View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A56 (Length: 643)

Name: R108-tnk507-A56
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A56
R108-tnk507-A56
[»] chr7 (1 HSPs)
chr7 (1-291)||(38052621-38052912)
[»] chr6 (1 HSPs)
chr6 (285-567)||(21523233-21523517)


Alignment Details
Target: chr7 (Bit Score: 245; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 245; E-Value: 1e-135
Query Start/End: Original strand, 1 - 291
Target Start/End: Original strand, 38052621 - 38052912
Alignment:
1 catagaacacttaaaactattaaaacaaccttacaaatgaaattctaatgaagtaaacatcaatattgaatgaaatttcacatcgatagtttcgaagatg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38052621 catagaacacttaaaactattaaaacaaccttacaaatgaaattctaatgaagtaaacatcaatattgaatgaaatttcacatcgatagtttcgaagatg 38052720  T
101 tgcaaatacgaatagagaaccacgaattagaaaaatgaatgaaaactacaaactagg-aaccaaggataattgcgaagagaaccg-aaaccaattaagat 198  Q
    ||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||| ||||||||| |||| |||||||||| | ||||||||||||||    
38052721 tgcaaatacgaatagagaaccacgaattagaaaaacgaatgagaactgcaaactaggaaaccaaggagaattacgaagagaactgcaaaccaattaagat 38052820  T
199 ttgcaaactatacaactatgtagatgaaatgaatcgaagacgaactcaaaacgatcgaagacggagaaggaaggaaaaacataacgattaata 291  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
38052821 ttgcaaactatacaactatgtagatgaaatgaatcgaagacgaactc-aaacgatcgaagacggagaaggaaggaaaaacataacgattaata 38052912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 285 - 567
Target Start/End: Original strand, 21523233 - 21523517
Alignment:
285 attaatacttatcgtgtgcaatgttccacaagttagctagcctgtgatctttaaaatataaataaatgttccttagtagctaataacataaacgtttgaa 384  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21523233 attaatacttatcgtgtgcaatgttccacaagttagctagcctgtgatctttaaaatataaataaatgttccttagtagctaataacataaacgtttgaa 21523332  T
385 actacataatatcacataactcatggttgaatttaaaaacttcatttcttacaggaagttacaattggcgtcattttctangtttgacattttatgtcat 484  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
21523333 actacataatatcacataactcatggttgaatttaaaaacttcatttcttacaggaagttacaattggcgtcattttctaagtttgacattttatgtcat 21523432  T
485 tagatcgtggccacacacncgtgcgtgcac-agagcaacatatatatgcaatgtgtgaagagcatggac-ttacttgcganggtt 567  Q
    ||||||||| | |||||| |||||| |||| |||||||||||||||||||||||||||||||||| ||| |||||||||| ||||    
21523433 tagatcgtgtcaacacacacgtgcgcgcacaagagcaacatatatatgcaatgtgtgaagagcattgacattacttgcgatggtt 21523517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 362067 times since January 2019
Visitors: 488