View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A45 (Length: 574)

Name: R108-tnk507-A45
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A45
R108-tnk507-A45
[»] chr3 (3 HSPs)
chr3 (156-536)||(35773088-35773471)
chr3 (1-159)||(35773775-35773933)
chr3 (1-51)||(35777097-35777148)
[»] chr5 (1 HSPs)
chr5 (251-300)||(2634981-2635030)


Alignment Details
Target: chr3 (Bit Score: 341; Significance: 0; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 341; E-Value: 0
Query Start/End: Original strand, 156 - 536
Target Start/End: Complemental strand, 35773471 - 35773088
Alignment:
156 ctttccaatttctttgatataagtgaccttgattgaagcagttgatcataatcttgaatagtattttgagcactcgcaaatttgacatcaaccccttcaa 255  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35773471 ctttccaatttctttgatataagtgaccttgattgaagcagttgatcataatcttgaatagtattttgagcactcgcaaatttgacatcaaccccttcaa 35773372  T
256 tgaaagttcttaacttgcaaataacatgatgaagcctaatagggatttgattttcaaattggccaagttgttccaaaatttgatggaacttttgcttcac 355  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
35773371 tgaaagttcttaacttgcaaatgacatgatgaagcctaatagggatttgatttgcaaattggccaagttgttccaaaatttgatggaacttttgcttcac 35773272  T
356 ttcatcgtctgaagagagcatttcaagtggtgtctccaaaagggtttctaaattttcaaaaatagctgcaacatttgaagctgggagcactgaaacagtt 455  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
35773271 ttcatcgtctgaagagagaatttcaagtggtgtctccaaaagggtttctaaattttcaaaaatagctgcaacatttgaagcttggagcactgaaacagtt 35773172  T
456 gttgagtcagtgcacataggagacaacttatanctatcatgt-acaaactttctagttcgg-aatcggatccc-agagtctgat 536  Q
    |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| ||||||||||| ||||||||||    
35773171 gttgagtcagtgcacataggagacaacttataactatcatgtaacaaactttctagttcggaaatcggatcccaagagtctgat 35773088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 151; E-Value: 1e-79
Query Start/End: Original strand, 1 - 159
Target Start/End: Complemental strand, 35773933 - 35773775
Alignment:
1 tctttctccttttgcatcgatggaatcgacaattacaatctaatatcaaaaataatcagatgttcattgtgaatttgaatccacagaggtgacaaaatta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||    
35773933 tctttctccttttgcatcgatggaatcgacaattacaatctaatataaaaaataaccagatgttcattgtgaatttgaatccacagaggtgacaaaatta 35773834  T
101 ctaaatgttaatatatgcatgaattgatatatcaaattttattggcggaaaatgccttt 159  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35773833 ctaaatgttaatatatgcatgaattgatatatcaaattttattggcggaaaatgccttt 35773775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 51
Target Start/End: Complemental strand, 35777148 - 35777097
Alignment:
1 tctttctccttttgcatcgatggaatcgacaa-ttacaatctaatatcaaaa 51  Q
    ||||||||||||| ||| |||||||||||||| ||||| |||||||||||||    
35777148 tctttctccttttccattgatggaatcgacaatttacattctaatatcaaaa 35777097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 251 - 300
Target Start/End: Original strand, 2634981 - 2635030
Alignment:
251 ttcaatgaaagttcttaacttgcaaataacatgatgaagcctaataggga 300  Q
    |||||||||||||||||| ||||||| ||||||||| |||||||||||||    
2634981 ttcaatgaaagttcttaagttgcaaacaacatgatgtagcctaataggga 2635030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111159 times since January 2019
Visitors: 1335