View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A55 (Length: 342)

Name: R108-tnk507-A55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A55
R108-tnk507-A55
[»] chr5 (2 HSPs)
chr5 (129-318)||(2561825-2562018)
chr5 (1-134)||(2561686-2561819)


Alignment Details
Target: chr5 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 129 - 318
Target Start/End: Complemental strand, 2562018 - 2561825
Alignment:
129 attaattcctcatccattatggctaatataccattattcttactactcatggcaaaccacaagattaaaccacttatcaacaaactgcaccccatgatgg 228  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2562018 attaattcctcatccattattgctaatataccattattcttactactcatggcaaaccacaagattaaaccacttatcaacaaactgcaccccatgatgg 2561919  T
229 ccctcttaagtcc----taagtactctacttgatatatattagctaaacatgcttgtatttataatcaattccaatatgataggaatttacaaa 318  Q
    |||||||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2561918 ccctcttaagtcctaattaagtactctacttgatatatattagctaaacatgcttgtatttataatcaattccaatatgataggaatttacaaa 2561825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 2561819 - 2561686
Alignment:
1 atgtgtataagaaagatctatgaagtgtgtggaatgggagagtagtttacgtgtaccagtcattatggcactatatgcatatataacaattaaagtcaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2561819 atgtgtataagaaagatctatgaagtgtgtggaatgggagagtagtttacgtgtaccagtcattatggcactatatgcatatataacaattaaagtcaga 2561720  T
101 ataaacgagtcatgaagatgacatatccattaat 134  Q
    ||||||||||||||||||||||||||||||||||    
2561719 ataaacgagtcatgaagatgacatatccattaat 2561686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110484 times since January 2019
Visitors: 1335