795-31842841)
chr1 (331-377)||(39401966-39402012)
chr1 (331-377)||(44668093-44668139)
chr1 (328-377)||(1050972-1051021)
chr1 (336-377)||(9981731-9981772)
chr1 (328-377)||(34042780-34042829)
chr1 (343-450)||(12043616-12043723)
chr1 (330-377)||(47216698-47216745)
chr1 (331-377)||(26471065-26471111)
chr1 (340-389)||(5392218-5392267)
chr1 (400-445)||(28017936-28017981)
chr1 (341-385)||(12062635-12062679)
[»] chr7 (38 HSPs)
chr7 (330-450)||(28536761-28536882)
chr7 (330-453)||(38063920-38064044)
chr7 (328-450)||(46840857-46840980)
chr7 (329-450)||(1738457-1738579)
chr7 (329-450)||(7240747-7240869)
chr7 (326-446)||(1565743-1565864)
chr7 (331-455)||(36016201-36016326)
chr7 (329-450)||(9268754-9268876)
chr7 (329-450)||(22285697-22285819)
chr7 (330-450)||(7482224-7482345)
chr7 (331-450)||(23314149-23314269)
chr7 (331-446)||(31319413-31319529)
chr7 (331-448)||(36583395-36583513)
chr7 (330-450)||(4790247-4790368)
chr7 (337-448)||(94330-94442)
chr7 (331-450)||(38441460-38441580)
chr7 (347-450)||(33418392-33418496)
chr7 (337-450)||(40840129-40840243)
chr7 (327-450)||(9575405-9575529)
chr7 (324-377)||(23314132-23314185)
chr7 (329-377)||(1738445-1738493)
chr7 (329-377)||(7240833-7240881)
chr7 (329-377)||(7482309-7482357)
chr7 (330-377)||(9268840-9268887)
chr7 (331-377)||(22285783-22285829)
chr7 (331-377)||(38441544-38441590)
chr7 (331-377)||(46840944-46840990)
chr7 (331-450)||(7269415-7269535)
chr7 (337-377)||(33418460-33418500)
chr7 (329-377)||(36583479-36583527)
chr7 (329-377)||(38063911-38063959)
chr7 (330-377)||(4790332-4790379)
chr7 (324-375)||(9575495-9575546)
chr7 (338-377)||(40840126-40840165)
chr7 (338-385)||(46877666-46877713)
chr7 (331-377)||(94318-94364)
chr7 (331-377)||(31319399-31319445)
chr7 (341-377)||(36016206-36016242)
[»] chr8 (48 HSPs)
chr8 (331-450)||(44498197-44498317)
chr8 (329-450)||(54622-54744)
chr8 (329-450)||(2890172-2890294)
chr8 (329-450)||(7785788-7785910)
chr8 (331-450)||(6552655-6552775)
chr8 (329-450)||(7805709-7805831)
chr8 (330-450)||(43199364-43199485)
chr8 (331-450)||(3304288-3304408)
chr8 (331-450)||(7012171-7012291)
chr8 (331-450)||(12343150-12343270)
chr8 (331-450)||(31654613-31654733)
chr8 (331-450)||(39571213-39571333)
chr8 (329-450)||(33289271-33289393)
chr8 (330-450)||(12763664-12763785)
chr8 (330-450)||(25601010-25601131)
chr8 (330-450)||(32211373-32211494)
chr8 (331-446)||(15888366-15888482)
chr8 (331-450)||(32114485-32114605)
chr8 (330-445)||(13578856-13578972)
chr8 (331-450)||(8587170-8587290)
chr8 (328-393)||(4245649-4245714)
chr8 (336-445)||(17006916-17007026)
chr8 (336-445)||(17570221-17570331)
chr8 (328-450)||(24691989-24692111)
chr8 (336-399)||(28463616-28463679)
chr8 (324-385)||(25600993-25601054)
chr8 (329-385)||(27422266-27422322)
chr8 (366-463)||(13246791-13246889)
chr8 (328-377)||(39571200-39571249)
chr8 (329-377)||(7785776-7785824)
chr8 (327-375)||(32211359-32211407)
chr8 (330-377)||(54611-54658)
chr8 (330-377)||(2890161-2890208)
chr8 (330-377)||(43199353-43199400)
chr8 (331-377)||(6552739-6552785)
chr8 (338-388)||(13246801-13246851)
chr8 (331-377)||(33289261-33289307)
chr8 (328-377)||(7012255-7012304)
chr8 (328-377)||(12763651-12763700)
chr8 (329-377)||(7805697-7805745)
chr8 (337-377)||(12343146-12343186)
chr8 (329-377)||(44498185-44498233)
chr8 (328-375)||(32114472-32114519)
chr8 (331-377)||(3304278-3304324)
chr8 (343-424)||(24203009-24203091)
chr8 (331-377)||(31654697-31654743)
chr8 (328-377)||(15888349-15888398)
chr8 (346-445)||(28999063-28999163)
[»] chr5 (42 HSPs)
chr5 (331-450)||(26350360-26350480)
chr5 (331-450)||(9395350-9395470)
chr5 (328-450)||(36563548-36563671)
chr5 (329-450)||(37148965-37149087)
chr5 (330-450)||(13103023-13103144)
chr5 (330-450)||(23359941-23360062)
chr5 (330-450)||(41989417-41989538)
chr5 (331-449)||(11795168-11795287)
chr5 (330-448)||(13033050-13033169)
chr5 (328-450)||(17025621-17025744)
chr5 (329-450)||(37641951-37642074)
chr5 (328-450)||(4443957-4444080)
chr5 (329-450)||(20848072-20848193)
chr5 (329-440)||(582987-583099)
chr5 (355-450)||(21575970-21576066)
chr5 (352-450)||(6126845-6126944)
chr5 (330-399)||(38361753-38361822)
chr5 (338-418)||(13539909-13539986)
chr5 (330-460)||(2629544-2629675)
chr5 (345-450)||(3549557-3549663)
chr5 (331-447)||(39290775-39290891)
chr5 (328-377)||(41989404-41989453)
chr5 (329-377)||(9395434-9395482)
chr5 (329-377)||(13103108-13103156)
chr5 (330-377)||(17025708-17025755)
chr5 (330-377)||(36563537-36563584)
chr5 (331-377)||(6126908-6126954)
chr5 (337-375)||(11574166-11574204)
chr5 (331-377)||(23360026-23360072)
chr5 (336-385)||(966224-966273)
chr5 (355-446)||(2366352-2366444)
chr5 (329-377)||(13033135-13033183)
chr5 (330-377)||(11795252-11795299)
chr5 (330-377)||(21576030-21576077)
chr5 (330-377)||(37642038-37642085)
chr5 (340-449)||(966157-966267)
chr5 (331-377)||(37148955-37149001)
chr5 (337-386)||(3549553-3549602)
chr5 (336-377)||(4444044-4444085)
chr5 (338-387)||(27081014-27081063)
chr5 (345-389)||(2366352-2366396)
chr5 (339-375)||(36595782-36595818)
[»] chr3 (59 HSPs)
chr3 (329-455)||(22721929-22722056)
chr3 (329-450)||(8437423-8437545)
chr3 (330-450)||(19557062-19557183)
chr3 (327-463)||(44785393-44785530)
chr3 (330-450)||(49823391-49823512)
chr3 (331-450)||(10297979-10298099)
chr3 (331-450)||(17653712-17653832)
chr3 (331-450)||(37508921-37509041)
chr3 (328-450)||(8817396-8817519)
chr3 (329-450)||(4238592-4238714)
chr3 (329-450)||(34080040-34080162)
chr3 (329-450)||(42507365-42507487)
chr3 (331-450)||(48340397-48340517)
chr3 (328-450)||(9111504-9111627)
chr3 (329-455)||(42170351-42170478)
chr3 (337-450)||(2787842-2787956)
chr3 (329-450)||(21295336-21295458)
chr3 (329-450)||(38964390-38964512)
chr3 (337-450)||(40691006-40691120)
chr3 (330-450)||(36095690-36095811)
chr3 (330-450)||(46208029-46208150)
chr3 (331-450)||(51406673-51406793)
chr3 (326-448)||(35513468-35513591)
chr3 (336-450)||(6013346-6013461)
chr3 (338-448)||(33942944-33943055)
chr3 (328-449)||(9213513-9213635)
chr3 (330-377)||(46208114-46208161)
chr3 (327-377)||(10298063-10298113)
chr3 (331-377)||(21295326-21295372)
chr3 (328-377)||(17653796-17653845)
chr3 (337-386)||(33128212-33128261)
chr3 (328-377)||(40690993-40691042)
chr3 (330-377)||(4238678-4238725)
chr3 (330-377)||(37509005-37509052)
chr3 (330-377)||(49823380-49823427)
chr3 (331-377)||(6013336-6013382)
chr3 (331-389)||(9213588-9213646)
chr3 (331-377)||(19557052-19557098)
chr3 (331-377)||(34080030-34080076)
chr3 (331-377)||(38964476-38964522)
chr3 (331-377)||(48340481-48340527)
chr3 (328-377)||(9027139-9027188)
chr3 (336-377)||(9111499-9111540)
chr3 (336-377)||(42507360-42507401)
chr3 (343-415)||(43323072-43323145)
chr3 (330-375)||(51406759-51406804)
chr3 (329-377)||(8817384-8817432)
chr3 (330-446)||(5323205-5323323)
chr3 (330-377)||(8437509-8437556)
chr3 (338-377)||(22722015-22722054)
chr3 (341-384)||(26001141-26001184)
chr3 (346-381)||(29285838-29285873)
chr3 (331-377)||(2787832-2787878)
chr3 (348-413)||(8951943-8952009)
chr3 (331-377)||(44785396-44785442)
chr3 (406-455)||(8092593-8092642)
chr3 (331-399)||(2131734-2131802)
chr3 (341-377)||(42170356-42170392)
chr3 (329-385)||(45652067-45652123)
[»] chr2 (54 HSPs)
chr2 (328-450)||(41478649-41478772)
chr2 (329-450)||(37990023-37990145)
chr2 (330-450)||(3055557-3055678)
chr2 (330-450)||(15896841-15896962)
chr2 (330-450)||(44397546-44397667)
chr2 (330-450)||(44398685-44398806)
chr2 (331-450)||(13197720-13197840)
chr2 (328-450)||(13344481-13344604)
chr2 (337-455)||(16243788-16243907)
chr2 (329-450)||(15372224-15372346)
chr2 (330-450)||(38917532-38917653)
chr2 (331-450)||(6648529-6648649)
chr2 (331-450)||(16044327-16044447)
chr2 (331-450)||(37666620-37666740)
chr2 (337-450)||(9047765-9047879)
chr2 (331-450)||(12337947-12338067)
chr2 (330-419)||(4683973-4684063)
chr2 (342-450)||(41492906-41493015)
chr2 (336-450)||(30099192-30099307)
chr2 (331-445)||(12170414-12170529)
chr2 (359-450)||(44804588-44804680)
chr2 (350-449)||(16734802-16734902)
chr2 (329-377)||(41492894-41492942)
chr2 (362-419)||(41453090-41453148)
chr2 (328-377)||(3055642-3055691)
chr2 (328-377)||(37990010-37990059)
chr2 (329-377)||(6648517-6648565)
chr2 (329-377)||(9047753-9047801)
chr2 (329-377)||(41478637-41478685)
chr2 (330-377)||(38917521-38917568)
chr2 (330-377)||(44398770-44398817)
chr2 (331-377)||(12337937-12337983)
chr2 (331-377)||(13197710-13197756)
chr2 (331-389)||(13724102-13724160)
chr2 (331-377)||(15372310-15372356)
chr2 (331-377)||(15896926-15896972)
chr2 (337-399)||(31150659-31150721)
chr2 (345-446)||(36089457-36089559)
chr2 (329-377)||(16243781-16243829)
chr2 (329-389)||(23227344-23227404)
chr2 (329-377)||(37666608-37666656)
chr2 (330-377)||(13344568-13344615)
chr2 (330-377)||(30099181-30099228)
chr2 (330-377)||(44397631-44397678)
chr2 (331-377)||(16044317-16044363)
chr2 (408-454)||(23986784-23986830)
chr2 (341-454)||(23986788-23986902)
chr2 (330-396)||(30852682-30852748)
chr2 (327-389)||(40714014-40714076)
chr2 (346-399)||(4553072-4553125)
chr2 (336-377)||(44804583-44804624)
chr2 (329-385)||(10069283-10069339)
chr2 (401-445)||(15243990-15244034)
chr2 (341-401)||(36688892-36688952)
[»] scaffold0482 (2 HSPs)
scaffold0482 (329-450)||(12858-12980)
scaffold0482 (329-377)||(12944-12992)
[»] scaffold0204 (2 HSPs)
scaffold0204 (329-450)||(23783-23905)
scaffold0204 (329-377)||(23869-23917)
[»] scaffold1707 (1 HSPs)
scaffold1707 (338-448)||(1342-1453)
[»] scaffold0464 (2 HSPs)
scaffold0464 (331-450)||(6141-6261)
scaffold0464 (329-377)||(6129-6177)
[»] scaffold0650 (1 HSPs)
scaffold0650 (330-444)||(1-115)
[»] scaffold0011 (2 HSPs)
scaffold0011 (331-450)||(231313-231433)
scaffold0011 (328-377)||(231300-231349)
[»] scaffold0415 (1 HSPs)
scaffold0415 (342-399)||(13788-13845)
[»] scaffold0171 (1 HSPs)
scaffold0171 (336-377)||(12437-12478)


Alignment Details
Target: chr4 (Bit Score: 282; Significance: 1e-158; HSPs: 56)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 1 - 330
Target Start/End: Original strand, 51791528 - 51791861
Alignment:
1 atgaatcatttgcctaagattcatctcatccaaatctagtctttatcttgaagttgttggagggaggaatctgaaattgat-gattgaaccccaccttta 99  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||    
51791528 atgaatcatttgcctaagattcatctcatccaaatccagtctttatcttcaagttgttggagggaggaatctgaaattgattgattgaaccccaccttta 51791627  T
100 aatggcgccattaaagtgtttgctcaaattggacccatgagaggaaatatattgaaaaca-ttggacttgatattgaaatgaagatatagttgaatcacc 198  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
51791628 aatggcgccattaaagtgtatgctcaaattggacccatgagaggaaatatattgaaaacacttggacttgatattgaaatgaagatatagttgaatcacc 51791727  T
199 tgggtggtggtggtgatctaattagtgattagtggttcaa-cttctgccttcaactccttcgtggccatctcaattctttccttcctccattgtaaatcg 297  Q
    || ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51791728 tgagtggtggtggtgatctaattagtgattagtggttcaatcttctgccttcaactccttcgtggccatctcaattctttccttcctccattgtaaatcg 51791827  T
298 gtttgtttgggatgcgaata-aaaatgagataaa 330  Q
    |||||||||||| ||||||| |||||||||||||    
51791828 gtttgtttgggacgcgaatagaaaatgagataaa 51791861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 53337370 - 53337490
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||  |||    
53337370 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttattgacccaa 53337469  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
53337470 aattctcttataaataggacc 53337490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 47833609 - 47833731
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
47833609 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 47833708  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
47833709 aaaattctcttataaataggacc 47833731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 3372119 - 3372241
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
3372119 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 3372218  T
428 aaaattctcttataaataggacc 450  Q
    |||||| ||||||||||||||||    
3372219 aaaattatcttataaataggacc 3372241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 48336261 - 48336383
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
48336261 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 48336360  T
428 aaaattctcttataaataggacc 450  Q
    |||||| ||||||||||||||||    
48336361 aaaattttcttataaataggacc 48336383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 3904814 - 3904693
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| ||||  ||    
3904814 atactacctccggtcctatttataaaagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactaaatacatcaatttttgttgaccca 3904715  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
3904714 aaattctcttataaataggacc 3904693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 6122023 - 6121903
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
6122023 tactacctccggtcctatttataagagaaatttagatcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 6121924  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
6121923 aattctcttataaataggacc 6121903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 20538816 - 20538696
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| ||||  |||    
20538816 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaaattttgttgacccaa 20538717  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
20538716 aattctcttataaataggacc 20538696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 328 - 450
Target Start/End: Original strand, 43900546 - 43900669
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgatt 426  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| || |      
43900546 aaatactccctccggtcctatttataagagaaatttaggtcaacaaaagtaaatgtatttggactgaatttttaactagatacatcaacttttgttaacc 43900645  T
427 caaaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||||    
43900646 caaaattctcttataaataggacc 43900669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 3992974 - 3993096
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
3992974 aatactacctccggtcctatttataagagaaatttcggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 3993073  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||| ||||    
3993074 aaaattctcttataaataagacc 3993096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 331 - 448
Target Start/End: Original strand, 24704370 - 24704488
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||| ||||  |||    
24704370 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacattaacttttgttgacccaa 24704469  T
430 aattctcttataaatagga 448  Q
    |||||||||||||||||||    
24704470 aattctcttataaatagga 24704488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 42797730 - 42797852
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||       
42797730 aatactacctccggtcctatatataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacct 42797829  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
42797830 aaaattctcttataaataggacc 42797852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 5986876 - 5986996
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||  |||    
