View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A68 (Length: 370)

Name: R108-tnk507-A68
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A68
R108-tnk507-A68
[»] scaffold0062 (7 HSPs)
scaffold0062 (1-129)||(15093-15221)
scaffold0062 (3-129)||(25261-25387)
scaffold0062 (3-129)||(35427-35553)
scaffold0062 (221-360)||(15310-15449)
scaffold0062 (221-360)||(25478-25617)
scaffold0062 (221-360)||(35644-35783)
scaffold0062 (221-274)||(8869-8922)


Alignment Details
Target: scaffold0062 (Bit Score: 121; Significance: 6e-62; HSPs: 7)
Name: scaffold0062
Description:

Target: scaffold0062; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 15093 - 15221
Alignment:
1 attaagactttctcatttcaaaaggtggtcttccttacaatctcccatcgactcttgcaaatggtcctcgcaaatattacgcgtgttaatgtttgtcctt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||    
15093 attaagactttctcatttcaaaaggtggtcttccttacaatctcccatcgactcttgcaaatggtcctcgcaaatattacacgtgttaatttttgtcctt 15192  T
101 gaattgttttcgttttgttttagtccttg 129  Q
    |||||||||||||||||||||||||||||    
15193 gaattgttttcgttttgttttagtccttg 15221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 3 - 129
Target Start/End: Original strand, 25261 - 25387
Alignment:
3 taagactttctcatttcaaaaggtggtcttccttacaatctcccatcgactcttgcaaatggtcctcgcaaatattacgcgtgttaatgtttgtccttga 102  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||     
25261 taagactttctcatttcaaaaggtggtattccttacaatctcccatcgactcttgcaaatggtcctcacaaatattacgcgtgttaatttttgtccttgc 25360  T
103 attgttttcgttttgttttagtccttg 129  Q
    |||||||||||||||||||||||||||    
25361 attgttttcgttttgttttagtccttg 25387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062; HSP #3
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 3 - 129
Target Start/End: Original strand, 35427 - 35553
Alignment:
3 taagactttctcatttcaaaaggtggtcttccttacaatctcccatcgactcttgcaaatggtcctcgcaaatattacgcgtgttaatgtttgtccttga 102  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||     
35427 taagactttctcatttcaaaaggtggtattccttacaatctcccatcgactcttgcaaatggtcctcacaaatattacgcgtgttaatttttgtccttgc 35526  T
103 attgttttcgttttgttttagtccttg 129  Q
    |||||||||||||||||||||||||||    
35527 attgttttcgttttgttttagtccttg 35553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062; HSP #4
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 221 - 360
Target Start/End: Original strand, 15310 - 15449
Alignment:
221 ccaacacgcttgatggttgcatagaccatttggaaatttaaggctaacttatttgaggaaatgttcacactatataaaataattgaagaaatggngttat 320  Q
    ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||| ||| | |||||    
15310 ccaacacgcttaatggttgcagagaccatttggaaatttaaggctaacttatttgaggaggtgttcacactatataaaataattgaagcaatagtgttat 15409  T
321 aaaagggcaccaagagtttgtgataaattccaaccacaaa 360  Q
    ||||||| | ||||||||||||||||||||||||||||||    
15410 aaaagggaagcaagagtttgtgataaattccaaccacaaa 15449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062; HSP #5
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 221 - 360
Target Start/End: Original strand, 25478 - 25617
Alignment:
221 ccaacacgcttgatggttgcatagaccatttggaaatttaaggctaacttatttgaggaaatgttcacactatataaaataattgaagaaatggngttat 320  Q
    ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||| ||| | |||||    
25478 ccaacacgcttaatggttgcagagaccatttggaaatttaaggctaacttatttgaggaggtgttcacactatataaaataattgaagcaatagtgttat 25577  T
321 aaaagggcaccaagagtttgtgataaattccaaccacaaa 360  Q
    ||||||| | ||||||||||||||||||||||||||||||    
25578 aaaagggaagcaagagtttgtgataaattccaaccacaaa 25617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062; HSP #6
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 221 - 360
Target Start/End: Original strand, 35644 - 35783
Alignment:
221 ccaacacgcttgatggttgcatagaccatttggaaatttaaggctaacttatttgaggaaatgttcacactatataaaataattgaagaaatggngttat 320  Q
    ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||| ||| | |||||    
35644 ccaacacgcttaatggttgcagagaccatttggaaatttaaggctaacttatttgaggaggtgttcacactatataaaataattgaagcaatagtgttat 35743  T
321 aaaagggcaccaagagtttgtgataaattccaaccacaaa 360  Q
    ||||||| | ||||||||||||||||||||||||||||||    
35744 aaaagggaagcaagagtttgtgataaattccaaccacaaa 35783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0062; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 221 - 274
Target Start/End: Original strand, 8869 - 8922
Alignment:
221 ccaacacgcttgatggttgcatagaccatttggaaatttaaggctaacttattt 274  Q
    ||||||||||||||||||| | |||||||||| ||||||||| |||| ||||||    
8869 ccaacacgcttgatggttgtagagaccatttgcaaatttaagcctaatttattt 8922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106077 times since January 2019
Visitors: 1319