View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A8 (Length: 269)

Name: R108-tnk507-A8
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A8
R108-tnk507-A8
[»] chr2 (1 HSPs)
chr2 (1-267)||(36431906-36432172)


Alignment Details
Target: chr2 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 1 - 267
Target Start/End: Complemental strand, 36432172 - 36431906
Alignment:
1 tttatctgatgccggtgatgaccatgacggtgttcgttcggaggggcgttgaacaattagcataggtttggatgaggatgagggagatgaatttgaggac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36432172 tttatctgatgccggtgatgaccatgacggtgttcgttcggaggggcgttgaacaattagcataggtttggatgaggatgagggagatgaatttgaggac 36432073  T
101 gatgaagctgagagagaaacagggataagagcatcgttgagaaggttggaattgtcaccggaatcgggagattcttcgttttccggcaagacggcgagga 200  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36432072 gatgaagccgagagagaaacagggataagagcatcgttgagaaggttggaattgtcaccggaatcgggagattcttcgttttccggcaagacggcgagga 36431973  T
201 ctccgaaggaatcgggagggcctaagggggaggatttgcgttggaattggtggtgattatagtgatg 267  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
36431972 ctccgaaggaatcgggagggcctaagggggaggatttgcgttggaattggtggtgattgtagtgatg 36431906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360342 times since January 2019
Visitors: 483