5986876 tactacctccgattctatttataagagaaatataggtcaacaaaagtgaatgtatttggactgaatttttaactaaatacatcaacttttgttgacccaa 5986975  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
5986976 aattctcttataaataggacc 5986996  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 46797725 - 46797845
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||| ||||  |||    
46797725 tactacctccggttctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatatatcaacttttgttgacccaa 46797824  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
46797825 aattctcttataaataggacc 46797845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 51894714 - 51894592
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| ||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| ||||||| | |||||||||||||| ||||  |    
51894714 aatactacctccggtcctatttataagaaaaatttaggtcaacaaaagtgaatgtttttggactgaatttttaaccagatacatcaacttttgttgaccc 51894615  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
51894614 aaaattctcttataaataggacc 51894592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 337 - 450
Target Start/End: Original strand, 52756681 - 52756795
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattct 435  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||||||||    
52756681 ctccggtcctatttataagagaaatttaggtcaacataagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaaaattct 52756780  T
436 cttataaataggacc 450  Q
     ||||||||||||||    
52756781 tttataaataggacc 52756795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 330 - 446
Target Start/End: Original strand, 7579309 - 7579426
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| ||||||||| |||||||||||||| ||||  ||    
7579309 atactacctccggtcctatttataagagaaatttaggttaacaaaagtgaatgtatttggattgaatttttaactagatacatcaacttttgttgaccca 7579408  T
429 aaattctcttataaatag 446  Q
    ||||||||||||||||||    
7579409 aaattctcttataaatag 7579426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 40913320 - 40913199
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||  ||| |||||||||| ||||| ||    
40913320 atactccctccggtcctatttataagagaaatttagatcaacaaaagtgaatgtatttggactgaatttttaactggatatatcaacttttgttgatcca 40913221  T
429 aaattctcttataaataggacc 450  Q
    || |||||||||||||||||||    
40913220 aatttctcttataaataggacc 40913199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 47838748 - 47838627
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||   |    
47838748 atactacctccgatcctatttataagagaaatttcggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccaa 47838649  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
47838648 aaattctcttataaataggacc 47838627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 81; E-Value: 8e-38
Query Start/End: Original strand, 327 - 450
Target Start/End: Complemental strand, 41469900 - 41469776
Alignment:
327 taaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgat 425  Q
    |||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||| ||||     
41469900 taaatacttccttcggtcctatttataaaagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaaatagatacatcaacttttgttgac 41469801  T
426 tcaaaattctcttataaataggacc 450  Q
      |||||||||||||||||||||||    
41469800 caaaaattctcttataaataggacc 41469776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 340 - 450
Target Start/End: Original strand, 33621805 - 33621916
Alignment:
340 cggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattctctt 438  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  ||||||| ||||    
33621805 cggttctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaaaattatctt 33621904  T
439 ataaataggacc 450  Q
    ||||||||||||    
33621905 ataaataggacc 33621916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 343 - 455
Target Start/End: Complemental strand, 41615794 - 41615681
Alignment:
343 tcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattctcttata 441  Q
    |||||||||||||||||| |||||||||||||||| |||||||||||||| || |||||||||||||||||||||||| ||||| |||  ||||||||||    
41615794 tcctatttataagagaaaattaggtcaacaaaagttaatgtatttggacttaatttttaactaaatacatcaacttttgttgatccaattttctcttata 41615695  T
442 aataggaccagatg 455  Q
    ||||||||| ||||    
41615694 aataggaccggatg 41615681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 343 - 450
Target Start/End: Original strand, 3422073 - 3422180
Alignment:
343 tcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgattcaaaattctcttata 441  Q
    ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| ||||| |||||||||||||| ||||  |||||||||||||||    
3422073 tcctatttataagagaaatttaggtcaacaaaa-tgaatgtatttgaactgaatttttaactagatacatcaacttttgttgacccaaaattctcttata 3422171  T
442 aataggacc 450  Q
    |||||||||    
3422172 aataggacc 3422180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 330 - 441
Target Start/End: Original strand, 33551200 - 33551312
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |||||||||||||| |  |  ||    
33551200 atactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtattttgactgaatttttaactagatacatcaacttttgtaaaccca 33551299  T
429 aaattctcttata 441  Q
    |||||||||||||    
33551300 aaattctcttata 33551312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 330 - 419
Target Start/End: Original strand, 26231576 - 26231666
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaactttt 419  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||| ||||||||||    
26231576 atactacctccggtcctatttataagagaaatttaggtcaacaaaagcgaatgtatttggactgaatttttaactagatatatcaactttt 26231666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 330 - 419
Target Start/End: Original strand, 25855082 - 25855172
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaactttt 419  Q
    ||||| |||| |||||||||||| ||||||| ||  |||||||||||| ||||||||||||||||| ||||||| ||||||||| ||||||    
25855082 atactccctcaggtcctatttatgagagaaagttgagtcaacaaaagttaatgtatttggactgaatttttaaccaaatacatcgactttt 25855172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 331 - 385
Target Start/End: Complemental strand, 4780425 - 4780371
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtat 385  Q
    |||| |||||||||||||||||||||||||||| ||||||||||||| |||||||    
4780425 tactccctccggtcctatttataagagaaattttggtcaacaaaagttaatgtat 4780371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 337 - 445
Target Start/End: Original strand, 17344219 - 17344328
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaattttaactaa-atacatcaacttttattgattcaaaattct 435  Q
    ||||||| |||||||||||||||| |||  |||||||||||  |||||| || |||||||||| | |   |||||||||||||| ||||| |||| ||||    
17344219 ctccggttctatttataagagaaagttaaatcaacaaaagttgatgtatctgaactgaatttttaatcggatacatcaacttttgttgatccaaatttct 17344318  T
436 cttataaata 445  Q
    ||||||||||    
17344319 cttataaata 17344328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 42797862 - 42797816
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| |||||||||||||||||    
42797862 tactccctccggtcctatttataagagaattttaggtcaacaaaagt 42797816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 342 - 399
Target Start/End: Original strand, 29845656 - 29845713
Alignment:
342 gtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt 399  Q
    |||||| ||||||||||||||||||||||||||| | ||| |||||| ||||||||||    
29845656 gtcctacttataagagaaatttaggtcaacaaaaattaatatatttgaactgaatttt 29845713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 3422192 - 3422144
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| |||||||||||||    
3422192 aatactccctccggtcctatttataagagaattttgggtcaacaaaagt 3422144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 377
Target Start/End: Original strand, 41469764 - 41469812
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| |||||||||||||    
41469764 aatactccctccggtcctatttataagagaatttttggtcaacaaaagt 41469812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 377
Target Start/End: Original strand, 47838615 - 47838663
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| |||||||||||||    
47838615 aatactccctccggtcctatttataagagaatttttggtcaacaaaagt 47838663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 337 - 399
Target Start/End: Complemental strand, 17236912 - 17236849
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgta-tttggactgaatttt 399  Q
    |||||||||||||||||||| |||||| |||||||||||||  ||||| ||| |||||||||||    
17236912 ctccggtcctatttataagaaaaatttgggtcaacaaaagttgatgtattttagactgaatttt 17236849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 385
Target Start/End: Complemental strand, 24704501 - 24704446
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtat 385  Q
    ||||| |||||| ||||||||||||||||| ||| ||||||||||||| |||||||    
24704501 atactccctccgatcctatttataagagaattttgggtcaacaaaagttaatgtat 24704446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 337 - 387
Target Start/End: Complemental strand, 5987000 - 5986950
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtattt 387  Q
    ||||||||||||||||||||||| ||| |||||||||||||  ||||||||    
5987000 ctccggtcctatttataagagaattttgggtcaacaaaagttgatgtattt 5986950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 6121893 - 6121939
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
6121893 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 6121939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 46797855 - 46797809
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
46797855 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 46797809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 47833741 - 47833695
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
47833741 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 47833695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 346 - 447
Target Start/End: Complemental strand, 50430533 - 50430431
Alignment:
346 tatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattctcttataaat 444  Q
    |||||||||||| || || |||||||||||||  ||||||||||| |||| ||||||| | ||||||||| |||| ||||  ||||  | ||||||||||    
50430533 tatttataagagcaagttgggtcaacaaaagttgatgtatttggattgaatttttaaccagatacatcaatttttgttgacccaaatatatcttataaat 50430434  T
445 agg 447  Q
    |||    
50430433 agg 50430431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 51894582 - 51894628
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
51894582 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 51894628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 330 - 375
Target Start/End: Original strand, 3904682 - 3904727
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaa 375  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||    
3904682 atactccctccggtcctatttataagagaattttgggtcaacaaaa 3904727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 336 - 377
Target Start/End: Original strand, 40913194 - 40913235
Alignment:
336 cctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||||||||||||||||||||||||| | |||||||||||    
40913194 cctccggtcctatttataagagaaatttggatcaacaaaagt 40913235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 331 - 375
Target Start/End: Original strand, 20538686 - 20538730
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaa 375  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||    
20538686 tactccctccggtcctatttataagagaattttgggtcaacaaaa 20538730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 33621928 - 33621880
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| ||||||||||||||||||||| || ||| |||||||||||||    
33621928 aatactccctccggtcctatttataagataattttgggtcaacaaaagt 33621880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 48336395 - 48336347
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| ||||||||||||||||||||| || ||| |||||||||||||    
48336395 aatactccctccggtcctatttataagaaaattttgggtcaacaaaagt 48336347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 3993107 - 3993060
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| ||||||||| |||||||||||||| ||| |||||||||||||    
3993107 atactccctccggtcttatttataagagaattttgggtcaacaaaagt 3993060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 53337501 - 53337454
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||| ||||||    
53337501 atactccctccggtcctatttataagagaattttgggtcaataaaagt 53337454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 3372251 - 3372205
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| ||||||||||||||||||||| || ||| |||||||||||||    
3372251 tactccctccggtcctatttataagataattttgggtcaacaaaagt 3372205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 7579440 - 7579394
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||| ||||||||||||||| ||| |||||||||||||    
7579440 tacttcctccggttctatttataagagaattttgggtcaacaaaagt 7579394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 43900679 - 43900633
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| ||| |||||||||    
43900679 tacttcctccggtcctatttataagagaattttgggttaacaaaagt 43900633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 44900080 - 44900126
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| ||||||||||||||||||||||| |||  |||||||||||||    
44900080 tactccctccggtcctatttataagagatattctggtcaacaaaagt 44900126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 460 - 519
Target Start/End: Original strand, 51791862 - 51791923
Alignment:
460 agttcgtatgggttttaaagggaggtccccattttc-ctttccttaaaa-nattaaattcat 519  Q
    |||||||||| ||||| |||||| |||||||||||| ||||||||||||  |||||||||||    
51791862 agttcgtatgtgtttttaagggatgtccccattttctctttccttaaaataattaaattcat 51791923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 399
Target Start/End: Complemental strand, 6924802 - 6924746
Alignment:
342 gtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt 399  Q
    ||||||| ||||||| ||| |||||||||||||||| ||||||||||| || ||||||    
6924802 gtcctatatataaga-aaagttaggtcaacaaaagttaatgtatttggtctaaatttt 6924746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 338 - 387
Target Start/End: Original strand, 41615683 - 41615732
Alignment:
338 tccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtattt 387  Q
    ||||||||||||||||||||||| || | |||||||||||  ||||||||    
41615683 tccggtcctatttataagagaaaattggatcaacaaaagttgatgtattt 41615732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 345 - 385
Target Start/End: Complemental strand, 32822325 - 32822285
Alignment:
345 ctatttataagagaaatttaggtcaacaaaagtgaatgtat 385  Q
    |||||||||||| |||||||||||||||||| || ||||||    
32822325 ctatttataagaaaaatttaggtcaacaaaaatggatgtat 32822285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 100; Significance: 4e-49; HSPs: 2)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 100; E-Value: 4e-49
Query Start/End: Original strand, 328 - 450
Target Start/End: Original strand, 49502 - 49625
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgatt 426  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||      
49502 aaatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactaaatacatcaacttttgttgacc 49601  T
