View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A61 (Length: 242)

Name: R108-tnk507-A61
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A61
R108-tnk507-A61
[»] chr3 (2 HSPs)
chr3 (56-242)||(5808886-5809074)
chr3 (1-54)||(5809007-5809060)


Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 56 - 242
Target Start/End: Complemental strand, 5809074 - 5808886
Alignment:
56 tgctaaggatgtgcttatagtagaggcatctctaaactagtgaaagatgggatgtttgatatgatgaatgacacaagacaactgaaaataccatgtcgta 155  Q
    |||||||||||||||||  ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
5809074 tgctaaggatgtgctta--gtagaggcatctctaaactagagaaagatgggatgtttgatatgatgaatgacacaagacaactgaaaataccatgtcata 5808977  T
156 ctttata----tatagatgatataataaatcacaaacatgtttggaatttatagtgtgttttaggaaggatatgttttgaggtaatgttat 242  Q
    |||||||    |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||    
5808976 ctttatatatatatagatgatataataaatcacaaacatatttggaatttagagtgtgttttaggaaggatatgttttgaggtaatgttat 5808886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 5809060 - 5809007
Alignment:
1 ttagtagaggcttctctaaactagtgtaagatgggatgtttgatacgatgaatg 54  Q
    ||||||||||| |||||||||||| | |||||||||||||||||| ||||||||    
5809060 ttagtagaggcatctctaaactagagaaagatgggatgtttgatatgatgaatg 5809007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110545 times since January 2019
Visitors: 1335