View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A71 (Length: 320)

Name: R108-tnk507-A71
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A71
R108-tnk507-A71
[»] chr7 (3 HSPs)
chr7 (61-228)||(25187356-25187523)
chr7 (1-67)||(25187236-25187302)
chr7 (257-320)||(25187298-25187361)


Alignment Details
Target: chr7 (Bit Score: 164; Significance: 1e-87; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 61 - 228
Target Start/End: Complemental strand, 25187523 - 25187356
Alignment:
61 tattaatatttcttctccattaggattttctcctcgattcgtcaaaccaaacatgtatgaaatcactctcttttgcccctccattaagcttcctctacac 160  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
25187523 tattaatatttcttctccattaggattttctcctcgattcgtcaaaccaaacatgtatgacatcactctcttttgcccctccattaagcttcctctacac 25187424  T
161 aattgaaccaaacagtacctaagtgtgtgttcatggatactcttcaatttcaaagacattattactac 228  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
25187423 aattgaaccaaacagtacctaagtgtgtgttcatggatactcttcaatttcaaagacattattactac 25187356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 25187302 - 25187236
Alignment:
1 ggtgattcacttgaattgaaatctatgagacattgtgaataatatgcgacaataattatgtattaat 67  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
25187302 ggtgattcacttgaattgaaatctatgagacattgtgaataatatccgacaataattatgtattaat 25187236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 257 - 320
Target Start/End: Complemental strand, 25187361 - 25187298
Alignment:
257 tactactgcaatttcgaacaaaaactattgattcacttgaagtgaaatccttgtgacatggtga 320  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
25187361 tactactgcaatttcgaagaaaaactattgattcacttgaagtgaaatccttgtgacatggtga 25187298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360900 times since January 2019
Visitors: 487