427 caaaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||||    
49602 caaaattctcttataaataggacc 49625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 331 - 387
Target Start/End: Complemental strand, 49635 - 49579
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtattt 387  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||  ||||||||    
49635 tactccctccggtcctatttataagagaattttgggtcaacaaaagttgatgtattt 49579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 100; Significance: 4e-49; HSPs: 42)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 100; E-Value: 4e-49
Query Start/End: Original strand, 329 - 455
Target Start/End: Complemental strand, 33052926 - 33052799
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||  |    
33052926 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttattgaccc 33052827  T
428 aaaattctcttataaataggaccagatg 455  Q
    ||||||||||||||||||||||| ||||    
33052826 aaaattctcttataaataggaccggatg 33052799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 8383101 - 8382979
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
8383101 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 8383002  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
8383001 aaaattctcttataaataggacc 8382979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 330 - 450
Target Start/End: Original strand, 2830334 - 2830455
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  ||    
2830334 atactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccca 2830433  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
2830434 aaattctcttataaataggacc 2830455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 11572276 - 11572155
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  ||    
11572276 atactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccca 11572177  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
11572176 aaattctcttataaataggacc 11572155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 6330115 - 6330235
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
6330115 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 6330214  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
6330215 aattctcttataaataggacc 6330235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 26602323 - 26602443
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
26602323 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 26602422  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
26602423 aattctcttataaataggacc 26602443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 13853725 - 13853603
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
13853725 aatactaccttcggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 13853626  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
13853625 aaaattctcttataaataggacc 13853603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 330 - 450
Target Start/End: Original strand, 8099529 - 8099650
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||| ||||  ||    
8099529 atactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggattgaatttttaactagatacatcaacttttgttgaccca 8099628  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
8099629 aaattctcttataaataggacc 8099650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 6068564 - 6068686
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |||| ||||||||| |||||||||||||| |||| ||    
6068564 aatactacctccggtcctatttataagaaaaatttaggtcaataaaagtgaatgtatttggattgaatttttaactagatacatcaacttttgttgactc 6068663  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
6068664 aaaattctcttataaataggacc 6068686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 35031132 - 35031011
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| ||||  ||    
35031132 atactacctccggtcctatttataagaaaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaatttttgttgaccca 35031033  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
35031032 aaattctcttataaataggacc 35031011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 9644696 - 9644816
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
9644696 tactacctccggtcctatttataagagaaatttaggtcaacataaatgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 9644795  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
9644796 aattctcttataaataggacc 9644816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 9650713 - 9650833
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
9650713 tactacctccggtcctatttataagagaaatttaggtcaacataaatgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 9650812  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
9650813 aattctcttataaataggacc 9650833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 8417925 - 8417803
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||| ||||  |    
8417925 aatactccctctggtcttatttataagagaaatttaggtcaacaaaagtgaatgtatttggattgaatttttaactagatacatcaacttttgttgaccc 8417826  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
8417825 aaaattctcttataaataggacc 8417803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 330 - 446
Target Start/End: Original strand, 6143553 - 6143670
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||| |||   ||    
6143553 atactacctccgatcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggattgaatttttaactagatacatcaacttttgttgtccca 6143652  T
429 aaattctcttataaatag 446  Q
    ||||||||||||||||||    
6143653 aaattctcttataaatag 6143670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 347 - 449
Target Start/End: Complemental strand, 28747248 - 28747145
Alignment:
347 atttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattctcttataaata 445  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| || |||||||||||||| ||||  |||||||||||||||||||    
28747248 atttataagagaaatttagatcaacaaaagtgaatgtatttggactgaatttttaattagatacatcaacttttgttgacccaaaattctcttataaata 28747149  T
446 ggac 449  Q
    ||||    
28747148 ggac 28747145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 331 - 419
Target Start/End: Original strand, 13043758 - 13043847
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaactttt 419  Q
    |||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||| | |||| ||||||||| ||||||||||||||    
13043758 tactacctccggttctatttataagagaaatttaggtcaacaaaaatgaatgtatttgaattgaatttttaactagatacatcaactttt 13043847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 22896471 - 22896582
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||| ||||||||||||         |||||||||||||||||| ||||| |||||||||||||| ||||   ||    
22896471 tactccctccggtcctatttataagagaagtttaggtcaaca---------gtatttggactgaatttttaactagatacatcaacttttgttgacaaaa 22896561  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
22896562 aattctcttataaataggacc 22896582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 361 - 450
Target Start/End: Original strand, 17992018 - 17992108
Alignment:
361 tttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattctcttataaataggacc 450  Q
    |||||||||| ||||||||||||||||||| |||| ||||||||| ||||||| | |||| ||||  ||||||||||||||||||||||||    
17992018 tttaggtcaataaaagtgaatgtatttggattgaatttttaactagatacatcgatttttgttgacccaaaattctcttataaataggacc 17992108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 346 - 448
Target Start/End: Complemental strand, 7597092 - 7596989
Alignment:
346 tatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgattcaaaattctcttataaat 444  Q
    ||||||||||||||| ||  || |||||||||  ||||||  | |||||||||| ||||||||||||||||||||||||| ||||| ||||| |||||||    
7597092 tatttataagagaaagttgtgttaacaaaagttgatgtatccgaactgaatttttaactaaatacatcaacttttattgactcaaatttctcctataaat 7596993  T
445 agga 448  Q
    ||||    
7596992 agga 7596989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 339 - 399
Target Start/End: Complemental strand, 6069062 - 6069002
Alignment:
339 ccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt 399  Q
    |||||||||||||||| ||| |||||||||||||||||| ||||||||||| || ||||||    
6069062 ccggtcctatttataaaagatatttaggtcaacaaaagttaatgtatttggtctaaatttt 6069002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 327 - 377
Target Start/End: Complemental strand, 9644830 - 9644780
Alignment:
327 taaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||||| |||||||||||||||||||||||| ||| |||||||||||||    
9644830 taaatactccctccggtcctatttataagagaattttgggtcaacaaaagt 9644780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 327 - 377
Target Start/End: Complemental strand, 9650847 - 9650797
Alignment:
327 taaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||||| |||||||||||||||||||||||| ||| |||||||||||||    
9650847 taaatactccctccggtcctatttataagagaattttgggtcaacaaaagt 9650797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 330 - 387
Target Start/End: Complemental strand, 3788168 - 3788111
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtattt 387  Q
    ||||| ||||||||| ||||||||||| ||||||||||||||||||||  ||||||||    
3788168 atactccctccggtcttatttataagataaatttaggtcaacaaaagttgatgtattt 3788111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 328 - 377
Target Start/End: Complemental strand, 8099663 - 8099614
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||| |||||||||||||||||||||||| ||| |||||||||||||    
8099663 aaatactccctccggtcctatttataagagaattttgggtcaacaaaagt 8099614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 26602455 - 26602407
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| |||||||||||||    
26602455 aatactccctccggtcctatttataagagaattttgggtcaacaaaagt 26602407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 3788034 - 3788157
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaa-caaaagtgaatgtatttggactgaatt-ttaactaaatacatcaacttttattgatt 426  Q
    |||||| ||| || |||||||||||||||||| || |||||| ||||| |   || || ||||||||||| |||||||||||||||||||||| ||||      
3788034 aatactccctacgatcctatttataagagaaagttgggtcaatcaaaatttgttggatgtggactgaattgttaactaaatacatcaacttttgttgacc 3788133  T
427 caaaattctcttataaataggacc 450  Q
     ||| || ||||||||||| ||||    
3788134 taaatttatcttataaataagacc 3788157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 6330246 - 6330199
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||    
6330246 atactccctccggtcctatttataagagaattttgggtcaacaaaagt 6330199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 11572144 - 11572191
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||    
11572144 atactccctccggtcctatttataagagaattttgggtcaacaaaagt 11572191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 13853592 - 13853639
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||    
13853592 atactccctccggtcctatttataagagaattttgggtcaacaaaagt 13853639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 2830465 - 2830419
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
2830465 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 2830419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 350 - 388
Target Start/End: Original strand, 6549902 - 6549940
Alignment:
350 tataagagaaatttaggtcaacaaaagtgaatgtatttg 388  Q
    |||||||||||||||||||||||||||| ||||||||||    
6549902 tataagagaaatttaggtcaacaaaagttaatgtatttg 6549940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 328 - 450
Target Start/End: Original strand, 8186366 - 8186487
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaattttaactaaatacatcaacttttattgattc 427  Q
    ||||||| |||||| |||||| || |||||| |||| |||||| ||||||  ||||||||| | | |||||  |  | |||||||||||||| ||||| |    
8186366 aaatacttcctccgctcctatatacaagagacatttgggtcaataaaagttgatgtatttg-attcaatttggatcagatacatcaacttttgttgatcc 8186464  T
428 aaaattctcttataaataggacc 450  Q
    ||| |||| ||||||||||||||    
8186465 aaatttcttttataaataggacc 8186487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 8382969 - 8383015
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
8382969 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 8383015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 336 - 424
Target Start/End: Complemental strand, 14936582 - 14936493
Alignment:
336 cctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatt-ttaactaaatacatcaacttttattga 424  Q
    |||| |||||||||||||||||| |||| ||||||||| |||  |||||||||||   |||| ||||||| |||||||| ||||| ||||    
14936582 cctctggtcctatttataagagatatttgggtcaacaatagttgatgtatttggaacaaattcttaactagatacatcaccttttgttga 14936493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 330 - 375
Target Start/End: Original strand, 35031000 - 35031045
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaa 375  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||    
35031000 atacttcctccggtcctatttataagagaattttgggtcaacaaaa 35031045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 6068697 - 6068650
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| |||  ||||||||||||    
6068697 atactccctccggtcctatttataagagaattttgagtcaacaaaagt 6068650  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 8417793 - 8417839
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| ||| |||||||||||||||||||| ||| |||||||||||||    
8417793 tactcccttcggtcctatttataagagaattttgggtcaacaaaagt 8417839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 342 - 375
Target Start/End: Original strand, 12473651 - 12473684
Alignment:
342 gtcctatttataagagaaatttaggtcaacaaaa 375  Q
    ||||||||||||||||||||||||||||| ||||    
12473651 gtcctatttataagagaaatttaggtcaataaaa 12473684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 377
Target Start/End: Original strand, 33052791 - 33052840
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||| | |||||||||||||||||||||| ||| |||||| ||||||    
33052791 aaatactccatccggtcctatttataagagaattttgggtcaataaaagt 33052840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 400 - 441
Target Start/End: Complemental strand, 33393206 - 33393165
Alignment:
400 aactaaatacatcaacttttattgattcaaaattctcttata 441  Q
    ||||| ||||||||||||||||||| ||||| ||||||||||    
33393206 aactagatacatcaacttttattgactcaaatttctcttata 33393165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 394 - 422
Target Start/End: Complemental strand, 8162742 - 8162714
Alignment:
394 aattttaactaaatacatcaacttttatt 422  Q
    |||||||||||||||||||||||||||||    
8162742 aattttaactaaatacatcaacttttatt 8162714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 331 - 375
Target Start/End: Complemental strand, 17992118 - 17992074
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaa 375  Q
    |||| ||| |||||||||||||||||||| ||| |||||||||||    
17992118 tactcccttcggtcctatttataagagaattttgggtcaacaaaa 17992074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 99; Significance: 1e-48; HSPs: 47)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 26471197 - 26471075
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||| |    
26471197 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgatcc 26471098  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
26471097 aaaattctcttataaataggacc 26471075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 12483760 - 12483638
