View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A67 (Length: 553)

Name: R108-tnk507-A67
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A67
R108-tnk507-A67
[»] chr2 (2 HSPs)
chr2 (1-306)||(6284287-6284591)
chr2 (371-534)||(6284063-6284221)


Alignment Details
Target: chr2 (Bit Score: 266; Significance: 1e-148; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 306
Target Start/End: Complemental strand, 6284591 - 6284287
Alignment:
1 gtctgttcattatttagtttaagaaacaaaaagtgtaacaaggaagtgagggaggtaagttcttattaaatgggttgtgcgattgtgtattttgagaaat 100  Q
    |||||||||||| |||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||    
6284591 gtctgttcattaattagtttaagaaacaaaaagtgtaacaagggagggagggaggtaagttcttattaaatgggttgtgcgattgtgtattttgagaaat 6284492  T
101 gcttaactaagaagaaaaacataagataatatataaagaaattctacacaatcaattaacataatgtaccgacaaaacgggctctacccgacccgcttcg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6284491 gcttaactaagaagaaaaacataagataatatataaagaaattttacacaatcaattaacataatgtaccgacaaaacgggctctacccgacccgcttcg 6284392  T
201 ggttgatattaggtttaaattaaagttttatcaaaacaaactaaaaattctatttttctcaagaaaggtttttgtacttgtacgttgtaagtttggtgga 300  Q
    ||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||  |||||||| ||||||||||||    
6284391 ggttgatattagg-ttaaattaaagttttatcaaaacaaactaaaaatcctatttttctcaagaaaggtttttgtacacgtacgttgaaagtttggtgga 6284293  T
301 ccagcc 306  Q
    ||||||    
6284292 ccagcc 6284287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 371 - 534
Target Start/End: Complemental strand, 6284221 - 6284063
Alignment:
371 cttgcaaatattatccacatcaattctccaacaagtttcttacaa-tgtggnctggcatattatactattatataaaattttaaacaattatagatttcc 469  Q
    |||||||||||||||||||||     ||||||||||||| ||||| ||||  |||||| |||||||||||||||||||||||||||||||||||||||      
6284221 cttgcaaatattatccacatc-----tccaacaagtttcctacaaatgtgatctggcacattatactattatataaaattttaaacaattatagatttta 6284127  T
470 aattngtncaaaacaacttctaaattct-cnacatctcaaacctcgaatattttangggttttatt 534  Q
    |||| || ||||||||||| |||||||| | |||||||||||||||||||||||| ||||||||||    
6284126 aatt-gttcaaaacaacttttaaattctccaacatctcaaacctcgaatatttta-gggttttatt 6284063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111118 times since January 2019
Visitors: 1335