View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A38 (Length: 257)

Name: R108-tnk507-A38
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A38
R108-tnk507-A38
[»] chr4 (1 HSPs)
chr4 (1-255)||(52899010-52899267)


Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 52899010 - 52899267
Alignment:
1 gttttgtgcctgtgtca-aaaagtgtaggtaaggttttttgttatgcctgcattcttcgtgtaatatatttttgctctaaggcatttatttgtatga-aa 98  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
52899010 gttttgtgcctgtgtcagaaaagtgtaggtaaggttttttgttatgcctgcattcttcgtgtaatatatttttgctctaaggcatttatttgtatgataa 52899109  T
99 ctgaataatgaaattacaggttgccataaagacattgattgtggtccataggatattgagagagggtgatcttagct-caaagaagatcttgtaaactac 197  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
52899110 ctgaataatgaaattacaggttgccataaagacattgattgtggtccataggatattgagagagggtgatcttagcttcaaagaagatcttgtaaactac 52899209  T
198 tcacacagagtacggtttctccgaatttccaacttcaaagatgactcaagccctctag 255  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52899210 tcacacagagtacggtttctccgaatttccaacttcaaagatgactcaagccctctag 52899267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108020 times since January 2019
Visitors: 1329