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||| ||||  |    
12483760 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttagactgaattttgaactaaatacatcaacttttgttgaccc 12483661  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
12483660 aaaattctcttataaataggacc 12483638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 27159490 - 27159368
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
27159490 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 27159391  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
27159390 aaaattctcttataaataggacc 27159368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 44668225 - 44668103
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
44668225 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 44668126  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
44668125 aaaattctcttataaataggacc 44668103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 330 - 450
Target Start/End: Original strand, 9981646 - 9981767
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  ||    
9981646 atactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccca 9981745  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
9981746 aaattctcttataaataggacc 9981767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 327 - 450
Target Start/End: Original strand, 11795929 - 11796053
Alignment:
327 taaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgat 425  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||| ||||     
11795929 taaatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgcatttggactgaatttttaactagatacatcaacttttgttgac 11796028  T
426 tcaaaattctcttataaataggacc 450  Q
     ||||||||||||||||||||||||    
11796029 ccaaaattctcttataaataggacc 11796053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 31842925 - 31842805
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
31842925 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 31842826  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
31842825 aattctcttataaataggacc 31842805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 39402096 - 39401976
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
39402096 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 39401997  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
39401996 aattctcttataaataggacc 39401976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 328 - 450
Target Start/End: Original strand, 14984834 - 14984957
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgatt 426  Q
    |||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||      
14984834 aaatactatctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacc 14984933  T
427 caaaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||||    
14984934 caaaattctcttataaataggacc 14984957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 331 - 446
Target Start/End: Complemental strand, 47216829 - 47216713
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
47216829 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 47216730  T
430 aattctcttataaatag 446  Q
    |||||||||||||||||    
47216729 aattctcttataaatag 47216713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 339 - 450
Target Start/End: Complemental strand, 47777603 - 47777491
Alignment:
339 ccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgattcaaaattctct 437  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||  |||||||||||    
47777603 ccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaattttgaactagatacatcaacttttgttgacccaaaattctct 47777504  T
438 tataaataggacc 450  Q
    |||||||||||||    
47777503 tataaataggacc 47777491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 330 - 446
Target Start/End: Original strand, 34042695 - 34042812
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||| ||||  ||    
34042695 atactacctccggtcctatttataagagaaatttaggtcaacaaaaatgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccca 34042794  T
429 aaattctcttataaatag 446  Q
    ||||||||||||||||||    
34042795 aaattctcttataaatag 34042812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 1050888 - 1051008
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| |||||||||||||  ||||  |||    
1050888 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgcatttggactgaatttttaactagatacatcaactttagttgacccaa 1050987  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
1050988 aattctcttataaataggacc 1051008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 44955336 - 44955216
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||   ||    
44955336 tactacctccggtcctatttataagaaaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacctaa 44955237  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
44955236 aattctcttataaataggacc 44955216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 331 - 440
Target Start/End: Complemental strand, 23278131 - 23278021
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
23278131 tactacctccggtcctatttataagagaaatttaggtcaacaaaaatgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 23278032  T
430 aattctcttat 440  Q
    |||||||||||    
23278031 aattctcttat 23278021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 329 - 445
Target Start/End: Complemental strand, 47588469 - 47588352
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||| ||||  |    
47588469 aatactacctctggtcttatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaattagatacatcaacttttgttgaccc 47588370  T
428 aaaattctcttataaata 445  Q
    ||||||||||||||||||    
47588369 aaaattctcttataaata 47588352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 25694317 - 25694439
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||| | ||||||||||||||||||||||| |||| ||||||||||||||||||| |||| ||||||||| |||||||||||||| ||||  |    
25694317 aatactccctctgatcctatttataagagaaatttagatcaataaaagtgaatgtatttggattgaatttttaactagatacatcaacttttgttgaccc 25694416  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
25694417 aaaattctcttataaataggacc 25694439  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 337 - 450
Target Start/End: Original strand, 47969700 - 47969815
Alignment:
337 ctccggtcctatttataa-gagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattc 434  Q
    |||||||||||||||||| ||||||||||||||||||||||| ||||||||| ||||||| ||||||||| |||||||||||||| ||||| |||||||     
47969700 ctccggtcctatttataaagagaaatttaggtcaacaaaagtaaatgtatttagactgaatttttaactagatacatcaacttttgttgatccaaaatta 47969799  T
435 tcttataaataggacc 450  Q
    | ||||||||||||||    
47969800 ttttataaataggacc 47969815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 330 - 450
Target Start/End: Original strand, 17556751 - 17556873
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaag-tgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    ||||| |||| |||||||||||||||||||| ||||||||||||||| | ||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
17556751 atactccctctggtcctatttataagagaaagttaggtcaacaaaagttaaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 17556850  T
428 aaaattctcttataaataggacc 450  Q
    ||  |||||||||||||||||||    
17556851 aagtttctcttataaataggacc 17556873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 330 - 450
Target Start/End: Original strand, 11897053 - 11897174
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||||||||||||||||||||||| ||||||||||||||||  |||||| || |||||| |||||||   |||||||||||||| ||||  ||    
11897053 atactccctccggtcctatttataagagaaagttaggtcaacaaaagttgatgtatctgaactgaatttttaaccggatacatcaacttttgttgaccca 11897152  T
429 aaattctcttataaataggacc 450  Q
    || |||||||||||||||||||    
11897153 aatttctcttataaataggacc 11897174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 346 - 450
Target Start/End: Original strand, 11989796 - 11989901
Alignment:
346 tatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgattcaaaattctcttataaat 444  Q
    ||||||||||||||| || |||||||||||   ||| ||||||||||||||||| ||| ||||||||||| ||||||||| ||||| |||| ||||||||    
11989796 tatttataagagaaagttgggtcaacaaaaactaatatatttggactgaatttttaaccaaatacatcaatttttattgactcaaatttcttttataaat 11989895  T
445 aggacc 450  Q
    ||||||    
11989896 aggacc 11989901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 16448239 - 16448118
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgattca 428  Q
    ||||| ||||||||||||||||||||||||| || |||||||||||||  |||||| ||||||||||||| ||| | |||||| ||||||| ||||  ||    
16448239 atactccctccggtcctatttataagagaaagttgggtcaacaaaagttgatgtatctggactgaattttgaaccagatacataaacttttgttgaccca 16448140  T
429 aaattctcttataaataggacc 450  Q
    | |||| | |||||||| ||||    
16448139 atattcccctataaataagacc 16448118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 330 - 453
Target Start/End: Complemental strand, 12213605 - 12213481
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||| ||| ||||||||||||||  |||||||||||||| | ||||||||| || |||| ||||||||||||| ||||| |||| ||||  ||    
12213605 atactccctccagtcttatttataagagaatgttaggtcaacaaaaattaatgtatttagattgaatttttaactaaataaatcaatttttgttgaccca 12213506  T
429 aaattctcttataaataggaccaga 453  Q
    |  |||||| |||||||||||||||    
12213505 agtttctctaataaataggaccaga 12213481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 328 - 377
Target Start/End: Complemental strand, 11897187 - 11897138
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||| |||||||||||||||||||||||||||| |||||||||||||    
11897187 aaatactccctccggtcctatttataagagaaatttgggtcaacaaaagt 11897138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 37552141 - 37552261
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| ||||||||||||||||||||| ||| ||  |||||||| |||  |||||| ||||||||| ||||||| | ||||||  | |||| ||||  |||    
37552141 tactccctccggtcctatttataagataaagttgagtcaacaacagttcatgtatctggactgaatttttaaccagatacattcatttttgttgacccaa 37552240  T
430 aattctcttataaataggacc 450  Q
    | |||||||||||||||||||    
37552241 atttctcttataaataggacc 37552261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 385
Target Start/End: Complemental strand, 37552272 - 37552217
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtat 385  Q
    ||||| || ||||||||||||||||||||||||| ||||||||||| |||||||||    
37552272 atactccccccggtcctatttataagagaaatttgggtcaacaaaaatgaatgtat 37552217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 329 - 387
Target Start/End: Original strand, 12483626 - 12483684
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtattt 387  Q
    |||||| |||||||||||||||||||||||| ||| |||||||||||||  ||||||||    
12483626 aatactccctccggtcctatttataagagaattttgggtcaacaaaagttgatgtattt 12483684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 342 - 446
Target Start/End: Original strand, 12047117 - 12047223
Alignment:
342 gtcctatttataagagaaatttaggtcaacaaaa-gtgaatgtatttggactgaatttt--aactaaatacatcaacttttattgattcaaaattctctt 438  Q
    ||||||||||||||||||| ||  || ||||||| |||| ||||||| |||||||||||  ||||  |||||||||  ||||||||| |||| |||||||    
12047117 gtcctatttataagagaaagttgagttaacaaaaagtga-tgtatttagactgaattttttaactggatacatcaatctttattgatccaaatttctctt 12047215  T
439 ataaatag 446  Q
    ||||||||    
12047216 ataaatag 12047223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 14984969 - 14984921
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| |||||||||||||    
14984969 aatactccctccggtcctatttataagagaattttgggtcaacaaaagt 14984921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 330 - 453
Target Start/End: Complemental strand, 25694450 - 25694326
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaattttaa-ctaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||  |||||| | |    || || || | ||||||||  ||||||||||||  |    
25694450 atactccctccggtcctatttataagagaattttgggtcaacaaaagttgatgtatctagttaaaaattcaatccaaatacattcacttttattgatcta 25694351  T
429 aaattctcttataaataggaccaga 453  Q
    || ||||||||||||||||| ||||    
25694350 aatttctcttataaataggatcaga 25694326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 337 - 377
Target Start/End: Original strand, 44955212 - 44955252
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||||||||||||||||||| |||||||||||||||||    
44955212 ctccggtcctatttataagagaattttaggtcaacaaaagt 44955252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 17556884 - 17556837
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| ||||||||||||||||||||||||| || |||||||||||||    
17556884 atactccctccggtcctatttataagagaaacttgggtcaacaaaagt 17556837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 326 - 377
Target Start/End: Original strand, 47777476 - 47777527
Alignment:
326 ataaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||| |||||||||||||||||||||||| ||| |||||||||||||    
47777476 ataattactccctccggtcctatttataagagaattttgggtcaacaaaagt 47777527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 11796063 - 11796017
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
11796063 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 11796017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 27159358 - 27159404
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
27159358 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 27159404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 31842795 - 31842841
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
31842795 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 31842841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 39401966 - 39402012
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
39401966 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 39402012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 44668093 - 44668139
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
44668093 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 44668139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 328 - 377
Target Start/End: Complemental strand, 1051021 - 1050972
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||| |||||||||||||||||||||||| ||| ||||||| |||||    
1051021 aaatactccctccggtcctatttataagagaattttgggtcaactaaagt 1050972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 336 - 377
Target Start/End: Complemental strand, 9981772 - 9981731
Alignment:
336 cctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||||||||||||||||||||| ||| |||||||||||||    
9981772 cctccggtcctatttataagagaattttgggtcaacaaaagt 9981731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 328 - 377
Target Start/End: Complemental strand, 34042829 - 34042780
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||| |||||||| ||||||||||||||| ||| |||||||||||||    
34042829 aaatactccctccggttctatttataagagaattttgggtcaacaaaagt 34042780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 343 - 450
Target Start/End: Original strand, 12043616 - 12043723
Alignment:
343 tcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattctcttata 441  Q
    |||||||||||| ||| ||||| ||||||||||||  |||||||| || | || ||||||| | |||||| || |||| |||||| ||| || |||||||    
