View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk507-A38 (Length: 257)
Name: R108-tnk507-A38
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] R108-tnk507-A38 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 52899010 - 52899267
Alignment:
Q |
1 |
gttttgtgcctgtgtca-aaaagtgtaggtaaggttttttgttatgcctgcattcttcgtgtaatatatttttgctctaaggcatttatttgtatga-aa |
98 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
T |
52899010 |
gttttgtgcctgtgtcagaaaagtgtaggtaaggttttttgttatgcctgcattcttcgtgtaatatatttttgctctaaggcatttatttgtatgataa |
52899109 |
T |
 |
Q |
99 |
ctgaataatgaaattacaggttgccataaagacattgattgtggtccataggatattgagagagggtgatcttagct-caaagaagatcttgtaaactac |
197 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
52899110 |
ctgaataatgaaattacaggttgccataaagacattgattgtggtccataggatattgagagagggtgatcttagcttcaaagaagatcttgtaaactac |
52899209 |
T |
 |
Q |
198 |
tcacacagagtacggtttctccgaatttccaacttcaaagatgactcaagccctctag |
255 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
52899210 |
tcacacagagtacggtttctccgaatttccaacttcaaagatgactcaagccctctag |
52899267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 108020 times since January 2019
Visitors: 1329