12043616 tcctatttataaaagatatttaagtcaacaaaagttgatgtattt-gattcaatttttaacaagatacattaatttttgttgatttaaatttttcttata 12043714  T
442 aataggacc 450  Q
    |||||||||    
12043715 aataggacc 12043723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 47216698 - 47216745
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||| ||||||||||||||| ||| |||||||||||||    
47216698 atactccctccggtactatttataagagaattttgggtcaacaaaagt 47216745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 26471065 - 26471111
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| | |||||||||||    
26471065 tactccctccggtcctatttataagagaattttggatcaacaaaagt 26471111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 340 - 389
Target Start/End: Complemental strand, 5392267 - 5392218
Alignment:
340 cggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttgg 389  Q
    |||||| || ||||||||||||||||||||| ||||||  ||||||||||    
5392267 cggtccaatatataagagaaatttaggtcaataaaagttgatgtatttgg 5392218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 400 - 445
Target Start/End: Complemental strand, 28017981 - 28017936
Alignment:
400 aactaaatacatcaacttttattgattcaaaattctcttataaata 445  Q
    |||||||||||| || |||||||||||||||  |||||||||||||    
28017981 aactaaatacattaatttttattgattcaaatatctcttataaata 28017936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 341 - 385
Target Start/End: Complemental strand, 12062679 - 12062635
Alignment:
341 ggtcctatttataagagaaatttaggtcaacaaaagtgaatgtat 385  Q
    ||||||||||||||||||||||||  ||||||||| | |||||||    
12062679 ggtcctatttataagagaaatttaaatcaacaaaaattaatgtat 12062635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 98; Significance: 6e-48; HSPs: 38)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 98; E-Value: 6e-48
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 28536882 - 28536761
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||| ||    
28536882 atactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggaatgaatttttaactagatacatcaacttttattgatcca 28536783  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
28536782 aaattctcttataaataggacc 28536761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 330 - 453
Target Start/End: Complemental strand, 38064044 - 38063920
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  ||    
38064044 atactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccca 38063945  T
429 aaattctcttataaataggaccaga 453  Q
    |||||||||||||||||||||||||    
38063944 aaattctcttataaataggaccaga 38063920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 328 - 450
Target Start/End: Original strand, 46840857 - 46840980
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgatt 426  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||      
46840857 aaatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacc 46840956  T
427 caaaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||||    
46840957 caaaattctcttataaataggacc 46840980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 1738579 - 1738457
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
1738579 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 1738480  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
1738479 aaaattctcttataaataggacc 1738457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 7240747 - 7240869
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
7240747 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 7240846  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
7240847 aaaattctcttataaataggacc 7240869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 326 - 446
Target Start/End: Complemental strand, 1565864 - 1565743
Alignment:
326 ataaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattga 424  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||    
1565864 ataaatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttga 1565765  T
425 ttcaaaattctcttataaatag 446  Q
      ||||||||||||||||||||    
1565764 cccaaaattctcttataaatag 1565743  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 331 - 455
Target Start/End: Complemental strand, 36016326 - 36016201
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||| ||||  |||    
36016326 tactccctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaaatagatacatcaacttttgttgacccaa 36016227  T
430 aattctcttataaataggaccagatg 455  Q
    ||||||||||||||||||||||||||    
36016226 aattctcttataaataggaccagatg 36016201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 9268754 - 9268876
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
9268754 aatactacctctggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 9268853  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
9268854 aaaattctcttataaataggacc 9268876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 22285697 - 22285819
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||| ||||  |    
22285697 aatactccctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaaatagatacatcaacttttgttgaccc 22285796  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
22285797 aaaattctcttataaataggacc 22285819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 330 - 450
Target Start/End: Original strand, 7482224 - 7482345
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||| ||||  ||    
7482224 atactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttgaactgaatttttaactagatacatcaacttttgttgaccca 7482323  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
7482324 aaattctcttataaataggacc 7482345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 23314269 - 23314149
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||| ||||  |||    
23314269 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatatatcaacttttgttgacccaa 23314170  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
23314169 aattctcttataaataggacc 23314149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 331 - 446
Target Start/End: Complemental strand, 31319529 - 31319413
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
31319529 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 31319430  T
430 aattctcttataaatag 446  Q
    |||||||||||||||||    
31319429 aattctcttataaatag 31319413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 331 - 448
Target Start/End: Original strand, 36583395 - 36583513
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||| ||||  |||    
36583395 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggacttaatttttaactagatacatcaacttttgttgacccaa 36583494  T
430 aattctcttataaatagga 448  Q
    |||||||||||||||||||    
36583495 aattctcttataaatagga 36583513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 330 - 450
Target Start/End: Original strand, 4790247 - 4790368
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| || ||||||||| |||||||||||||||||||  ||    
4790247 atactacctccggtcctatttataagaaaaatttaggtcaacaaaaatgaatgtatttggactaaatttttaactagatacatcaacttttattgaccca 4790346  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
4790347 aaattctcttataaataggacc 4790368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 337 - 448
Target Start/End: Complemental strand, 94442 - 94330
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattct 435  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |||||||||||||| ||||  |||||||||    
94442 ctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggacagaatttttaactagatacatcaacttttgttgacccaaaattct 94343  T
436 cttataaatagga 448  Q
    |||||||||||||    
94342 cttataaatagga 94330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 38441460 - 38441580
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||||||||| |||||||||||||| ||||  |||    
38441460 tactacctccggtcctatttataagagaaatttatgtcaacaaaagtgaatgtatttgaactgaatttttaactagatacatcaacttttgttgacccaa 38441559  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
38441560 aattctcttataaataggacc 38441580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 347 - 450
Target Start/End: Original strand, 33418392 - 33418496
Alignment:
347 atttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattctcttataaata 445  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||| ||||  |||||||||||||||||||    
33418392 atttttaagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaaatagatacatcaacttttgttgacccaaaattctcttataaata 33418491  T
446 ggacc 450  Q
    |||||    
33418492 ggacc 33418496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 337 - 450
Target Start/End: Complemental strand, 40840243 - 40840129
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattct 435  Q
    ||||||||||||||| |||||||| ||| || ||||||| | ||||||||||||||||| |||||||||| ||||||||||||| ||||   ||| ||||    
40840243 ctccggtcctatttagaagagaaagttaagttaacaaaaatcaatgtatttggactgaatttttaactaagtacatcaacttttgttgacaaaaatttct 40840144  T
436 cttataaataggacc 450  Q
    |||||||||||||||    
40840143 cttataaataggacc 40840129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 327 - 450
Target Start/End: Original strand, 9575405 - 9575529
Alignment:
327 taaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgat 425  Q
    |||||||| |||| |||||||||| ||||||||| || ||||||||||||| || |||||| ||||||| ||||||||| ||||||||| |||| ||||     
9575405 taaatactccctctggtcctatttgtaagagaaagttgggtcaacaaaagttaacgtatttagactgaatttttaactagatacatcaagttttgttgac 9575504  T
426 tcaaaattctcttataaataggacc 450  Q
      ||  |||||||||||||||||||    
9575505 caaactttctcttataaataggacc 9575529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 324 - 377
Target Start/End: Original strand, 23314132 - 23314185
Alignment:
324 agataaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||| |||||||||||||||||||||||| ||| |||||||||||||    
23314132 agataattactccctccggtcctatttataagagaattttgggtcaacaaaagt 23314185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 377
Target Start/End: Original strand, 1738445 - 1738493
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| |||||||||||||    
1738445 aatactccctccggtcctatttataagagaattttgggtcaacaaaagt 1738493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 7240881 - 7240833
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| |||||||||||||    
7240881 aatactccctccggtcctatttataagagaattttgggtcaacaaaagt 7240833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 7482357 - 7482309
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| |||||||||||||    
7482357 aatactccctccggtcctatttataagagaattttgggtcaacaaaagt 7482309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 9268887 - 9268840
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||    
9268887 atactccctccggtcctatttataagagaattttgggtcaacaaaagt 9268840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 22285829 - 22285783
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
22285829 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 22285783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 38441590 - 38441544
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
38441590 tacttcctccggtcctatttataagagaattttgggtcaacaaaagt 38441544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 46840990 - 46840944
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
46840990 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 46840944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 7269535 - 7269415
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| ||||||||| ||||||||||| ||| || ||||||||||| |  |||||| |  |||||| ||||||| | || ||||||||||| || |  |||    
7269535 tactccctccggtcttatttataagaaaaagttgggtcaacaaaaattgatgtatctaaactgaatttttaaccagatgcatcaacttttgttaacccaa 7269436  T
430 aattctcttataaataggacc 450  Q
      |||||||||||||||||||    
7269435 ctttctcttataaataggacc 7269415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 337 - 377
Target Start/End: Complemental strand, 33418500 - 33418460
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||||||||||||||||||| ||| |||||||||||||    
33418500 ctccggtcctatttataagagaattttgggtcaacaaaagt 33418460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 36583527 - 36583479
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||| ||||||||||||||||| ||| |||||||||||||    
36583527 aatactccctccgatcctatttataagagaattttgggtcaacaaaagt 36583479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 377
Target Start/End: Original strand, 38063911 - 38063959
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||| ||||||||||||||||||| ||| |||||||||||||    
38063911 aatactccctctggtcctatttataagagaattttgggtcaacaaaagt 38063959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 4790379 - 4790332
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||| ||||||    
4790379 atacttcctccggtcctatttataagagaattttgggtcaataaaagt 4790332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 324 - 375
Target Start/End: Complemental strand, 9575546 - 9575495
Alignment:
324 agataaatactgcctccggtcctatttataagagaaatttaggtcaacaaaa 375  Q
    |||||| |||| ||| ||||||||||||||||||||| || |||||||||||    
9575546 agataattactcccttcggtcctatttataagagaaagtttggtcaacaaaa 9575495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 338 - 377
Target Start/End: Original strand, 40840126 - 40840165
Alignment:
338 tccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||||||||||||||||||||||  ||||||||||||    
40840126 tccggtcctatttataagagaaatttttgtcaacaaaagt 40840165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 338 - 385
Target Start/End: Complemental strand, 46877713 - 46877666
Alignment:
338 tccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtat 385  Q
    ||||||||||| ||||||||||| || ||||||||||||| |||||||    
46877713 tccggtcctatatataagagaaagttgggtcaacaaaagttaatgtat 46877666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 94318 - 94364
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||| ||||||||||||||||| ||| |||||||||||||    
94318 tactccctccgatcctatttataagagaattttgggtcaacaaaagt 94364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 31319399 - 31319445
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||| ||||||||||||||| ||| |||||||||||||    
31319399 tactccctccggttctatttataagagaattttgggtcaacaaaagt 31319445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 341 - 377
Target Start/End: Original strand, 36016206 - 36016242
Alignment:
341 ggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||||||||||||||| ||| |||||||||||||    
36016206 ggtcctatttataagagaattttgggtcaacaaaagt 36016242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 97; Significance: 2e-47; HSPs: 48)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 44498317 - 44498197
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||  |||    
44498317 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttattgacccaa 44498218  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
44498217 aattctcttataaataggacc 44498197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 54744 - 54622
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
54744 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 54645  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
54644 aaaattctcttataaataggacc 54622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 2890294 - 2890172
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
2890294 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 2890195  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
2890194 aaaattctcttataaataggacc 2890172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 7785910 - 7785788
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
7785910 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 7785811  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
7785810 aaaattctcttataaataggacc 7785788  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 6552655 - 6552775
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
6552655 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 6552754  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
6552755 aattctcttataaataggacc 6552775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 7805831 - 7805709
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||  |||  |    
7805831 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgctgaccc 7805732  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
7805731 aaaattctcttataaataggacc 7805709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 43199485 - 43199364
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||   |    
43199485 atactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccaa 43199386  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
43199385 aaattctcttataaataggacc 43199364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 3304408 - 3304288
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
3304408 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 3304309  T
430 aattctcttataaataggacc 450  Q
    |||| ||||||||||||||||    
3304308 aattttcttataaataggacc 3304288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 7012171 - 7012291
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| ||||||||| |||||||||||||| ||||| |||    
7012171 tactacctccggtcctatttataagagaaatttagatcaacaaaagtgaatatatttggactgaatttttaactagatacatcaacttttgttgatccaa 7012270  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
7012271 aattctcttataaataggacc 7012291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 12343270 - 12343150
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||   ||    
12343270 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccaaa 12343171  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
12343170 aattctcttataaataggacc 12343150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 31654613 - 31654733
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
31654613 tactccctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 31654712  T
430 aattctcttataaataggacc 450  Q
    |||||| ||||||||||||||    
31654713 aattcttttataaataggacc 31654733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 39571333 - 39571213
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
39571333 tactacctccggtcctatttataagagaaatttagatcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 39571234  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
39571233 aattctcttataaataggacc 39571213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 33289393 - 33289271
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
33289393 aatactacctccggtcctatttataagagaaatttagatcaacataagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 33289294  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
33289293 aaaattctcttataaataggacc 33289271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 12763785 - 12763664
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  ||    
12763785 atactacctccggtcttatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccca 12763686  T
429 aaattctcttataaataggacc 450  Q
    ||||| ||||||||||||||||    
12763685 aaattatcttataaataggacc 12763664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 25601131 - 25601010
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| ||||||| ||||  ||    
25601131 atactacctccgatcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacattaacttttgttgaccca 25601032  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
25601031 aaattctcttataaataggacc 25601010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 32211494 - 32211373
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| ||||||||| |||| ||||  ||    
32211494 atactacctccggtcctatttataagagaaatttaggtcaacaaaaatgaatgtatttggactgaatttttaactagatacatcaatttttgttgaccca 32211395  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
32211394 aaattctcttataaataggacc 32211373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 331 - 446
Target Start/End: Complemental strand, 15888482 - 15888366
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||| ||||  |||    
15888482 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggattgaatttttaactagatacatcaacttttgttgacccaa 15888383  T
430 aattctcttataaatag 446  Q
    |||||||||||||||||    
15888382 aattctcttataaatag 15888366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 32114605 - 32114485
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| ||||  |||    
32114605 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaatttttgttgacccaa 32114506  T
430 aattctcttataaataggacc 450  Q
    |||| ||||||||||||||||    
32114505 aattttcttataaataggacc 32114485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 330 - 445
Target Start/End: Original strand, 13578856 - 13578972
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||| || |||||||||||||||||||||||||| ||||||||||||||||| |||||| ||||||||| |||||||||||||| ||||  ||    
13578856 atactacctccagttctatttataagagaaatttaggtcaataaaagtgaatgtatttgaactgaatttttaactagatacatcaacttttgttgaccca 13578955  T
429 aaattctcttataaata 445  Q
    |||||||||||||||||    
13578956 aaattctcttataaata 13578972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 8587170 - 8587290
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| ||||||||||||||||||||||||| || |||||||||||||  |||||||| |||| || ||||||||| ||||||||||||||||||| ||||    
8587170 tactccctccggtcctatttataagagaaagtttggtcaacaaaagttgatgtattttgactaaatttttaactagatacatcaacttttattgactcaa 8587269  T
430 aattctcttataaataggacc 450  Q
      |||||||||||||| ||||    
8587270 gtttctcttataaataagacc 8587290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 328 - 393
Target Start/End: Complemental strand, 4245714 - 4245649
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactg 393  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4245714 aaatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactg 4245649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 336 - 445
Target Start/End: Original strand, 17006916 - 17007026
Alignment:
336 cctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatt-ttaactaaatacatcaacttttattgattcaaaattc 434  Q
    |||||| |||||||||||||||||| || |||||||||||||  ||| || ||||||||||| ||||  | ||||||||||||||||||| | ||| |||    
17006916 cctccgatcctatttataagagaaagttgggtcaacaaaagttgatggatctggactgaattgttaatcagatacatcaacttttattgactaaaatttc 17007015  T
435 tcttataaata 445  Q
    |||||||||||    
17007016 tcttataaata 17007026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 336 - 445
Target Start/End: Complemental strand, 17570331 - 17570221
Alignment:
336 cctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatt-ttaactaaatacatcaacttttattgattcaaaattc 434  Q
    |||||| |||||||||||||||||| || |||||||||||||  ||| || ||||||||||| ||||  | ||||||||||||||||||| | ||| |||    
17570331 cctccgatcctatttataagagaaagttgggtcaacaaaagttgatggatctggactgaattgttaatcagatacatcaacttttattgactaaaatttc 17570232  T
435 tcttataaata 445  Q
    |||||||||||    
17570231 tcttataaata 17570221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 328 - 450
Target Start/End: Complemental strand, 24692111 - 24691989
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaattttaactaaatacatcaacttttattgattc 427  Q
    ||||||| ||| || |||||||||||||| ||| ||||||||||||||||  |||||| || ||||||||||||| | ||| |||||||||| ||||  |    
24692111 aaatactcccttcgatcctatttataagaaaaagttaggtcaacaaaagttgatgtatctgaactgaattttaaccagatatatcaacttttgttgaccc 24692012  T
428 aaaattctcttataaataggacc 450  Q
    ||| |||| ||| ||||||||||    
24692011 aaatttcttttaaaaataggacc 24691989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 336 - 399
Target Start/End: Original strand, 28463616 - 28463679
Alignment:
336 cctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt 399  Q
    ||||||||||||||||||||||||| || |||||||||||||  ||||||||||||||||||||    
28463616 cctccggtcctatttataagagaaagttgggtcaacaaaagttgatgtatttggactgaatttt 28463679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 324 - 385
Target Start/End: Original strand, 25600993 - 25601054
Alignment:
324 agataaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtat 385  Q
    ||||| ||||| |||||||||||||||||||||||| ||| ||||||||||||| |||||||    
25600993 agatatatactccctccggtcctatttataagagaattttgggtcaacaaaagttaatgtat 25601054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 329 - 385
Target Start/End: Complemental strand, 27422322 - 27422266
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtat 385  Q
    |||||| ||| |||||||||||||||||||||||| ||||||||||| |||||||||    
27422322 aatactcccttcggtcctatttataagagaaatttgggtcaacaaaaatgaatgtat 27422266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 366 - 463
Target Start/End: Complemental strand, 13246889 - 13246791
Alignment:
366 gtcaacaaaagtgaatgtatttggactgaattttaact-aaatacatcaacttttattgattcaaaattctcttataaataggaccagatgaaatagtt 463  Q
    ||||||||||||  |||||| ||||||||||||| | | ||||||||  | |||| ||||| |||| ||||||||||||||||| | ||||||||||||    
13246889 gtcaacaaaagttcatgtatctggactgaatttttagtcaaatacattcatttttgttgatccaaatttctcttataaataggatcggatgaaatagtt 13246791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 328 - 377
Target Start/End: Original strand, 39571200 - 39571249
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||| |||||||||||||||||||||||| ||| |||||||||||||    
39571200 aaatactccctccggtcctatttataagagaattttgggtcaacaaaagt 39571249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 377
Target Start/End: Original strand, 7785776 - 7785824
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| |||||||||||||    
7785776 aatactccctccggtcctatttataagagaattttgggtcaacaaaagt 7785824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 327 - 375
Target Start/End: Original strand, 32211359 - 32211407
Alignment:
327 taaatactgcctccggtcctatttataagagaaatttaggtcaacaaaa 375  Q
    |||||||| |||||||||||||||||||||||| ||| |||||||||||    
32211359 taaatactccctccggtcctatttataagagaattttgggtcaacaaaa 32211407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 54611 - 54658
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||    
54611 atactccctccggtcctatttataagagaattttgggtcaacaaaagt 54658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 2890161 - 2890208
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||    
2890161 atactccctccggtcctatttataagagaattttgggtcaacaaaagt 2890208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 43199353 - 43199400
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||    
43199353 atactccctccggtcctatttataagagaatttttggtcaacaaaagt 43199400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 6552785 - 6552739
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
6552785 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 6552739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 338 - 388
Target Start/End: Original strand, 13246801 - 13246851
Alignment:
338 tccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttg 388  Q
    |||| ||||||||||||||||||||| | ||||||||| ||||||||||||    
13246801 tccgatcctatttataagagaaatttggatcaacaaaaatgaatgtatttg 13246851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 33289261 - 33289307
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
33289261 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 33289307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 328 - 377
Target Start/End: Complemental strand, 7012304 - 7012255
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||| |||||||||||||||||||||||| ||| | |||||||||||    
7012304 aaatacttcctccggtcctatttataagagaattttggatcaacaaaagt 7012255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 328 - 377
Target Start/End: Original strand, 12763651 - 12763700
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||| ||||||||||||||||||||| || ||| |||||||||||||    
12763651 aaatactccctccggtcctatttataagataattttgggtcaacaaaagt 12763700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 377
Target Start/End: Original strand, 7805697 - 7805745
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| ||||| |||||||    
7805697 aatactccctccggtcctatttataagagaattttgggtcagcaaaagt 7805745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 337 - 377
Target Start/End: Original strand, 12343146 - 12343186
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||||||||||||||||||| ||| |||||||||||||    
12343146 ctccggtcctatttataagagaatttttggtcaacaaaagt 12343186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 377
Target Start/End: Original strand, 44498185 - 44498233
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| |||||| ||||||    
44498185 aatactccctccggtcctatttataagagaattttgggtcaataaaagt 44498233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 328 - 375
Target Start/End: Original strand, 32114472 - 32114519
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaa 375  Q
    ||||||| ||||||||||||||||||||| || ||| |||||||||||    
32114472 aaatactccctccggtcctatttataagaaaattttgggtcaacaaaa 32114519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 3304278 - 3304324
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| ||||||||||||||||||||| || ||| |||||||||||||    
3304278 tactccctccggtcctatttataagaaaattttgggtcaacaaaagt 3304324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 343 - 424
Target Start/End: Complemental strand, 24203091 - 24203009
Alignment:
343 tcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattga 424  Q
    |||||||||||||||||||||| ||||| ||||||| || ||||||   | |||||| ||| ||||||||||||  |||||||    
24203091 tcctatttataagagaaatttatgtcaataaaagtggatatatttgatttaaattttgaaccaaatacatcaaccattattga 24203009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 31654743 - 31654697
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| ||||||||||||||||||| |||| ||| |||||||||||||    
31654743 tacttcctccggtcctatttataaaagaattttgggtcaacaaaagt 31654697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 328 - 377
Target Start/End: Original strand, 15888349 - 15888398
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||| ||||| || ||||||||||||||| ||| |||||||||||||    
15888349 aaatactccctccagttctatttataagagaattttgggtcaacaaaagt 15888398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 346 - 445
Target Start/End: Complemental strand, 28999163 - 28999063
Alignment:
346 tatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattctcttataaat 444  Q
    ||||||||| ||||| || ||||||||||| |  |||||| | ||||||| ||||||||| |||| | |||||||||||| | ||| || || |||||||    
28999163 tatttataaaagaaagtttggtcaacaaaaattgatgtatctagactgaatttttaactacatacgtaaacttttattgacttaaatttttcatataaat 28999064  T
445 a 445  Q
    |    
28999063 a 28999063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 97; Significance: 2e-47; HSPs: 42)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 331 - 450
Target Start/End: Complemental strand, 26350480 - 26350360
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||    
26350480 tactccctccgatcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttattgattcaa 26350381  T
430 aattctcttataaataggacc 450  Q
    |||||| ||||||||||||||    
26350380 aattcttttataaataggacc 26350360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 9395350 - 9395470
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
9395350 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 9395449  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
9395450 aattctcttataaataggacc 9395470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 328 - 450
Target Start/End: Complemental strand, 36563671 - 36563548
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgatt 426  Q
    ||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||      
36563671 aaatactacctccgatcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacc 36563572  T
427 caaaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||||    
36563571 caaaattctcttataaataggacc 36563548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 37149087 - 37148965
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
37149087 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 37148988  T
428 aaaattctcttataaataggacc 450  Q
    |||||||| ||||||||||||||    
37148987 aaaattctattataaataggacc 37148965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 330 - 450
Target Start/End: Original strand, 13103023 - 13103144
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||| ||||  ||    
13103023 atacttcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaaatagatacatcaacttttgttgaccca 13103122  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
13103123 aaattctcttataaataggacc 13103144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 330 - 450
Target Start/End: Original strand, 23359941 - 23360062
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  ||    
23359941 atactacctctggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccca 23360040  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
23360041 aaattctcttataaataggacc 23360062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 41989538 - 41989417
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  ||    
41989538 atactacctccggtcctatttgtaagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccca 41989439  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
41989438 aaattctcttataaataggacc 41989417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 331 - 449
Target Start/End: Original strand, 11795168 - 11795287
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
11795168 tactacctccgatcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 11795267  T
430 aattctcttataaataggac 449  Q
    ||||||||||||||||||||    
11795268 aattctcttataaataggac 11795287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 330 - 448
Target Start/End: Original strand, 13033050 - 13033169
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||| ||||  ||    
13033050 atacttcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaaatagatacatcaacttttgttgaccca 13033149  T
429 aaattctcttataaatagga 448  Q
    ||||||||||||||||||||    
13033150 aaattctcttataaatagga 13033169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 328 - 450
Target Start/End: Original strand, 17025621 - 17025744
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgatt 426  Q
    ||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||  |||||| ||||||||| |||||||||||||| ||||      
17025621 aaatactacctccggtcctatttataagagaaatttaggtccacaaaagtgaatgtatttaaactgaatttttaactagatacatcaacttttgttgacc 17025720  T
427 caaaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||||    
17025721 caaaattctcttataaataggacc 17025744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 37641951 - 37642074
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaa-gtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgatt 426  Q
    |||||| ||||||||||||||||||||||||||||||||||| |||| |||||||||| ||||||||||||| ||||| |||||||||||||||||||      
37641951 aatactacctccggtcctatttataagagaaatttaggtcaataaaaagtgaatgtatgtggactgaatttttaactagatacatcaacttttattgacc 37642050  T
427 caaaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||||    
37642051 caaaattctcttataaataggacc 37642074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 328 - 450
Target Start/End: Original strand, 4443957 - 4444080
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgatt 426  Q
    ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| || |||||||||||||| |||||     
4443957 aaatacttccttcggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttagactgaatttttaaatagatacatcaacttttgttgatc 4444056  T
427 caaaattctcttataaataggacc 450  Q
     |||||||||||||||||| ||||    
4444057 taaaattctcttataaataagacc 4444080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 20848072 - 20848193
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| ||||||||| |||| |||   |    
20848072 aatactacctccggtcctatttataagagaaatttaggtcaataaaagtgaatgtatttggactgaatttttaactagatacatcaatttttgttg-ccc 20848170  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
20848171 aaaattctcttataaataggacc 20848193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 329 - 440
Target Start/End: Original strand, 582987 - 583099
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
582987 aatactacctccggtcctatttataagagaaatttaggtcaacataagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 583086  T
428 aaaattctcttat 440  Q
    |||||||| ||||    
583087 aaaattcttttat 583099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 355 - 450
Target Start/End: Original strand, 21575970 - 21576066
Alignment:
355 gagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||| ||||| ||||||||||||||||||||||||    
21575970 gagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaattagatacatcaacttttgttgatccaaaattctcttataaataggacc 21576066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 352 - 450
Target Start/End: Original strand, 6126845 - 6126944
Alignment:
352 taagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgattcaaaattctcttataaataggacc 450  Q
    |||||||||||||| ||||||||| |||||||||||||||| |||||| ||||| |||||||||||||| ||||  ||||||||||||||||||||||||    
6126845 taagagaaatttagatcaacaaaaatgaatgtatttggactaaatttttaactagatacatcaacttttgttgacccaaaattctcttataaataggacc 6126944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 330 - 399
Target Start/End: Complemental strand, 38361822 - 38361753
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt 399  Q
    ||||| |||||| |||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||    
38361822 atacttcctccgatcctatttataagataaatttaggtcaataaaagtgaatgtatttggactgaatttt 38361753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 338 - 418
Target Start/End: Complemental strand, 13539986 - 13539909
Alignment:
338 tccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttt 418  Q
    |||||||||||||||||||||||||||||||||||||    |||  |||| ||||||| ||||||||| |||||||||||||    
13539986 tccggtcctatttataagagaaatttaggtcaacaaa----aataaatttagactgaatttttaactagatacatcaacttt 13539909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 460
Target Start/End: Complemental strand, 2629675 - 2629544
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactga-attttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||||||| | ||||||||| | |||||||||||||||||| ||||||| ||  || |  ||||||||| ||||||||| ||||||||| |||    
2629675 atacttcctccggtcttgtttataagaaatatttaggtcaacaaaagttaatgtatctgatctaattttttaactatatacatcaaattttattgactca 2629576  T
429 aaattctcttataaataggaccagatgaaata 460  Q
    ||  | ||||||||| |  | |||||||||||    
2629575 aatgtttcttataaaaaatatcagatgaaata 2629544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 345 - 450
Target Start/End: Complemental strand, 3549663 - 3549557
Alignment:
345 ctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgattcaaaattctcttataaa 443  Q
    |||||||||||||| ||||  |||||||||| | ||||||| ||| || |||||| |||  ||||||||||||||| || ||  ||| ||||||||||||    
3549663 ctatttataagagatattttagtcaacaaaaattaatgtatctggtctaaatttttaaccgaatacatcaacttttgttaatataaatttctcttataaa 3549564  T
444 taggacc 450  Q
    |||||||    
3549563 taggacc 3549557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 331 - 447
Target Start/End: Original strand, 39290775 - 39290891
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||| |||||||||  | |||||||||||| |  ||||||||||| | |||||| || || |||||| ||||||| ||||||| |    
39290775 tactccctccggtcctatt-ataagagaatatcaggtcaacaaaaattgatgtatttggattaaatttttaattagatacattaacttttgttgattcga 39290873  T
430 aattctcttataaatagg 447  Q
      ||||||||||||||||    
39290874 ctttctcttataaatagg 39290891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 328 - 377
Target Start/End: Original strand, 41989404 - 41989453
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||| |||||||||||||||||||||||| ||| |||||||||||||    
41989404 aaatactccctccggtcctatttataagagaattttgggtcaacaaaagt 41989453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 9395482 - 9395434
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| |||||||||||||    
9395482 aatactccctccggtcctatttataagagaattttgggtcaacaaaagt 9395434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 13103156 - 13103108
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||||||||||||||||||||| ||| |||||||||||||    
13103156 aatactccctccggtcctatttataagagaattttgggtcaacaaaagt 13103108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 17025755 - 17025708
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||    
17025755 atactccctccggtcctatttataagagaattttgggtcaacaaaagt 17025708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 36563537 - 36563584
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||    
36563537 atactccctccggtcctatttataagagaattttgggtcaacaaaagt 36563584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 6126954 - 6126908
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
6126954 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 6126908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 337 - 375
Target Start/End: Complemental strand, 11574204 - 11574166
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaa 375  Q
    |||||||||||||||||||||| ||||||||||||||||    
11574204 ctccggtcctatttataagagacatttaggtcaacaaaa 11574166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 23360072 - 23360026
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
23360072 tactacctccggtcctatttataagagaattttgggtcaacaaaagt 23360026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 336 - 385
Target Start/End: Complemental strand, 966273 - 966224
Alignment:
336 cctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtat 385  Q
    ||||| |||||||||||||||||||||| | ||||||||| |||||||||    
966273 cctccagtcctatttataagagaaatttggatcaacaaaaatgaatgtat 966224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 355 - 446
Target Start/End: Complemental strand, 2366444 - 2366352
Alignment:
355 gagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattctcttataaatag 446  Q
    |||||| || ||| || ||||||  |||||||||||||||| ||||||| |||||||| |||| || ||||  |||| |||||||||||||||    
2366444 gagaaagtttggttaataaaagttgatgtatttggactgaaattttaaccaaatacatgaactcttgttgacccaaatttctcttataaatag 2366352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 329 - 377
Target Start/End: Complemental strand, 13033183 - 13033135
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||| |||||| ||||||||||||||||| ||| |||||||||||||    
13033183 aatactccctccgatcctatttataagagaattttgggtcaacaaaagt 13033135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 11795299 - 11795252
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| ||||| |||||||||||||||||| ||| |||||||||||||    
11795299 atactccctccagtcctatttataagagaattttgggtcaacaaaagt 11795252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 21576077 - 21576030
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| | |||||||||||    
21576077 atactccctccggtcctatttataagagaattttggatcaacaaaagt 21576030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 37642085 - 37642038
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||| ||||||    
37642085 atactccctccggtcctatttataagagaattttgggtcaataaaagt 37642038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 340 - 449
Target Start/End: Original strand, 966157 - 966267
Alignment:
340 cggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgattcaaaattctctt 438  Q
    |||||||||||| |||||||| ||   ||||||| |||  |||||| | ||||||||||| ||| | ||||||  | |||| ||||| |||| |||||||    
966157 cggtcctatttacaagagaaagttgaatcaacaacagttcatgtatcttgactgaatttttaaccagatacattcatttttgttgatccaaatttctctt 966256  T
439 ataaataggac 449  Q
    |||||||||||    
966257 ataaataggac 966267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 37148955 - 37149001
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| ||||||||||||||||||| |||| ||| |||||||||||||    
37148955 tactccctccggtcctatttataatagaattttgggtcaacaaaagt 37149001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 337 - 386
Target Start/End: Original strand, 3549553 - 3549602
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatt 386  Q
    ||||||||||||||||||||||||||||  | |||||||||  |||||||    
3549553 ctccggtcctatttataagagaaatttatattaacaaaagttgatgtatt 3549602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 336 - 377
Target Start/End: Complemental strand, 4444085 - 4444044
Alignment:
336 cctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||||| |||||||||||||| ||||| |||||||||||    
4444085 cctccggtcttatttataagagaattttagatcaacaaaagt 4444044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 338 - 387
Target Start/End: Complemental strand, 27081063 - 27081014
Alignment:
338 tccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtattt 387  Q
    |||| ||||||||| |||||| ||||||||||||||||||  ||||||||    
27081063 tccgatcctatttacaagagacatttaggtcaacaaaagttgatgtattt 27081014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 345 - 389
Target Start/End: Original strand, 2366352 - 2366396
Alignment:
345 ctatttataagagaaatttaggtcaacaaaagtgaatgtatttgg 389  Q
    ||||||||||||||||||| ||||||||| |||  ||||||||||    
2366352 ctatttataagagaaatttgggtcaacaagagttcatgtatttgg 2366396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 339 - 375
Target Start/End: Original strand, 36595782 - 36595818
Alignment:
339 ccggtcctatttataagagaaatttaggtcaacaaaa 375  Q
    |||||| ||||||||||||||| ||||||||||||||    
36595782 ccggtcttatttataagagaaagttaggtcaacaaaa 36595818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 96; Significance: 9e-47; HSPs: 59)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 329 - 455
Target Start/End: Original strand, 22721929 - 22722056
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |    
22721929 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccc 22722028  T
428 aaaattctcttataaataggaccagatg 455  Q
    ||||||||||||||||||||||| ||||    
22722029 aaaattctcttataaataggaccggatg 22722056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 8437423 - 8437545
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||| |||||||||||||| |||| ||    
8437423 aatactacctccggtcctatttataagagaaatttaggtcaataaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgactc 8437522  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
8437523 aaaattctcttataaataggacc 8437545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 19557183 - 19557062
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  ||    
19557183 atactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccca 19557084  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
19557083 aaattctcttataaataggacc 19557062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 327 - 463
Target Start/End: Complemental strand, 44785530 - 44785393
Alignment:
327 taaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgat 425  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||     
44785530 taaatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgac 44785431  T
426 tcaaaattctcttataaataggaccagatgaaatagtt 463  Q
     |||||||||||||||||||| ||| || ||| |||||    
44785430 ccaaaattctcttataaatagaaccggaggaagtagtt 44785393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 49823512 - 49823391
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  ||    
49823512 atactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgaccca 49823413  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
49823412 aaattctcttataaataggacc 49823391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 10297979 - 10298099
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
10297979 tactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 10298078  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
10298079 aattctcttataaataggacc 10298099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 17653712 - 17653832
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
17653712 tactccctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 17653811  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
17653812 aattctcttataaataggacc 17653832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 93; E-Value: 5e-45
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 37508921 - 37509041
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
37508921 tactccctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 37509020  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
37509021 aattctcttataaataggacc 37509041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 328 - 450
Target Start/End: Complemental strand, 8817519 - 8817396
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgatt 426  Q
    ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||      
8817519 aaatactaccttcggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacc 8817420  T
427 caaaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||||    
8817419 caaaattctcttataaataggacc 8817396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 4238592 - 4238714
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||       
4238592 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacca 4238691  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
4238692 aaaattctcttataaataggacc 4238714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 34080162 - 34080040
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||||| ||||  |    
34080162 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaacaagatacatcaacttttgttgaccc 34080063  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
34080062 aaaattctcttataaataggacc 34080040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 42507487 - 42507365
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttt-aactaaatacatcaacttttattgattc 427  Q
    |||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||| ||||  |    
42507487 aatactacctccggtcctatttataatagaaatttaggtcaacaaaagtgaatgtatttggactgaattttgaactagatacatcaacttttgttgaccc 42507388  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
42507387 aaaattctcttataaataggacc 42507365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 48340397 - 48340517
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||    
48340397 tactacctccggtcctatttacaagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaa 48340496  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
48340497 aattctcttataaataggacc 48340517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 328 - 450
Target Start/End: Complemental strand, 9111627 - 9111504
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgatt 426  Q
    ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |||||||||||||| ||||      
9111627 aaatactaccttcggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttgaactgaatttttaactagatacatcaacttttgttgacc 9111528  T
427 caaaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||||    
9111527 caaaattctcttataaataggacc 9111504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 329 - 455
Target Start/End: Complemental strand, 42170478 - 42170351
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| | |||||||||||||| ||||  |    
42170478 aatactacctccggtcttatttataagagaaatttaggtcaacaaaagtgaatgtatttggagtgaatttttaaccagatacatcaacttttgttgaccc 42170379  T
428 aaaattctcttataaataggaccagatg 455  Q
    ||||||||||||||||||||||||||||    
42170378 aaaattctcttataaataggaccagatg 42170351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 337 - 450
Target Start/End: Complemental strand, 2787956 - 2787842
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattct 435  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||  |||  |||||||||    
2787956 ctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgctgacccaaaattct 2787857  T
436 cttataaataggacc 450  Q
    |||||||||||||||    
2787856 cttataaataggacc 2787842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 329 - 450
Target Start/End: Complemental strand, 21295458 - 21295336
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||| ||||       
21295458 aatactacctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaattagatacatcaacttttgttgacct 21295359  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
21295358 aaaattctcttataaataggacc 21295336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 329 - 450
Target Start/End: Original strand, 38964390 - 38964512
Alignment:
329 aatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattc 427  Q
    |||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||       
38964390 aatactacctccggtcctatttataagagaaatttagatcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacca 38964489  T
428 aaaattctcttataaataggacc 450  Q
    |||||||||||||||||||||||    
38964490 aaaattctcttataaataggacc 38964512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 337 - 450
Target Start/End: Complemental strand, 40691120 - 40691006
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattct 435  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||  |||||||||    
40691120 ctccggtcctatttataagagaaatttaggttaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaaaattct 40691021  T
436 cttataaataggacc 450  Q
    |||||||||||||||    
40691020 cttataaataggacc 40691006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 330 - 450
Target Start/End: Complemental strand, 36095811 - 36095690
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||| ||    
36095811 atactccctccggtcctatttataagataaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaacttttgttgatcca 36095712  T
429 aaattctcttataaataggacc 450  Q
    |||||||||| |||||| ||||    
36095711 aaattctcttgtaaataagacc 36095690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 330 - 450
Target Start/End: Original strand, 46208029 - 46208150
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattca 428  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||| ||||   |    
46208029 atactccctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaaatagatacatcaacttttgttgaccta 46208128  T
429 aaattctcttataaataggacc 450  Q
    ||||||||||||||||||||||    
46208129 aaattctcttataaataggacc 46208150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 331 - 450
Target Start/End: Original strand, 51406673 - 51406793
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaa 429  Q
    |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| |||| ||||  |||    
51406673 tactacctccggtcttatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaatttttgttgacccaa 51406772  T
430 aattctcttataaataggacc 450  Q
    |||||||||||||||||||||    
51406773 aattctcttataaataggacc 51406793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 326 - 448
Target Start/End: Original strand, 35513468 - 35513591
Alignment:
326 ataaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattga 424  Q
    |||| |||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||    
35513468 ataattactcccttcggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagatacatcaccttttattga 35513567  T
425 ttcaaaattctcttataaatagga 448  Q
    | || |||||| ||||||||||||    
35513568 tccagaattcttttataaatagga 35513591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 336 - 450
Target Start/End: Complemental strand, 6013461 - 6013346
Alignment:
336 cctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattc 434  Q
    ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||  |||||| ||||  ||||||||    
6013461 cctccagtccaatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaatttttaactagataaatttacttttgttgacccaaaattc 6013362  T
435 tcttataaataggacc 450  Q
    ||||||||||||||||    
6013361 tcttataaataggacc 6013346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 338 - 448
Target Start/End: Complemental strand, 33943055 - 33942944
Alignment:
338 tccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaa-ttttaactaaatacatcaacttttattgattcaaaattctc 436  Q
    |||| |||||||||||| ||||| |||||||||||||||| ||||||||||||||||| ||||||||| |||||||||||||| ||||  |||  |||||    
33943055 tccgatcctatttataaaagaaagttaggtcaacaaaagttaatgtatttggactgaatttttaactagatacatcaacttttgttgacccaagtttctc 33942956  T
437 ttataaatagga 448  Q
    ||||||||||||    
33942955 ttataaatagga 33942944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 328 - 449
Target Start/End: Original strand, 9213513 - 9213635
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttggactgaattt-taactaaatacatcaacttttattgatt 426  Q
    ||||||| ||||||||||||||||||| ||| ||||  ||||||||||||  |||||| |||||| | ||| |||| ||||||||||| |||| ||||      
9213513 aaatactccctccggtcctatttataaaagacattttagtcaacaaaagttgatgtatctggactaattttataaccaaatacatcaatttttgttgacc 9213612  T
427 caaaattctcttataaataggac 449  Q
     ||| |||||| |||||||||||    
9213613 taaatttctctaataaataggac 9213635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 46208161 - 46208114
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| |||||||||||||||||    
46208161 atactccctccggtcctatttataagagaattttaggtcaacaaaagt 46208114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 327 - 377
Target Start/End: Complemental strand, 10298113 - 10298063
Alignment:
327 taaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||||||| |||||||||||||||||||||||| ||| |||||||||||||    
10298113 taaatactccctccggtcctatttataagagaattttgggtcaacaaaagt 10298063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 21295326 - 21295372
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| |||||||||||||||||    
21295326 tactccctccggtcctatttataagagaattttaggtcaacaaaagt 21295372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 328 - 377
Target Start/End: Complemental strand, 17653845 - 17653796
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||| |||||||||||||||||||||||| ||| |||||||||||||    
17653845 aaatactacctccggtcctatttataagagaattttgggtcaacaaaagt 17653796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 337 - 386
Target Start/End: Original strand, 33128212 - 33128261
Alignment:
337 ctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatt 386  Q
    |||| |||||| ||||||||||||||||||||||||||||| ||||||||    
33128212 ctccagtcctaattataagagaaatttaggtcaacaaaagttaatgtatt 33128261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 328 - 377
Target Start/End: Original strand, 40690993 - 40691042
Alignment:
328 aaatactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||||| |||||||||||||||||||||||| ||| |||||||||||||    
40690993 aaatactccctccggtcctatttataagagaattttgggtcaacaaaagt 40691042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 4238725 - 4238678
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||    
4238725 atactacctccggtcctatttataagagaatttttggtcaacaaaagt 4238678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Complemental strand, 37509052 - 37509005
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||    
37509052 atactacctccggtcctatttataagagaattttgggtcaacaaaagt 37509005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 330 - 377
Target Start/End: Original strand, 49823380 - 49823427
Alignment:
330 atactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    ||||| |||||||||||||||||||||||| ||| |||||||||||||    
49823380 atactccctccggtcctatttataagagaattttgggtcaacaaaagt 49823427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 6013336 - 6013382
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
6013336 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 6013382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 389
Target Start/End: Complemental strand, 9213646 - 9213588
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagtgaatgtatttgg 389  Q
    |||| ||||| ||||||||||| |||||||||||||||||||||| |  ||||||||||    
9213646 tactccctcccgtcctatttattagagaaatttaggtcaacaaaaattgatgtatttgg 9213588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 19557052 - 19557098
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
19557052 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 19557098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Original strand, 34080030 - 34080076
Alignment:
331 tactgcctccggtcctatttataagagaaatttaggtcaacaaaagt 377  Q
    |||| |||||||||||||||||||||||| ||| |||||||||||||    
34080030 tactccctccggtcctatttataagagaattttgggtcaacaaaagt 34080076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 331 - 377
Target Start/End: Complemental strand, 38964522 - 38964476
Alignment: