View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-A9 (Length: 335)

Name: R108-tnk507-A9
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-A9
R108-tnk507-A9
[»] chr2 (35 HSPs)
chr2 (24-254)||(44469028-44469258)
chr2 (249-326)||(3668208-3668285)
chr2 (250-321)||(30486229-30486300)
chr2 (249-326)||(43637178-43637255)
chr2 (249-321)||(561613-561685)
chr2 (249-313)||(4381822-4381886)
chr2 (249-315)||(22567627-22567693)
chr2 (249-326)||(2898085-2898162)
chr2 (249-321)||(27856491-27856563)
chr2 (249-313)||(38590969-38591033)
chr2 (249-321)||(44587921-44587993)
chr2 (249-320)||(31438666-31438737)
chr2 (249-326)||(20552944-20553022)
chr2 (249-319)||(31390033-31390103)
chr2 (249-313)||(5093634-5093698)
chr2 (249-313)||(6580216-6580280)
chr2 (249-321)||(22068415-22068486)
chr2 (249-321)||(26891758-26891830)
chr2 (249-308)||(26387159-26387218)
chr2 (249-326)||(34442627-34442704)
chr2 (249-313)||(38296204-38296268)
chr2 (271-326)||(5881231-5881286)
chr2 (249-324)||(8969502-8969576)
chr2 (249-296)||(15079053-15079100)
chr2 (249-324)||(28600983-28601057)
chr2 (249-319)||(22887771-22887841)
chr2 (249-326)||(32860115-32860193)
chr2 (249-309)||(27584769-27584829)
chr2 (249-321)||(32360964-32361036)
chr2 (249-312)||(13574124-13574187)
chr2 (249-320)||(29102378-29102449)
chr2 (249-296)||(39531868-39531915)
chr2 (277-326)||(28012077-28012127)
chr2 (249-289)||(15146683-15146723)
chr2 (278-326)||(25782954-25783002)
[»] scaffold0003 (1 HSPs)
scaffold0003 (249-321)||(53780-53852)
[»] chr6 (35 HSPs)
chr6 (249-321)||(27433511-27433583)
chr6 (249-321)||(392115-392187)
chr6 (249-320)||(2350672-2350743)
chr6 (249-325)||(3026104-3026179)
chr6 (249-313)||(3515793-3515857)
chr6 (249-312)||(12525747-12525810)
chr6 (249-323)||(34477645-34477719)
chr6 (249-326)||(1391273-1391350)
chr6 (249-310)||(25165508-25165569)
chr6 (249-321)||(4215714-4215786)
chr6 (249-325)||(18276710-18276786)
chr6 (249-313)||(20897975-20898039)
chr6 (251-323)||(23629673-23629745)
chr6 (249-321)||(34396622-34396694)
chr6 (249-326)||(32985288-32985366)
chr6 (249-318)||(13529477-13529546)
chr6 (249-318)||(26467219-26467288)
chr6 (249-313)||(7851254-7851318)
chr6 (249-313)||(11115190-11115254)
chr6 (249-313)||(12145212-12145276)
chr6 (249-313)||(13417057-13417121)
chr6 (249-313)||(31280348-31280412)
chr6 (249-321)||(32929603-32929675)
chr6 (258-318)||(35043912-35043972)
chr6 (250-309)||(29451211-29451270)
chr6 (249-319)||(23402159-23402229)
chr6 (260-326)||(29978246-29978312)
chr6 (249-298)||(961051-961100)
chr6 (249-313)||(1840342-1840406)
chr6 (249-309)||(21878442-21878502)
chr6 (252-317)||(34851947-34852011)
chr6 (249-309)||(28225252-28225311)
chr6 (249-312)||(2580980-2581043)
chr6 (249-308)||(9661018-9661077)
chr6 (249-326)||(28562694-28562771)
[»] chr5 (24 HSPs)
chr5 (249-321)||(35132541-35132613)
chr5 (249-321)||(35504335-35504407)
chr5 (249-326)||(34650928-34651005)
chr5 (245-321)||(10069988-10070064)
chr5 (249-319)||(19647753-19647823)
chr5 (249-326)||(13661821-13661899)
chr5 (249-317)||(6284818-6284886)
chr5 (249-321)||(8787358-8787430)
chr5 (249-321)||(10054447-10054519)
chr5 (249-321)||(11846091-11846163)
chr5 (249-319)||(2619652-2619722)
chr5 (251-313)||(39069408-39069469)
chr5 (249-326)||(4837271-4837348)
chr5 (249-313)||(12506323-12506387)
chr5 (249-313)||(13470178-13470242)
chr5 (249-317)||(19436931-19436999)
chr5 (249-309)||(21547489-21547549)
chr5 (249-312)||(9721702-9721765)
chr5 (249-315)||(39067030-39067097)
chr5 (252-326)||(31909645-31909719)
chr5 (249-307)||(40057340-40057398)
chr5 (249-307)||(40564499-40564557)
chr5 (249-321)||(11958062-11958134)
chr5 (249-315)||(20175252-20175318)
[»] chr4 (40 HSPs)
chr4 (249-321)||(7768957-7769029)
chr4 (249-321)||(18067974-18068046)
chr4 (249-321)||(15186262-15186334)
chr4 (249-319)||(43944528-43944598)
chr4 (249-310)||(37987965-37988026)
chr4 (249-321)||(789625-789697)
chr4 (249-321)||(43202478-43202550)
chr4 (249-321)||(54897327-54897399)
chr4 (249-312)||(12356272-12356335)
chr4 (249-318)||(24679737-24679806)
chr4 (249-326)||(28755634-28755711)
chr4 (249-309)||(4220226-4220286)
chr4 (249-321)||(4268917-4268989)
chr4 (249-321)||(16536067-16536139)
chr4 (249-321)||(32217064-32217136)
chr4 (249-313)||(54655971-54656035)
chr4 (249-313)||(54945873-54945937)
chr4 (249-312)||(19503200-19503263)
chr4 (249-326)||(4089155-4089233)
chr4 (249-321)||(32202575-32202647)
chr4 (249-313)||(42898841-42898905)
chr4 (249-320)||(5091705-5091776)
chr4 (249-316)||(31680558-31680625)
chr4 (249-316)||(52533880-52533947)
chr4 (249-316)||(53655973-53656040)
chr4 (249-321)||(29591208-29591280)
chr4 (253-309)||(52697083-52697139)
chr4 (270-313)||(1432658-1432701)
chr4 (249-300)||(3783596-3783647)
chr4 (249-300)||(30154258-30154309)
chr4 (249-300)||(36395139-36395190)
chr4 (249-312)||(42815137-42815200)
chr4 (249-319)||(33108768-33108837)
chr4 (249-310)||(39843937-39843998)
chr4 (271-326)||(47231989-47232045)
chr4 (249-300)||(46148979-46149030)
chr4 (249-320)||(50619106-50619177)
chr4 (249-326)||(54054561-54054639)
chr4 (249-313)||(6164121-6164184)
chr4 (249-313)||(50603254-50603318)
[»] chr3 (37 HSPs)
chr3 (249-321)||(53489919-53489991)
chr3 (249-321)||(7468430-7468502)
chr3 (249-321)||(39074438-39074510)
chr3 (249-321)||(52520700-52520772)
chr3 (258-326)||(52718181-52718249)
chr3 (249-319)||(20924013-20924083)
chr3 (249-326)||(10617379-10617456)
chr3 (249-321)||(272239-272311)
chr3 (249-325)||(41554035-41554111)
chr3 (249-319)||(43786892-43786962)
chr3 (249-321)||(46352653-46352725)
chr3 (249-321)||(49893350-49893422)
chr3 (249-312)||(4168211-4168274)
chr3 (249-308)||(13159929-13159988)
chr3 (249-315)||(28139334-28139400)
chr3 (249-319)||(40362675-40362745)
chr3 (249-326)||(48725284-48725362)
chr3 (249-319)||(52246603-52246673)
chr3 (249-313)||(858616-858680)
chr3 (249-313)||(22248913-22248977)
chr3 (250-321)||(18014691-18014762)
chr3 (249-319)||(42964344-42964414)
chr3 (249-313)||(2119458-2119522)
chr3 (249-321)||(50395657-50395729)
chr3 (249-316)||(2505373-2505440)
chr3 (249-300)||(31514831-31514882)
chr3 (271-313)||(2391634-2391676)
chr3 (271-313)||(2393395-2393437)
chr3 (257-319)||(41304026-41304088)
chr3 (271-319)||(11308327-11308375)
chr3 (249-313)||(43269834-43269898)
chr3 (249-325)||(50359281-50359357)
chr3 (249-308)||(29241669-29241728)
chr3 (275-326)||(49529390-49529441)
chr3 (249-296)||(21010041-21010086)
chr3 (261-321)||(23925299-23925359)
chr3 (249-313)||(42548122-42548186)
[»] chr7 (37 HSPs)
chr7 (249-326)||(28587923-28588000)
chr7 (249-321)||(34333303-34333375)
chr7 (249-320)||(30810675-30810746)
chr7 (249-309)||(4628597-4628657)
chr7 (249-313)||(5239312-5239376)
chr7 (249-321)||(29993582-29993654)
chr7 (249-321)||(43594131-43594203)
chr7 (249-326)||(8754680-8754758)
chr7 (249-319)||(11686419-11686489)
chr7 (249-323)||(42044388-42044461)
chr7 (249-319)||(47083076-47083146)
chr7 (249-326)||(24798498-24798575)
chr7 (249-326)||(47839506-47839583)
chr7 (249-321)||(12218531-12218603)
chr7 (249-321)||(18485980-18486052)
chr7 (249-321)||(24438496-24438568)
chr7 (249-325)||(27456208-27456284)
chr7 (249-309)||(34546409-34546469)
chr7 (249-319)||(18117164-18117234)
chr7 (249-319)||(34606282-34606352)
chr7 (249-311)||(45045799-45045861)
chr7 (260-309)||(4100630-4100679)
chr7 (249-309)||(3021922-3021982)
chr7 (261-313)||(5729373-5729425)
chr7 (249-313)||(47657007-47657071)
chr7 (273-319)||(28262052-28262098)
chr7 (249-315)||(29835799-29835865)
chr7 (249-310)||(13064972-13065033)
chr7 (249-314)||(18220533-18220598)
chr7 (249-326)||(23363262-23363339)
chr7 (249-313)||(525170-525234)
chr7 (249-313)||(1737007-1737071)
chr7 (249-296)||(18470034-18470081)
chr7 (268-319)||(22973619-22973670)
chr7 (249-319)||(37631637-37631707)
chr7 (249-326)||(18220626-18220702)
chr7 (249-317)||(7689295-7689363)
[»] chr8 (40 HSPs)
chr8 (249-321)||(20831648-20831720)
chr8 (249-321)||(30675667-30675739)
chr8 (249-319)||(168487-168557)
chr8 (249-319)||(11112660-11112730)
chr8 (249-326)||(42035076-42035154)
chr8 (249-326)||(4648208-4648285)
chr8 (249-326)||(21595860-21595937)
chr8 (249-326)||(37373219-37373296)
chr8 (249-325)||(36730459-36730535)
chr8 (250-321)||(2805356-2805427)
chr8 (249-312)||(9537919-9537982)
chr8 (249-326)||(16888639-16888716)
chr8 (249-325)||(33357224-33357301)
chr8 (245-321)||(9253992-9254068)
chr8 (249-319)||(27988594-27988664)
chr8 (249-319)||(28045896-28045966)
chr8 (249-326)||(34228695-34228773)
chr8 (249-326)||(12203868-12203945)
chr8 (249-326)||(12448296-12448373)
chr8 (249-326)||(16785100-16785177)
chr8 (249-310)||(32113938-32113999)
chr8 (271-326)||(12652643-12652699)
chr8 (249-321)||(13643031-13643103)
chr8 (249-321)||(13743456-13743528)
chr8 (249-313)||(40831304-40831368)
chr8 (271-326)||(9063169-9063224)
chr8 (249-308)||(16890575-16890634)
chr8 (249-320)||(29444235-29444306)
chr8 (249-326)||(43119230-43119308)
chr8 (249-317)||(9278235-9278303)
chr8 (249-309)||(28626799-28626859)
chr8 (249-319)||(4537839-4537909)
chr8 (249-307)||(7304613-7304671)
chr8 (249-309)||(10618049-10618109)
chr8 (249-300)||(34192815-34192866)
chr8 (271-321)||(16394178-16394228)
chr8 (249-307)||(29235268-29235326)
chr8 (249-326)||(3930328-3930405)
chr8 (249-313)||(22956733-22956796)
chr8 (273-313)||(36923782-36923822)
[»] chr1 (46 HSPs)
chr1 (249-321)||(51065843-51065915)
chr1 (249-319)||(29210434-29210504)
chr1 (249-326)||(17333377-17333454)
chr1 (249-321)||(29657790-29657862)
chr1 (249-321)||(42770085-42770157)
chr1 (249-313)||(47010020-47010084)
chr1 (249-312)||(15282609-15282672)
chr1 (249-326)||(14350372-14350450)
chr1 (249-319)||(18043183-18043253)
chr1 (249-319)||(38162871-38162941)
chr1 (249-313)||(3784808-3784872)
chr1 (249-321)||(24178558-24178630)
chr1 (249-320)||(38702028-38702099)
chr1 (249-312)||(51368880-51368943)
chr1 (249-307)||(6770370-6770428)
chr1 (249-307)||(45431311-45431369)
chr1 (249-310)||(23473559-23473620)
chr1 (249-310)||(30294476-30294537)
chr1 (249-326)||(35985716-35985793)
chr1 (249-313)||(9266823-9266887)
chr1 (249-321)||(12072157-12072229)
chr1 (249-313)||(15227766-15227830)
chr1 (249-317)||(43286745-43286813)
chr1 (271-326)||(19011113-19011168)
chr1 (249-308)||(19031910-19031969)
chr1 (245-308)||(47532761-47532824)
chr1 (249-311)||(3097688-3097750)
chr1 (249-319)||(5694342-5694412)
chr1 (249-307)||(39497340-39497398)
chr1 (249-310)||(8473009-8473070)
chr1 (249-321)||(3838872-3838944)
chr1 (249-317)||(38335192-38335260)
chr1 (249-312)||(35700745-35700808)
chr1 (249-312)||(48071510-48071573)
chr1 (255-310)||(52749632-52749687)
chr1 (260-313)||(10976008-10976061)
chr1 (249-321)||(29683214-29683287)
chr1 (249-294)||(37503260-37503305)
chr1 (249-313)||(36446420-36446483)
chr1 (274-321)||(14881086-14881133)
chr1 (249-320)||(30657628-30657699)
chr1 (249-307)||(50128267-50128325)
chr1 (250-323)||(45449340-45449413)
chr1 (249-321)||(13961231-13961302)
chr1 (249-313)||(26228220-26228284)
chr1 (249-313)||(39081828-39081892)
[»] scaffold0674 (1 HSPs)
scaffold0674 (249-323)||(7992-8066)
[»] scaffold0549 (1 HSPs)
scaffold0549 (249-323)||(7305-7379)
[»] scaffold0264 (1 HSPs)
scaffold0264 (249-326)||(22974-23052)
[»] scaffold0045 (2 HSPs)
scaffold0045 (249-319)||(50569-50639)
scaffold0045 (249-315)||(53441-53507)
[»] scaffold0206 (1 HSPs)
scaffold0206 (250-325)||(11066-11140)
[»] scaffold0014 (1 HSPs)
scaffold0014 (258-321)||(68394-68457)
[»] scaffold0002 (1 HSPs)
scaffold0002 (249-308)||(147000-147059)
[»] scaffold0050 (2 HSPs)
scaffold0050 (249-313)||(69253-69317)
scaffold0050 (249-313)||(33776-33840)
[»] scaffold0021 (1 HSPs)
scaffold0021 (249-321)||(116223-116295)
[»] scaffold0188 (1 HSPs)
scaffold0188 (250-326)||(6206-6283)
[»] scaffold1152 (1 HSPs)
scaffold1152 (249-309)||(709-769)
[»] scaffold0524 (1 HSPs)
scaffold0524 (249-313)||(852-916)
[»] scaffold1266 (1 HSPs)
scaffold1266 (253-326)||(306-379)
[»] scaffold0038 (1 HSPs)
scaffold0038 (249-309)||(25750-25809)
[»] scaffold0190 (1 HSPs)
scaffold0190 (271-321)||(14915-14965)
[»] scaffold0533 (1 HSPs)
scaffold0533 (249-289)||(5090-5130)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 6e-96; HSPs: 35)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 24 - 254
Target Start/End: Original strand, 44469028 - 44469258
Alignment:
24 ttaaataatataataaaacggatacaatagcatataatgtagtttaagttaagagttaa-ggtataaatgaagaaaaaatcgagctcaaattaaattatg 122  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    ||||||    
44469028 ttaaataatataataaaacggatacaatagcacataatgtagtttaagttaagagttaaaggtataaatgaagaaaaaatcgagctcaaa----attatg 44469123  T
123 tatttcttttatagactaacaaaaaa-tatgattctcggc-taattaaatttttgaattgtaagtatatgagctctagtttattcagttcaggcgtttgg 220  Q
    |||||||||||||||||||||||||| ||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44469124 tatttcttttatagactaacaaaaaaatatgattctcgacataattaaatttttgaattgtaagtatatgagctctagtttattcagttcaggcgtttgg 44469223  T
221 aatgagtatataaccaaac-aaaagtatcattaat 254  Q
    ||||||||||||||||||| |||||||||||||||    
44469224 aatgagtatataaccaaacaaaaagtatcattaat 44469258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 3668208 - 3668285
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||    
3668208 attaattacacaatttcaatgcattaactactatataatttccttttccatacccttaaccagtgtccgggggcaccg 3668285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 250 - 321
Target Start/End: Complemental strand, 30486300 - 30486229
Alignment:
250 ttaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    ||||||| ||||||| |||| |||||||||||||||||||||||||||||| |||||||||||| |||||||    
30486300 ttaattacacaatttcaatacattaactactatataatttcctttttcatatccttaaccagtgccccgggg 30486229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 43637255 - 43637178
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||    
43637255 attaattacacaatttcaatgcattaactactatataatttccttattcatatccttaaccagtgtctcggggcaccg 43637178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 561613 - 561685
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||||| |||||||    
561613 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgccccgggg 561685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 4381886 - 4381822
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||||||||||||||||    
4381886 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaaccagtg 4381822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 249 - 315
Target Start/End: Complemental strand, 22567693 - 22567627
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtc 315  Q
    |||||||| ||||||| |||| |||||||||||||||||||| ||||||||| ||||||||||||||    
22567693 attaattacacaatttcaatacattaactactatataatttcttttttcatatccttaaccagtgtc 22567627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 2898162 - 2898085
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  ||||||||||||||||||| |||||||||| ||||||||||||| ||||| |||||    
2898162 attaattacacaatttcaatgcattaactactatataattttctttttcatatccttaaccagtgttccgggacaccg 2898085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 27856491 - 27856563
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||| |||||||||||||||||||||| ||||||||||| |||||||    
27856491 attaattacacaatttcaatgcattaactattatataatttcctttttcatactcttaaccagtgccccgggg 27856563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 38590969 - 38591033
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| |||||||||||| |||||||||| |||||||||||||||||||  |||||||||||    
38590969 attaattacacaattttaatacattaactactgtataatttcctttttcatattcttaaccagtg 38591033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 44587993 - 44587921
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| ||| ||||||||||||||||||||||||||| ||| |||||||| ||| |||||||    
44587993 attaattacacaatttcaatgtattaactactatataatttccttttttatatccttaaccggtgccccgggg 44587921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 249 - 320
Target Start/End: Complemental strand, 31438737 - 31438666
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggg 320  Q
    |||||||| ||||||| |||  |||||||||| ||||||||||||||||||| |||||||||||| ||||||    
31438737 attaattacacaatttcaatgcattaactactgtataatttcctttttcatatccttaaccagtgccccggg 31438666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 20553022 - 20552944
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg-tcccggggcaccg 326  Q
    |||||||| ||||||| |||  ||||| |||||||||||||||||||||||| ||||||||||||  ||||||||||||    
20553022 attaattacacaatttcaatgcattaattactatataatttcctttttcatatccttaaccagtgcccccggggcaccg 20552944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 31390103 - 31390033
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| | ||||| |||| |||||||||||||||||||||||||||||| ||||||| |||| |||||    
31390103 attaattacataatttcaatacattaactactatataatttcctttttcatatccttaactagtgccccgg 31390033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 5093634 - 5093698
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| |||||||||||  |||||||||||| ||||||||||||||||| ||||||| ||||    
5093634 attaattacacaattttaatgcattaactactatttaatttcctttttcatatccttaactagtg 5093698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 6580280 - 6580216
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| | ||||| |||  ||||||||||||||| |||||||||||||||||||||||||||    
6580280 attaattacataatttcaatgcattaactactatatagtttcctttttcatacccttaaccagtg 6580216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 22068415 - 22068486
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||||||||||| |||  || ||||||||||||||| ||||||||||| |||||||||||| |||||||    
22068415 attaattatacaatttcaatgcat-aactactatataattccctttttcatatccttaaccagtgccccgggg 22068486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 26891758 - 26891830
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||| ||||||||||||||||| ||| |||||| |||||||||||||    
26891758 attaattacacaatttcaatgcattaactaatatataatttccttttttatatccttaatcagtgtcccgggg 26891830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 249 - 308
Target Start/End: Original strand, 26387159 - 26387218
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaac 308  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||    
26387159 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaac 26387218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 34442627 - 34442704
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  ||||||||||||||||| | |||||||||| |||||||  ||| ||||||||||||    
34442627 attaattacacaatttcaatgcattaactactatataatcttctttttcatatccttaacatgtgccccggggcaccg 34442704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 38296268 - 38296204
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| ||| |||||| ||||||||||||| |||||||||| | ||||||||||    
38296268 attaattacacaatttcaatgtattaattactatataattttctttttcatatctttaaccagtg 38296204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 271 - 326
Target Start/End: Complemental strand, 5881286 - 5881231
Alignment:
271 attaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||||||||||||||||||||||||| |||||||| |||  ||||| |||||    
5881286 attaactactatataatttcctttttcatatccttaacctgtgctccgggacaccg 5881231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 324
Target Start/End: Original strand, 8969502 - 8969576
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcac 324  Q
    |||||||| || |||| |||  ||||||||||||||||||| |||||||||| ||||||| |||| ||||||||||    
8969502 attaattacactatttcaatgcattaactactatataattttctttttcatatccttaactagtg-cccggggcac 8969576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 296
Target Start/End: Original strand, 15079053 - 15079100
Alignment:
249 attaattatacaattttaatatattaactactatataatttccttttt 296  Q
    |||||||| ||||||| |||| ||||||||||||||||||||||||||    
15079053 attaattacacaatttcaatacattaactactatataatttccttttt 15079100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 324
Target Start/End: Complemental strand, 28601057 - 28600983
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcac 324  Q
    |||||||||||||||| |||  || ||||||| ||||||| ||||||||||| |||||||||||| ||| ||||||    
28601057 attaattatacaatttcaatgcat-aactactttataattccctttttcatatccttaaccagtgcccccgggcac 28600983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 22887841 - 22887771
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| | ||||| |||  |||||||||||||||||||| ||||||||| ||||||||| || |||||    
22887841 attaattacataatttcaatgcattaactactatataatttcttttttcatatccttaaccactgccccgg 22887771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 32860193 - 32860115
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg-tcccggggcaccg 326  Q
    |||||||| ||||||| |||  ||||| |||||||||||||||||||| ||| |||||||| |||  ||||||||||||    
32860193 attaattacacaatttcaatgcattaaatactatataatttccttttttatatccttaacccgtgcccccggggcaccg 32860115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 309
Target Start/End: Complemental strand, 27584829 - 27584769
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||||| ||||||| |||   |||||||||||||||||||| |||||||| ||||||||    
27584829 attaattacacaatttcaatgctttaactactatataatttcccttttcatatccttaacc 27584769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 32360964 - 32361036
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    ||||||||||  |||| |||  |||||||| |||||||||| |||||||| | |||||||||||| |||||||    
32360964 attaattatattatttcaatgcattaactattatataattttctttttcacatccttaaccagtgccccgggg 32361036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 312
Target Start/End: Original strand, 13574124 - 13574187
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    |||||||| ||||||| |||| ||||| |  |||||| |||||||||||||| |||||||||||    
13574124 attaattacacaatttcaatacattaatttttatatattttcctttttcatatccttaaccagt 13574187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 320
Target Start/End: Original strand, 29102378 - 29102449
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggg 320  Q
    |||||||||| ||||| ||| |||||||  ||||||||||| |||||| |||  |||||||| |||||||||    
29102378 attaattataaaatttcaatgtattaaccgctatataattttctttttgatattcttaaccaatgtcccggg 29102449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 296
Target Start/End: Complemental strand, 39531915 - 39531868
Alignment:
249 attaattatacaattttaatatattaactactatataatttccttttt 296  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||    
39531915 attaattacacaatttcaatgcattaactactatataatttccttttt 39531868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 277 - 326
Target Start/End: Original strand, 28012077 - 28012127
Alignment:
277 tactatataattt-cctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    ||||||||||||| ||||||| ||| ||||||||||| |||||||||||||    
28012077 tactatataattttcctttttaatatccttaaccagtatcccggggcaccg 28012127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 289
Target Start/End: Complemental strand, 15146723 - 15146683
Alignment:
249 attaattatacaattttaatatattaactactatataattt 289  Q
    |||||||||||||||| ||| ||||||||| ||||||||||    
15146723 attaattatacaatttcaatgtattaactattatataattt 15146683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 278 - 326
Target Start/End: Original strand, 25782954 - 25783002
Alignment:
278 actatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||||||||||||||||||  |||||| ||||||  |||||||||    
25782954 actatataatttcctttttcatattcttaactagtgtcttggggcaccg 25783002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 57; Significance: 9e-24; HSPs: 1)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 53780 - 53852
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| |||||||||||  ||||||||||||||||||||||||||||||||||||||||||| |||||||    
53780 attaattacacaattttaatgcattaactactatataatttcctttttcatacccttaaccagtgccccgggg 53852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 57; Significance: 9e-24; HSPs: 35)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 27433583 - 27433511
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| |||||||||||  ||||||||||||||||||||||||||||||||||||||||||| |||||||    
27433583 attaattacacaattttaatgcattaactactatataatttcctttttcatacccttaaccagtgccccgggg 27433511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 392187 - 392115
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||||||||||||||| |||||||    
392187 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaaccagtgccccgggg 392115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 249 - 320
Target Start/End: Complemental strand, 2350743 - 2350672
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggg 320  Q
    |||||||| ||||||| |||| |||||||||||||||||||||||||||||| |||||||||||| ||||||    
2350743 attaattacacaatttcaatacattaactactatataatttcctttttcatatccttaaccagtgccccggg 2350672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 325
Target Start/End: Original strand, 3026104 - 3026179
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcacc 325  Q
    |||||||||||||||| |||  |||||||||| ||||||||| |||||||||||||||||||||| |||||||||||    
3026104 attaattatacaatttcaatgcattaactactgtataatttcatttttcatacccttaaccagtg-cccggggcacc 3026179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 3515857 - 3515793
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||||||||||||||||    
3515857 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaaccagtg 3515793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 249 - 312
Target Start/End: Complemental strand, 12525810 - 12525747
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    |||||||| ||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||    
12525810 attaattacacattttcaatgtattaactactatataatttcctttttcatacccttaaccagt 12525747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 249 - 323
Target Start/End: Original strand, 34477645 - 34477719
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggca 323  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||||| || ||||||    
34477645 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgcccgggggca 34477719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 1391273 - 1391350
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||||||||||| |||  |||||||||||||||||||||||||||||| |||||| ||||  ||||| ||||||    
1391273 attaattatacaatttcaatgcattaactactatataatttcctttttcatatccttaatcagtaccccggagcaccg 1391350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 249 - 310
Target Start/End: Original strand, 25165508 - 25165569
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacca 310  Q
    |||||||| ||||||| ||||||||||||||||||||||||| ||||||||| |||||||||    
25165508 attaattacacaatttcaatatattaactactatataatttcttttttcatatccttaacca 25165569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 4215786 - 4215714
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||| |||||||||||||||||||||| ||||||||||| |||||||    
4215786 attaattacacaatttcaatgcattaactattatataatttcctttttcatactcttaaccagtgccccgggg 4215714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 325
Target Start/End: Original strand, 18276710 - 18276786
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcacc 325  Q
    |||||||| |||| || |||  |||||||||||||||||||||||||||||| |||||||||||| || ||||||||    
18276710 attaattacacaaattcaatgcattaactactatataatttcctttttcatatccttaaccagtgcccaggggcacc 18276786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 20898039 - 20897975
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| ||||||||||||    
20898039 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtg 20897975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 251 - 323
Target Start/End: Original strand, 23629673 - 23629745
Alignment:
251 taattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggca 323  Q
    |||||| ||||||| |||| ||||||||||||||||||| |||||||||| |||||| ||||| |||||||||    
23629673 taattacacaatttcaatacattaactactatataattttctttttcatatccttaatcagtgccccggggca 23629745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 34396622 - 34396694
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||| |||||| ||||    
34396622 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaacctgtgtcctgggg 34396694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 32985288 - 32985366
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccg-gggcaccg 326  Q
    |||||||| ||||||| |||| |||||||||||||||||||||||||| ||| ||||||||| || |||| ||||||||    
32985288 attaattacacaatttcaatacattaactactatataatttccttttttatatccttaaccaatgccccgagggcaccg 32985366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 318
Target Start/End: Complemental strand, 13529546 - 13529477
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccg 318  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||| | |||||||||||| ||||    
13529546 attaattacacaatttcaatgcattaactactatataatttcctttttcacatccttaaccagtgccccg 13529477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 318
Target Start/End: Original strand, 26467219 - 26467288
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccg 318  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||| ||| ||||    
26467219 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccggtgccccg 26467288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 7851254 - 7851318
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| |||||||||||  ||||| ||||||||||||| |||||||||| ||||||||||||    
7851254 attaattacacaattttaatgcattaattactatataattttctttttcatatccttaaccagtg 7851318  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 11115190 - 11115254
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| ||| ||||||||| ||||||||||||||||| ||| ||||||||||||    
11115190 attaattacacaatttcaatgtattaactattatataatttccttttttatatccttaaccagtg 11115254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 12145212 - 12145276
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| ||||||| ||||    
12145212 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaacaagtg 12145276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 13417057 - 13417121
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||| |||||||| ||||||||||||||||||||| ||||||| ||||    
13417057 attaattacacaatttcaatacattaactaatatataatttcctttttcatatccttaactagtg 13417121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 31280412 - 31280348
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||||||||||| |||  ||||||||||||||||||||||||||||| | ||||| |||||    
31280412 attaattatacaatttcaatgcattaactactatataatttcctttttcattctcttaatcagtg 31280348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 32929603 - 32929675
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  ||||| || ||||||||||||||||||||||||||||||| || |||||||    
32929603 attaattacacaatttcaatgcattaattaatatataatttcctttttcatacccttaaccattgccccgggg 32929675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 258 - 318
Target Start/End: Complemental strand, 35043972 - 35043912
Alignment:
258 acaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccg 318  Q
    ||||||| |||  |||||||||||||||||||| ||||||||| |||||||||||||||||    
35043972 acaatttcaatgaattaactactatataatttcttttttcatatccttaaccagtgtcccg 35043912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 250 - 309
Target Start/End: Original strand, 29451211 - 29451270
Alignment:
250 ttaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    ||||||| ||||||| |||  |||||||||||||||||||||||||||||| ||||||||    
29451211 ttaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaacc 29451270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 23402229 - 23402159
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||  ||||||| |||  ||||| |||||||||||||||||||||||| |||||||||||| |||||    
23402229 attaatttcacaatttcaatgcattaattactatataatttcctttttcatatccttaaccagtgccccgg 23402159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 260 - 326
Target Start/End: Complemental strand, 29978312 - 29978246
Alignment:
260 aattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    ||||| |||| ||||| |||||||||||||||||||||||| ||||||| ||||||| | |||||||    
29978312 aatttcaatacattaaatactatataatttcctttttcatatccttaactagtgtccggaggcaccg 29978246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 249 - 298
Target Start/End: Complemental strand, 961100 - 961051
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttca 298  Q
    |||||||| |||||||||||  ||||||||||||||||||||||||||||    
961100 attaattacacaattttaatgcattaactactatataatttcctttttca 961051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 1840342 - 1840406
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| |||||||||||| ||||| || ||||||||||| ||||| ||| ||||||||||||    
1840342 attaattacacaattttaatacattaattattatataatttctttttttatatccttaaccagtg 1840406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 309
Target Start/End: Original strand, 21878442 - 21878502
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||||| | ||||| |||  |||||||||||||||||||||||||||||| ||||||||    
21878442 attaattaaataatttcaatgcattaactactatataatttcctttttcatatccttaacc 21878502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 252 - 317
Target Start/End: Original strand, 34851947 - 34852011
Alignment:
252 aattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtccc 317  Q
    ||||| ||||||| |||  |||||||||||||||||||||||||||||| | |||| |||||||||    
34851947 aattacacaatttcaatgcattaactactatataatttcctttttcatatctttaa-cagtgtccc 34852011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 309
Target Start/End: Complemental strand, 28225311 - 28225252
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||||| ||||||| |||| ||||| |||||||||| ||||||||||||| ||||||||    
28225311 attaattacacaatttcaatacattaattactatataa-ttcctttttcatatccttaacc 28225252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 312
Target Start/End: Complemental strand, 2581043 - 2580980
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    |||||||| | ||||| |||  |||||||||||||||||||||||||| ||| | |||||||||    
2581043 attaattacataatttcaatgcattaactactatataatttccttttttatatcattaaccagt 2580980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 308
Target Start/End: Complemental strand, 9661077 - 9661018
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaac 308  Q
    |||||||||||||||| |||  |||||||| ||| ||||||| ||||||||| |||||||    
9661077 attaattatacaatttcaatgcattaactattatgtaatttcttttttcatatccttaac 9661018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 28562771 - 28562694
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| | ||||||||||  |||| ||||||||| ||||  |||| ||| | |||||| ||||||||||||||||    
28562771 attaattacagaattttaatacgttaattactatatagtttctattttaatatcattaaccggtgtcccggggcaccg 28562694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 9e-24; HSPs: 24)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 35132613 - 35132541
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||    
35132613 attaattacacaatttcaatgtattaactactatataatttcctttttcatatccttaaccagtgtcccgggg 35132541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 35504335 - 35504407
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||||||||||||||||||||||||    
35504335 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 35504407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 34650928 - 34651005
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||||||||||||||| || |||||||||    
34650928 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaaccagtgcccgggggcaccg 34651005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 245 - 321
Target Start/End: Complemental strand, 10070064 - 10069988
Alignment:
245 tatcattaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||||| |||||||    
10070064 tatcattaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgccccgggg 10069988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 249 - 319
Target Start/End: Original strand, 19647753 - 19647823
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||||||||||| |||  |||||||||||||||||||||||||||||| |||||||||||| |||||    
19647753 attaattatacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgccccgg 19647823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 13661899 - 13661821
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg-tcccggggcaccg 326  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||    
13661899 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgctccgggggcaccg 13661821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 317
Target Start/End: Complemental strand, 6284886 - 6284818
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtccc 317  Q
    |||||||||||||||| |||| ||||| ||||||||||||||||||||  || ||||||||||||||||    
6284886 attaattatacaatttcaatacattaattactatataatttcctttttagtatccttaaccagtgtccc 6284818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 8787430 - 8787358
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||||||||||||||| ||||||||||||||||||| || |||||||    
8787430 attaattacacaatttcaatgcattaactactatataatttcatttttcatacccttaaccaatgccccgggg 8787358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 10054447 - 10054519
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  ||||| || |||||||||||||||||||||||||||||||||| |||||||    
10054447 attaattacacaatttcaatgcattaattattatataatttcctttttcatacccttaaccagtgccccgggg 10054519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 11846163 - 11846091
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| ||| ||||||||||||||||||||||||||| ||| ||||| | ||||||||||||    
11846163 attaattacacaatttcaatgtattaactactatataatttccttttttatatccttagctagtgtcccgggg 11846091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 319
Target Start/End: Original strand, 2619652 - 2619722
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||| ||||||||||| ||||||| |||||||||| ||||||| ||||||||||    
2619652 attaattacacaatttcaatacattaactactaaataattttctttttcatatccttaacaagtgtcccgg 2619722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 251 - 313
Target Start/End: Complemental strand, 39069469 - 39069408
Alignment:
251 taattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||| |||||||||||  ||||||||||||||||||||| |||||||||||||||||||||    
39069469 taattacacaattttaatgcattaactactatataatttcc-ttttcatacccttaaccagtg 39069408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 4837348 - 4837271
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  ||||| ||||||||||||||||||||||||  ||||||| ||| ||||||||||||    
4837348 attaattacacaatttcaatgcattaattactatataatttcctttttcatattcttaaccggtgccccggggcaccg 4837271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 12506387 - 12506323
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||| |||||| ||||    
12506387 attaattacacaatttcaatgcattaactactatataatttcctttttcatactcttaacgagtg 12506323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 13470242 - 13470178
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||||||||||| |||  ||| |||||||||| ||||||||||||||| ||||||||||||    
13470242 attaattatacaatttcaatgcattgactactatattatttcctttttcatatccttaaccagtg 13470178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 317
Target Start/End: Original strand, 19436931 - 19436999
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtccc 317  Q
    |||||||||||||||| |||   ||||| ||||||||||||||||||||||| ||||||| ||||||||    
19436931 attaattatacaatttcaatgctttaaccactatataatttcctttttcatatccttaacgagtgtccc 19436999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 309
Target Start/End: Original strand, 21547489 - 21547549
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||| ||| ||||||||    
21547489 attaattacacaatttcaatgcattaactactatataatttccttttttatatccttaacc 21547549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 312
Target Start/End: Original strand, 9721702 - 9721765
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    |||||||| ||||||| |||  ||||| ||||||||||||||||||||||||  ||||||||||    
9721702 attaattaaacaatttcaatgcattaattactatataatttcctttttcatattcttaaccagt 9721765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 315
Target Start/End: Original strand, 39067030 - 39067097
Alignment:
249 attaattatacaattttaatatattaactact-atataatttcctttttcatacccttaaccagtgtc 315  Q
    |||||||| | ||||| ||||||||||||| | |||||||||| ||||||||| ||||||||||||||    
39067030 attaattacataatttcaatatattaactaattatataatttcttttttcatatccttaaccagtgtc 39067097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 252 - 326
Target Start/End: Complemental strand, 31909719 - 31909645
Alignment:
252 aattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    ||||| ||||||| |||  ||||||||||||||||||||| |||| ||| ||||||||||| ||| | |||||||    
31909719 aattacacaatttcaatgcattaactactatataatttcccttttaatatccttaaccagtatccggaggcaccg 31909645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 307
Target Start/End: Complemental strand, 40057398 - 40057340
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaa 307  Q
    ||||||||||| |||| |||  | |||||||||||||||||||||||||||| ||||||    
40057398 attaattatactatttcaatgcactaactactatataatttcctttttcatatccttaa 40057340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 307
Target Start/End: Original strand, 40564499 - 40564557
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaa 307  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||| | ||||||    
40564499 attaattacacaatttcaatgcattaactactatataatttcctttttcaaatccttaa 40564557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 11958062 - 11958134
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| | |  |||||||||||||||||||||||||| ||| | |||||| ||| |||||||    
11958062 attaattacacaatttcattgcattaactactatataatttccttttttatatctttaacctgtgccccgggg 11958134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 249 - 315
Target Start/End: Complemental strand, 20175318 - 20175252
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtc 315  Q
    |||||||| ||||||| |||  |||||||||||||||||||| ||||| |||   ||||||||||||    
20175318 attaattacacaatttcaatgcattaactactatataatttctttttttatatttttaaccagtgtc 20175252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 57; Significance: 9e-24; HSPs: 40)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 7769029 - 7768957
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||    
7769029 attaattacacaatttcaatacattaactactatataatttcctttttcatacccttaaccagtgccccgggg 7768957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 18067974 - 18068046
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| |||||||||||  ||||||||||||||||||||||||||||||||||||||||||| |||||||    
18067974 attaattacacaattttaatgcattaactactatataatttcctttttcatacccttaaccagtgccccgggg 18068046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 15186334 - 15186262
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||||||||||||||| |||||||    
15186334 attaattacacaatttcaatggattaactactatataatttcctttttcatacccttaaccagtgccccgggg 15186262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 43944598 - 43944528
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||||||||||||||| |||||    
43944598 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaaccagtgccccgg 43944528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 249 - 310
Target Start/End: Complemental strand, 37988026 - 37987965
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacca 310  Q
    |||||||| ||||||| |||| ||||||||||||||||||||||||||||||||||||||||    
37988026 attaattacacaatttcaatacattaactactatataatttcctttttcatacccttaacca 37987965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 789625 - 789697
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||||||||||| ||| |||||||    
789625 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaacccgtgccccgggg 789697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 43202478 - 43202550
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| |||||||||||  ||||| |||||||||||||||||||||||||||||||| |||| |||||||    
43202478 attaattacacaattttaatgcattaattactatataatttcctttttcatacccttaactagtgccccgggg 43202550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 54897399 - 54897327
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||||||||||| |||  |||||||||||||||||||||||| ||||| |||||||||||| |||||||    
54897399 attaattatacaatttcaatgcattaactactatataatttcctttctcatatccttaaccagtgccccgggg 54897327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 249 - 312
Target Start/End: Complemental strand, 12356335 - 12356272
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    |||||||||| ||||| ||| ||||||||||||||||||||||||||||||| |||||||||||    
12356335 attaattatataatttcaatgtattaactactatataatttcctttttcatatccttaaccagt 12356272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 249 - 318
Target Start/End: Original strand, 24679737 - 24679806
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccg 318  Q
    |||||||| ||||||| |||| |||||||||||||||||||| ||||||||| |||||||||||| ||||    
24679737 attaattacacaatttcaatacattaactactatataatttcttttttcatatccttaaccagtgccccg 24679806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 28755711 - 28755634
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||||| || ||| |||||    
28755711 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgccctgggacaccg 28755634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 309
Target Start/End: Complemental strand, 4220286 - 4220226
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||||| ||||||| |||| |||||||||||||||||||||||||||||| ||||||||    
4220286 attaattacacaatttcaatacattaactactatataatttcctttttcatatccttaacc 4220226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 4268917 - 4268989
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| | ||||| |||  ||||||||||||||| ||||||||||||||||||||||||||| |||||||    
4268917 attaattacataatttcaatgcattaactactatatagtttcctttttcatacccttaaccagtgccccgggg 4268989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 16536139 - 16536067
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||||||||| | ||| |||||||    
16536139 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaatccgtgccccgggg 16536067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 32217136 - 32217064
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||| ||| |||||||||||| |||||||    
32217136 attaattacacaatttcaatgcattaactactatataatttccttttttatatccttaaccagtgccccgggg 32217064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 54655971 - 54656035
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||| |||||||||||||||||||||||||| ||| ||||||||||||    
54655971 attaattacacaatttcaatacattaactactatataatttccttttttatatccttaaccagtg 54656035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 54945873 - 54945937
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||| ||||||| |||||||||||||||||||||| ||||||||||||    
54945873 attaattacacaatttcaatacattaactgctatataatttcctttttcatatccttaaccagtg 54945937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 249 - 312
Target Start/End: Original strand, 19503200 - 19503263
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    |||||||| ||||||| ||| ||||||||| ||||||||||||||||||||| |||||||||||    
19503200 attaattacacaatttcaatgtattaactagtatataatttcctttttcatatccttaaccagt 19503263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 4089233 - 4089155
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtccc-ggggcaccg 326  Q
    |||||||| ||||||| |||  ||||||||||||||||||| ||||||||||||||||| ||||| ||| |||||||||    
4089233 attaattacacaatttcaatgcattaactactatataattttctttttcatacccttaatcagtgccccaggggcaccg 4089155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 32202575 - 32202647
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||| ||| |||||||| ||| |||||||    
32202575 attaattacacaatttcaatgcattaactactatataatttccttttttatatccttaacccgtgccccgggg 32202647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 42898841 - 42898905
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||| ||| ||||||||||||    
42898841 attaattacacaatttcaatgcattaactactatataatttccttttttatatccttaaccagtg 42898905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 249 - 320
Target Start/End: Original strand, 5091705 - 5091776
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggg 320  Q
    |||||||| |||||||||||||||||| || ||||||||||  |||||||||  ||||||||||| ||||||    
5091705 attaattacacaattttaatatattaattattatataattttatttttcatattcttaaccagtgccccggg 5091776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 249 - 316
Target Start/End: Original strand, 31680558 - 31680625
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcc 316  Q
    |||||||||||||||| |||  |||||||| ||| ||| || ||||||||||||||||||||||||||    
31680558 attaattatacaatttcaatgcattaactattatgtaactttctttttcatacccttaaccagtgtcc 31680625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 249 - 316
Target Start/End: Original strand, 52533880 - 52533947
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcc 316  Q
    ||||||||| |||||| | |  ||||||||||||||||||||||||||||||  ||||||||||||||    
52533880 attaattattcaatttcagtgcattaactactatataatttcctttttcatattcttaaccagtgtcc 52533947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 249 - 316
Target Start/End: Original strand, 53655973 - 53656040
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcc 316  Q
    |||||||| ||||||| |||| |||||||| ||||||||||| ||||||||| ||||||| |||||||    
53655973 attaattacacaatttcaatacattaactattatataatttcttttttcatatccttaacaagtgtcc 53656040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 29591280 - 29591208
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    ||||| || ||||||| |||  ||||||||||||||||||||||| ||||||  ||||||||||| |||||||    
29591280 attaagtacacaatttcaatgcattaactactatataatttccttattcatattcttaaccagtgccccgggg 29591208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 253 - 309
Target Start/End: Complemental strand, 52697139 - 52697083
Alignment:
253 attatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||| ||||||||| ||||||||||||||||||||  ||||||||| ||||||||    
52697139 attatataattttaatgtattaactactatataattttgtttttcatatccttaacc 52697083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 270 - 313
Target Start/End: Original strand, 1432658 - 1432701
Alignment:
270 tattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    ||||||||| ||||||||||||||||||||| ||||||||||||    
1432658 tattaactattatataatttcctttttcatatccttaaccagtg 1432701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 300
Target Start/End: Original strand, 3783596 - 3783647
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcata 300  Q
    |||||||| |||||||||||  |||||||||||||||||||| |||||||||    
3783596 attaattaaacaattttaatgcattaactactatataatttcatttttcata 3783647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 300
Target Start/End: Original strand, 30154258 - 30154309
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcata 300  Q
    |||||||| | ||||| |||| ||||||||||||||||||||||||||||||    
30154258 attaattacataatttcaatacattaactactatataatttcctttttcata 30154309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 300
Target Start/End: Complemental strand, 36395190 - 36395139
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcata 300  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||    
36395190 attaattacacaatttcaatgcattaactactatataatttcctttttcata 36395139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 312
Target Start/End: Complemental strand, 42815200 - 42815137
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    |||||||| | ||||| |||| ||||||||  |||||||||||||||||||| |||||||||||    
42815200 attaattacataatttcaatacattaactatgatataatttcctttttcatatccttaaccagt 42815137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 319
Target Start/End: Original strand, 33108768 - 33108837
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    ||||||||||| |||| |||  |||||||| |||||||||||||||||||||  ||||||||||| |||||    
33108768 attaattatactatttcaatgcattaactattatataatttcctttttcata-tcttaaccagtgccccgg 33108837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 249 - 310
Target Start/End: Complemental strand, 39843998 - 39843937
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacca 310  Q
    |||||||| | ||||| |||  |||||||||||||||||||| ||||||||| |||||||||    
39843998 attaattacataatttcaatgcattaactactatataatttcatttttcatatccttaacca 39843937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 271 - 326
Target Start/End: Original strand, 47231989 - 47232045
Alignment:
271 attaactactatataatttcctttttcatacccttaaccagtg-tcccggggcaccg 326  Q
    |||||||| ||||||||||||||||||| | |||||||||||| ||| |||||||||    
47231989 attaactattatataatttcctttttcacatccttaaccagtgctccgggggcaccg 47232045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 300
Target Start/End: Complemental strand, 46149030 - 46148979
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcata 300  Q
    |||||||| ||||||| ||| |||||| || |||||||||||||||||||||    
46149030 attaattacacaatttcaatgtattaattattatataatttcctttttcata 46148979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 320
Target Start/End: Complemental strand, 50619177 - 50619106
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggg 320  Q
    ||||| || ||||||| |||  ||||||||||||||||||| ||||||||||  ||||| ||||| ||||||    
50619177 attaagtacacaatttcaatgcattaactactatataattttctttttcatattcttaatcagtgccccggg 50619106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 54054639 - 54054561
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg-tcccggggcaccg 326  Q
    |||||||| || |||| |||  |||||||| ||||||||||| ||||||||| |||||||| |||  ||||||||||||    
54054639 attaattacactatttcaatgcattaactattatataatttcttttttcatatccttaaccggtgcccccggggcaccg 54054561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 6164184 - 6164121
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  ||||||||||||||||||| | |||| ||| ||||||||||||    
6164184 attaattacacaatttcaatgcattaactactatataattttc-ttttgatatccttaaccagtg 6164121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 50603318 - 50603254
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  ||||| || |||| ||||||||||| || ||||||||||||||    
50603318 attaattacacaatttcaatgcattaattattatacaatttccttttccacacccttaaccagtg 50603254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 57; Significance: 9e-24; HSPs: 37)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 53489919 - 53489991
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| |||||||||||  ||||||||||||||||||||||||||||||||||||||||||| |||||||    
53489919 attaattacacaattttaatgcattaactactatataatttcctttttcatacccttaaccagtgccccgggg 53489991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 7468502 - 7468430
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||||||||||| |||  |||||||||||||||||||||||||||||  ||||||||||||||||||||    
7468502 attaattatacaatttcaatgcattaactactatataatttcctttttcatttccttaaccagtgtcccgggg 7468430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 39074510 - 39074438
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||||||||||||||| |||||||    
39074510 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaaccagtgccccgggg 39074438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 52520772 - 52520700
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||||||||||||||| |||||||    
52520772 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaaccagtgccccgggg 52520700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 258 - 326
Target Start/End: Complemental strand, 52718249 - 52718181
Alignment:
258 acaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||    
52718249 acaattttaatgtattaactactatataatttcctttttcatatccttaaccagtgtccgggagcaccg 52718181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 20924083 - 20924013
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||||||||||||||| |||||    
20924083 attaattacacaatttcaatgaattaactactatataatttcctttttcatacccttaaccagtgccccgg 20924013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 10617379 - 10617456
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| |||||||||||  |||||||||||||||||||||||||| ||| |||||| |||||||| |||||||||    
10617379 attaattacacaattttaatgcattaactactatataatttccttttttatatccttaatcagtgtccgggggcaccg 10617456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 272311 - 272239
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||||| |||||||    
272311 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgccccgggg 272239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 325
Target Start/End: Original strand, 41554035 - 41554111
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcacc 325  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| ||||||||||||  ||||||||||    
41554035 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgcaccggggcacc 41554111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 43786962 - 43786892
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||||| |||||||||| |||||    
43786962 attaattacacaatttcaatgcattaactactatataatttcctttttcataccattaaccagtgccccgg 43786892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 46352725 - 46352653
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||||| ||||||||||||||||||| |||||||||||| |||||||    
46352725 attaattacacaatttcaatgcattaactactgtataatttcctttttcatatccttaaccagtgccccgggg 46352653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 49893422 - 49893350
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||| ||||||||||||||||||||| |||||||||||| |||||||    
49893422 attaattacacaatttcaatgcattaactattatataatttcctttttcatatccttaaccagtgccccgggg 49893350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 249 - 312
Target Start/End: Complemental strand, 4168274 - 4168211
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    |||||||| ||||||| |||| |||||||||||||||||||||||||| ||| |||||||||||    
4168274 attaattacacaatttcaatacattaactactatataatttccttttttatatccttaaccagt 4168211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 249 - 308
Target Start/End: Complemental strand, 13159988 - 13159929
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaac 308  Q
    |||||||| ||||||| ||| ||||||||||||||||||||||||||||||| |||||||    
13159988 attaattacacaatttcaatgtattaactactatataatttcctttttcatatccttaac 13159929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 315
Target Start/End: Complemental strand, 28139400 - 28139334
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtc 315  Q
    |||||||||||||||| |||  |||||||||||| ||||||| ||||||||| ||||||||||||||    
28139400 attaattatacaatttcaatgcattaactactatttaatttcttttttcatatccttaaccagtgtc 28139334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 319
Target Start/End: Original strand, 40362675 - 40362745
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| |||||||||||  |||||||||||||||||||| ||||||||| |||||| ||||| |||||    
40362675 attaattacacaattttaatgcattaactactatataatttcttttttcatatccttaatcagtgccccgg 40362745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 48725362 - 48725284
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg-tcccggggcaccg 326  Q
    |||||||| ||||||| |||  ||||| |||||||||||||||||||||||| ||||||||||||  ||||||||||||    
48725362 attaattacacaatttcaatgcattaattactatataatttcctttttcatatccttaaccagtgcccccggggcaccg 48725284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 52246673 - 52246603
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||||||||||| |||  |||||| ||||||||||||| ||||||||| |||||||||||| |||||    
52246673 attaattatacaatttcaatgcattaacaactatataatttcatttttcatatccttaaccagtgccccgg 52246603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 858680 - 858616
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| ||||||| ||||    
858680 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaactagtg 858616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 22248977 - 22248913
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||| | |||||||||||||||||||||||||||| ||||||| ||||    
22248977 attaattacacaatttcaatacaataactactatataatttcctttttcatatccttaactagtg 22248913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 250 - 321
Target Start/End: Complemental strand, 18014762 - 18014691
Alignment:
250 ttaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    ||||||| ||||||| |||  ||||||||||||||||||| |||||||||| |||||| ||||| |||||||    
18014762 ttaattacacaatttcaatgcattaactactatataatttactttttcatatccttaatcagtgccccgggg 18014691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 249 - 319
Target Start/End: Original strand, 42964344 - 42964414
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  ||||||||||||| |||||| ||||||||| |||||||||||| |||||    
42964344 attaattacacaatttcaatgcattaactactataaaatttcatttttcatatccttaaccagtgccccgg 42964414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 2119522 - 2119458
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    ||||||||  |||||| |||  |||||||||||||||||||||||||||||| | ||||||||||    
2119522 attaattactcaatttcaatgcattaactactatataatttcctttttcatatctttaaccagtg 2119458  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 50395657 - 50395729
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| |||||||  ||  |||||||||| |||||||| |||||||||| || |||||||||||||||||    
50395657 attaattacacaatttctatgcattaactactgtataattttctttttcatatccctaaccagtgtcccgggg 50395729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 316
Target Start/End: Complemental strand, 2505440 - 2505373
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcc 316  Q
    |||||||| ||||||| |||  | |||||||||||||||||||||||||||| | ||||||| |||||    
2505440 attaattacacaatttcaatgcactaactactatataatttcctttttcatatctttaaccaatgtcc 2505373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 300
Target Start/End: Complemental strand, 31514882 - 31514831
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcata 300  Q
    |||||||| |||||||||||| |||||||||||||||||||  |||||||||    
31514882 attaattacacaattttaatacattaactactatataattttatttttcata 31514831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 271 - 313
Target Start/End: Complemental strand, 2391676 - 2391634
Alignment:
271 attaactactatataatttcctttttcatacccttaaccagtg 313  Q
    ||||||||||||||||||||||||||| || ||||||||||||    
2391676 attaactactatataatttcctttttcttatccttaaccagtg 2391634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 271 - 313
Target Start/End: Complemental strand, 2393437 - 2393395
Alignment:
271 attaactactatataatttcctttttcatacccttaaccagtg 313  Q
    ||||||||||||||||||||||||||| || ||||||||||||    
2393437 attaactactatataatttcctttttcttatccttaaccagtg 2393395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 257 - 319
Target Start/End: Complemental strand, 41304088 - 41304026
Alignment:
257 tacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| |||  ||||| |||||||||||||||||||||||| ||||||||| || |||||    
41304088 tacaatttcaatgcattaattactatataatttcctttttcatatccttaaccactgccccgg 41304026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 271 - 319
Target Start/End: Original strand, 11308327 - 11308375
Alignment:
271 attaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||||||||||||||| | |||||| |||||||||||    
11308327 attaactattatataatttcctttttcacatccttaatcagtgtcccgg 11308375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 43269834 - 43269898
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| | ||||| |||  |||||||||||| |||||||| |||||||| ||||||||||||    
43269834 attaattacataatttcaatgcattaactactatgtaatttcccttttcatatccttaaccagtg 43269898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 325
Target Start/End: Original strand, 50359281 - 50359357
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcacc 325  Q
    ||||||||  |||||| |||  |||||||||||||||||||  |||||| || |||||||||||| | |||||||||    
50359281 attaattacccaatttcaatgcattaactactatataattttttttttcttaaccttaaccagtgccacggggcacc 50359357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 308
Target Start/End: Complemental strand, 29241728 - 29241669
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaac 308  Q
    |||||||| | ||||| |||  ||||||||||||||||||||| |||||||| |||||||    
29241728 attaattacataatttcaatgcattaactactatataatttccattttcatatccttaac 29241669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 275 - 326
Target Start/End: Original strand, 49529390 - 49529441
Alignment:
275 actactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||| |||||||||| |||||||||| |||||| ||||| ||||||||||||    
49529390 actagtatataattttctttttcatatccttaatcagtgccccggggcaccg 49529441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 296
Target Start/End: Complemental strand, 21010086 - 21010041
Alignment:
249 attaattatacaattttaatatattaactactatataatttccttttt 296  Q
    |||||||||||||||| ||| |  ||||||||||||||||||||||||    
21010086 attaattatacaatttcaatgt--taactactatataatttccttttt 21010041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 261 - 321
Target Start/End: Complemental strand, 23925359 - 23925299
Alignment:
261 attttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    ||||||||  ||||| |||||||||||||||||||| |||  ||||||||||  |||||||    
23925359 attttaatgcattaattactatataatttccttttttatattcttaaccagttccccgggg 23925299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 42548186 - 42548122
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| | ||||| |||  |||||||||||||||||||| ||||||||| | |||| |||||    
42548186 attaattacataatttcaatgcattaactactatataatttcttttttcatatctttaagcagtg 42548122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 54; Significance: 6e-22; HSPs: 37)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 28588000 - 28587923
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||| ||| |||||||||||||||||||||||||| ||||||||||||||| |||||||||    
28588000 attaattacacaatttcaatacattgactactatataatttcctttttcatatccttaaccagtgtccgggggcaccg 28587923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 34333375 - 34333303
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  ||||| ||||||||||||||||||||||||||||||||||||| |||||||    
34333375 attaattacacaatttcaatgcattaattactatataatttcctttttcatacccttaaccagtgccccgggg 34333303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 249 - 320
Target Start/End: Complemental strand, 30810746 - 30810675
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggg 320  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||||| ||||||    
30810746 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgccccggg 30810675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 309
Target Start/End: Complemental strand, 4628657 - 4628597
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||||| ||||||| ||| ||||||||||||||||||||||||||||||| ||||||||    
4628657 attaattaaacaatttcaatgtattaactactatataatttcctttttcatatccttaacc 4628597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 5239376 - 5239312
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||||| ||||||||||    
5239376 attaattacacaatttcaatgcattaactactatataatttcctttttcataccattaaccagtg 5239312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 29993582 - 29993654
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||| ||| |||||||    
29993582 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccggtgccccgggg 29993654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 43594131 - 43594203
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||||||||||| |||  |||||||| ||||||||||||||||| ||| ||||||||||||| ||||||    
43594131 attaattatacaatttcaatgcattaactattatataatttccttttttatatccttaaccagtgttccgggg 43594203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 8754680 - 8754758
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg-tcccggggcaccg 326  Q
    |||||||| ||||||| |||  |||||||||||||||||||| ||||||||| |||||||||||| |||| ||||||||    
8754680 attaattacacaatttcaatgcattaactactatataatttcatttttcatatccttaaccagtgctcccagggcaccg 8754758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 319
Target Start/End: Original strand, 11686419 - 11686489
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||| ||| ||||||||||| ||||||    
11686419 attaattacacaatttcaatgcattaactactatataatttccttttttatatccttaaccagtatcccgg 11686489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 323
Target Start/End: Original strand, 42044388 - 42044461
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggca 323  Q
    |||||||| ||||||| ||| ||||||||||||||||||||| ||||||||||| |||||| ||| |||||||||    
42044388 attaattacacaatttcaatctattaactactatataatttcttttttcatacctttaaccggtg-cccggggca 42044461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 47083146 - 47083076
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||| |||||||||||||||||||| ||||||||| |||||||| |||| ||||    
47083146 attaattacacaatttcaatacattaactactatataatttcttttttcatatccttaaccggtgttccgg 47083076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 24798498 - 24798575
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| ||| ||| |||| || |||||||||    
24798498 attaattacacaatttcaatgcattaactactatataatttcctttttcatatcctcaacaagtgcccgggggcaccg 24798575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 47839583 - 47839506
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| ||| ||||||||| ||||||| ||||||||||||| |||||||||||  |||||| |||||    
47839583 attaattacacaatttcaatgtattaactattatataaattcctttttcatatccttaaccagtaccccgggacaccg 47839506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 12218531 - 12218603
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||  |||| |||||| |||||||    
12218531 attaattacacaatttcaatgcattaactactatataatttcctttttcatatacttatccagtgccccgggg 12218603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 18486052 - 18485980
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||| ||||| |||||||||||||||||||  ||| |||||||||||| |||||||    
18486052 attaattacacaatttcaatacattaattactatataatttccttttcaatatccttaaccagtgccccgggg 18485980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 24438568 - 24438496
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| | ||||| |||  ||||||||||||||| |||||||||||||||||||||| |||| |||||||    
24438568 attaattacataatttcaatgcattaactactatatagtttcctttttcatacccttaactagtgccccgggg 24438496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 325
Target Start/End: Original strand, 27456208 - 27456284
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcacc 325  Q
    |||||||| ||||||| |||  |||||||||||||||||||| |||| |||| |||||||||||| || ||||||||    
27456208 attaattacacaatttcaatgcattaactactatataatttctttttccatatccttaaccagtgcccgggggcacc 27456284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 309
Target Start/End: Original strand, 34546409 - 34546469
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| ||||||||    
34546409 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaacc 34546469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 18117234 - 18117164
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||| |||||||||||||||||||||| |||||||  |||||| | ||||||||    
18117234 attaattacacaatttcaatacattaactactatataatttcctctttcatatacttaacaaatgtcccgg 18117164  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 34606352 - 34606282
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||  ||||||| |||  ||||| |||||||||||||||||||||||| |||||||||||| |||||    
34606352 attaatttcacaatttcaatgcattaattactatataatttcctttttcatatccttaaccagtgccccgg 34606282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 249 - 311
Target Start/End: Complemental strand, 45045861 - 45045799
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccag 311  Q
    |||||||| ||||||| |||  ||||| |||||||||||||| ||||||||||||||||||||    
45045861 attaattacacaatttcaatgcattaattactatataatttcatttttcatacccttaaccag 45045799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 260 - 309
Target Start/End: Original strand, 4100630 - 4100679
Alignment:
260 aattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||||||| ||||| |||||||||||||||||||||||| ||||||||    
4100630 aattttaatacattaattactatataatttcctttttcatatccttaacc 4100679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 309
Target Start/End: Complemental strand, 3021982 - 3021922
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||||||||||||| ||| ||||||||| ||||||||||||||||| |||  |||||||    
3021982 attaattatacaatttcaatgtattaactagtatataatttcctttttaatatgcttaacc 3021922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 261 - 313
Target Start/End: Complemental strand, 5729425 - 5729373
Alignment:
261 attttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||| |||| |||||||| ||||||||||||||||||||| ||||||||||||    
5729425 atttcaatacattaactattatataatttcctttttcatatccttaaccagtg 5729373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 47657071 - 47657007
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  ||||| ||||||||||||| |||||||||| ||||||||||||    
47657071 attaattacacaatttcaatgcattaattactatataattttctttttcatatccttaaccagtg 47657007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 273 - 319
Target Start/End: Complemental strand, 28262098 - 28262052
Alignment:
273 taactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||||||||||||||||||||||| |||||||| ||| |||||    
28262098 taactactatataatttcctttttcatatccttaaccggtgacccgg 28262052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 315
Target Start/End: Original strand, 29835799 - 29835865
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtc 315  Q
    ||||||||  ||||||||||| |||||||| ||||||| ||||||||||||| | ||||||| ||||    
29835799 attaattacgcaattttaatacattaactagtatataacttcctttttcatatctttaaccaatgtc 29835865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 249 - 310
Target Start/End: Original strand, 13064972 - 13065033
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacca 310  Q
    |||||||| |||| || |||| ||||| || ||||||||||||||||||||| |||||||||    
13064972 attaattacacaaattcaatacattaaatattatataatttcctttttcatatccttaacca 13065033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 249 - 314
Target Start/End: Original strand, 18220533 - 18220598
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgt 314  Q
    |||||||| |||||||||||| ||||| ||||||||||||| ||||||  || |||||||| ||||    
18220533 attaattacacaattttaatacattaattactatataattttctttttagtatccttaaccggtgt 18220598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 23363262 - 23363339
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  ||||||||||||| ||||||||||||| || ||||||| ||||  ||||| |||||    
23363262 attaattacacaatttcaatgcattaactactatacaatttcctttttcttatccttaacgagtgctccgggacaccg 23363339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 525170 - 525234
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||||||||||| |||  |||||||||| |||| ||| |||||||||| | ||||||||||    
525170 attaattatacaatttcaatgcattaactactgtatacttttctttttcatatctttaaccagtg 525234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 1737071 - 1737007
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| || |||| |||  |||||||| ||||||||||| ||||||||| ||||||||||||    
1737071 attaattacactatttcaatgcattaactattatataatttcatttttcatatccttaaccagtg 1737007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 296
Target Start/End: Original strand, 18470034 - 18470081
Alignment:
249 attaattatacaattttaatatattaactactatataatttccttttt 296  Q
    |||||||| ||||||| ||| |||||||| ||||||||||||||||||    
18470034 attaattacacaatttcaatgtattaactgctatataatttccttttt 18470081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 319
Target Start/End: Complemental strand, 22973670 - 22973619
Alignment:
268 tatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    ||||||||||||||||||||||| ||||| ||| | |||||||||| |||||    
22973670 tatattaactactatataatttctttttttatatcattaaccagtgccccgg 22973619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 249 - 319
Target Start/End: Original strand, 37631637 - 37631707
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| | |||||||||  ||||| || ||||||||||||||||| ||| |||||||| ||| |||||    
37631637 attaattacataattttaatgcattaattattatataatttccttttttatatccttaacccgtgccccgg 37631707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 18220626 - 18220702
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||| | ||| ||||||||||||||||||||  ||  ||||||||| | ||||||||||||    
18220626 attaattacacaatttcaatacagtaattactatataatttcctttttagtattcttaaccagcg-cccggggcaccg 18220702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 317
Target Start/End: Original strand, 7689295 - 7689363
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtccc 317  Q
    |||||||| ||||||| |||  ||||| |||| || |||||||||||| ||| |||||| |||||||||    
7689295 attaattacacaatttcaatgcattaattactgtaaaatttccttttttatatccttaatcagtgtccc 7689363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 40)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 20831648 - 20831720
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    ||||||||||| |||| |||  |||||||||||||||||||||||||||||| ||||||||||||||||||||    
20831648 attaattatactatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgtcccgggg 20831720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 30675667 - 30675739
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||||||||||||||| |||||||    
30675667 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaaccagtgccccgggg 30675739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 168557 - 168487
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||||||||||||||| |||||    
168557 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaaccagtgccccgg 168487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 11112730 - 11112660
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| ||||||||||||||||||    
11112730 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgtcccgg 11112660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 42035076 - 42035154
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg-tcccggggcaccg 326  Q
    |||||||| ||||||| |||| |||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||    
42035076 attaattacacaatttcaatacattaactactatataatttcctttttcatatccttaaccagtgctccgggggcaccg 42035154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 4648285 - 4648208
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| ||| ||||||||||||||||||||||||||||||| |||||| ||||| |||||| |||||    
4648285 attaattacacaatttcaatgtattaactactatataatttcctttttcatatccttaatcagtgccccgggacaccg 4648208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 21595937 - 21595860
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  ||||||| ||||||||||||||||||||||||||||||||||| || |||||||||    
21595937 attaattacacaatttcaatgcattaactcctatataatttcctttttcatacccttaaccagtgcccgggggcaccg 21595860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 37373296 - 37373219
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  |||||||| ||||||||||||||||||||| ||||||||||||||| |||||||||    
37373296 attaattacacaatttcaatgcattaactattatataatttcctttttcatatccttaaccagtgtccgggggcaccg 37373219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 325
Target Start/End: Complemental strand, 36730535 - 36730459
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcacc 325  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||    
36730535 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaactagtgtcctggggcacc 36730459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 250 - 321
Target Start/End: Original strand, 2805356 - 2805427
Alignment:
250 ttaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    ||||||| ||||||| |||  |||||||| ||||||||||||||||||||| ||||||||||||||||||||    
2805356 ttaattacacaatttcaatgcattaactattatataatttcctttttcatatccttaaccagtgtcccgggg 2805427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 249 - 312
Target Start/End: Original strand, 9537919 - 9537982
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    |||||||| |||||||||||  |||||||||||||||||||||||||||||| |||||||||||    
9537919 attaattacacaattttaatgcattaactactatataatttcctttttcatatccttaaccagt 9537982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 16888639 - 16888716
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||| ||| || |||||||||    
16888639 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaacctgtgcccgggggcaccg 16888716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 249 - 325
Target Start/End: Original strand, 33357224 - 33357301
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg-tcccggggcacc 325  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||||| ||| ||||||||    
33357224 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgctccgggggcacc 33357301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 245 - 321
Target Start/End: Original strand, 9253992 - 9254068
Alignment:
245 tatcattaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||||||| ||||||| |||  ||||||||||||| |||||| ||||||||| |||||||||||| |||||||    
9253992 tatcattaattacacaatttcaatgcattaactactataaaatttcatttttcatatccttaaccagtgccccgggg 9254068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 319
Target Start/End: Original strand, 27988594 - 27988664
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  |||||||| ||||||||||||||||||||| |||||||||||| |||||    
27988594 attaattacacaatttcaatgcattaactattatataatttcctttttcatatccttaaccagtgccccgg 27988664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 319
Target Start/End: Original strand, 28045896 - 28045966
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  |||||||| ||||||||||||||||||||| |||||||||||| |||||    
28045896 attaattacacaatttcaatgcattaactattatataatttcctttttcatatccttaaccagtgccccgg 28045966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 34228773 - 34228695
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg-tcccggggcaccg 326  Q
    |||||||| ||||||| |||  ||||| |||||||||||||||||||||||| ||||||||||||  ||||||||||||    
34228773 attaattacacaatttcaatgcattaattactatataatttcctttttcatatccttaaccagtgcccccggggcaccg 34228695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 12203945 - 12203868
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  |||||||||||||||||||| |||||||||||||||||| ||  || |||||||||    
12203945 attaattacacaatttcaatgcattaactactatataatttcttttttcatacccttaaccggtacccgggggcaccg 12203868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 12448373 - 12448296
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  |||||||||||||||||||| |||||||||||||||||| ||  || |||||||||    
12448373 attaattacacaatttcaatgcattaactactatataatttcttttttcatacccttaaccggtacccgggggcaccg 12448296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 16785177 - 16785100
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||| ||||||| |||||||||||| ||||||||| |||||||||||| || || ||||||    
16785177 attaattacacaatttcaatacattaactgctatataatttcttttttcatatccttaaccagtgccctggagcaccg 16785100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 310
Target Start/End: Complemental strand, 32113999 - 32113938
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacca 310  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||    
32113999 attaattaaacaatttcaatgcattaactactatataatttcctttttcatatccttaacca 32113938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 271 - 326
Target Start/End: Complemental strand, 12652699 - 12652643
Alignment:
271 attaactactatataatttcctttttcatacccttaaccagtg-tcccggggcaccg 326  Q
    |||||||||||||||||||||||||||||| |||||||||||| ||| |||||||||    
12652699 attaactactatataatttcctttttcatatccttaaccagtgctccaggggcaccg 12652643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 13643103 - 13643031
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| | ||||| |||  ||||||||||||||||||||||||||| || |||||||||||| |||||||    
13643103 attaattacataatttcaatgcattaactactatataatttcctttttcgtatccttaaccagtgccccgggg 13643031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 13743528 - 13743456
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| | ||||| |||  ||||||||||||||||||||||||||| || |||||||||||| |||||||    
13743528 attaattacataatttcaatgcattaactactatataatttcctttttcgtatccttaaccagtgccccgggg 13743456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 40831368 - 40831304
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||||||||||| |||  ||||||||||||||||||| |||||||||| | ||||||||||    
40831368 attaattatacaatttcaatgcattaactactatataattttctttttcatatctttaaccagtg 40831304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 271 - 326
Target Start/End: Original strand, 9063169 - 9063224
Alignment:
271 attaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||||||||||||||||||||||||| ||||||||||||  ||||| |||||    
9063169 attaactactatataatttcctttttcatatccttaaccagtgctccgggacaccg 9063224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 249 - 308
Target Start/End: Original strand, 16890575 - 16890634
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaac 308  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||    
16890575 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaac 16890634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 249 - 320
Target Start/End: Original strand, 29444235 - 29444306
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggg 320  Q
    |||||||| ||||||| |||   ||||||||||||||||||||||||||||| |||||| ||||| ||||||    
29444235 attaattacacaatttcaatgcgttaactactatataatttcctttttcatatccttaatcagtgccccggg 29444306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 43119308 - 43119230
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccg-gggcaccg 326  Q
    |||||||||||||||| |||  ||||||||||||||||||| |||||||||| | |||| ||||| |||| ||||||||    
43119308 attaattatacaatttcaatgcattaactactatataattttctttttcatatctttaatcagtgccccgagggcaccg 43119230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 317
Target Start/End: Complemental strand, 9278303 - 9278235
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtccc 317  Q
    |||||||| ||||||| |||  |||||||| ||||||||||||||||||||| | ||||| ||||||||    
9278303 attaattacacaatttcaatgcattaactattatataatttcctttttcatatctttaacgagtgtccc 9278235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 309
Target Start/End: Complemental strand, 28626859 - 28626799
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||| | ||||||| |||| |||||||||||||||||||||||||||| | ||||||||    
28626859 attaatcacacaatttcaatacattaactactatataatttcctttttcacatccttaacc 28626799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 319
Target Start/End: Original strand, 4537839 - 4537909
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| | ||||| |||  |||||||||||||||||||||| ||| ||| |||||||||||| |||||    
4537839 attaattacataatttcaatgcattaactactatataatttcctattttatatccttaaccagtgccccgg 4537909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 249 - 307
Target Start/End: Original strand, 7304613 - 7304671
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaa 307  Q
    |||||||| ||||||| |||  ||||||||||||||||||| |||||||||| ||||||    
7304613 attaattacacaatttcaatgcattaactactatataattttctttttcatatccttaa 7304671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 309
Target Start/End: Complemental strand, 10618109 - 10618049
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||||| ||||||| | |  ||||||||||||||||||| |||||||||| ||||||||    
10618109 attaattacacaatttaattgcattaactactatataattttctttttcatatccttaacc 10618049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 300
Target Start/End: Complemental strand, 34192866 - 34192815
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcata 300  Q
    |||||||| ||||||| |||  |||||||| |||||||||||||||||||||    
34192866 attaattacacaatttcaatgcattaactagtatataatttcctttttcata 34192815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Original strand, 16394178 - 16394228
Alignment:
271 attaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| |||||||||| |||||||| | |||||||||||| |||||||    
16394178 attaactattatataattttctttttcacatccttaaccagtgccccgggg 16394228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 249 - 307
Target Start/End: Complemental strand, 29235326 - 29235268
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaa 307  Q
    |||||||| |||| ||||||  |||||||||||||||||||| ||||| ||| ||||||    
29235326 attaattacacaaatttaatgcattaactactatataatttctttttttatatccttaa 29235268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 3930328 - 3930405
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| |||| || |||  |||||||||||||||||||||| |||||||   ||||| |||| || |||||||||    
3930328 attaattacacaacttcaatgcattaactactatataatttcctctttcatattattaactagtgcccgggggcaccg 3930405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 22956796 - 22956733
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| | ||||||||| |||||||||| |||| ||| ||||||| |||| |||||||||||    
22956796 attaattacataattttaatgtattaactaccatatgatt-ccttttttatactcttaaccagtg 22956733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 273 - 313
Target Start/End: Original strand, 36923782 - 36923822
Alignment:
273 taactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||| ||||||||||||||||||||| |||||| |||||    
36923782 taactattatataatttcctttttcatatccttaatcagtg 36923822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 46)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 51065843 - 51065915
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||| ||||||||||||||||||| |||||||||| ||||||||||||||||||||    
51065843 attaattacacaatttcaatacattaactactatataatttactttttcatatccttaaccagtgtcccgggg 51065915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 29210504 - 29210434
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  ||||||||||||||||||||||||||||||||||||||||||| |||||    
29210504 attaattacacaatttcaatgcattaactactatataatttcctttttcatacccttaaccagtgccccgg 29210434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 17333377 - 17333454
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||||| || |||||||||    
17333377 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgcccgggggcaccg 17333454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 29657862 - 29657790
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||||||||||| |||  |||||||||||||||||||||||||| ||| |||||||||||| |||||||    
29657862 attaattatacaatttcaatgcattaactactatataatttccttttttatatccttaaccagtgccccgggg 29657790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 42770085 - 42770157
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||||| |||||||||| |||||||    
42770085 attaattacacaatttcaatgcattaactactatataatttcctttttcataccattaaccagtgccccgggg 42770157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 47010084 - 47010020
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||| |||||||||||||||||||||||||||||| ||||||||||||    
47010084 attaattacacaatttcaatacattaactactatataatttcctttttcatatccttaaccagtg 47010020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 249 - 312
Target Start/End: Original strand, 15282609 - 15282672
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    |||||||| ||||||| |||||||||||||||||||||||| |||||||||| |||||||||||    
15282609 attaattacacaatttcaatatattaactactatataattttctttttcatatccttaaccagt 15282672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 14350372 - 14350450
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg-tcccggggcaccg 326  Q
    |||||||| |||||||||||  ||||||||| ||||||||||||||||||||||||||||| ||| ||| |||||||||    
14350372 attaattacacaattttaatgcattaactacaatataatttcctttttcatacccttaaccggtgctccgggggcaccg 14350450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 18043253 - 18043183
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||| |||||||||||||||| |||||    
18043253 attaattacacaatttcaatgcattaactactatataatttccttttttatacccttaaccagtgccccgg 18043183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 38162941 - 38162871
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  ||||||||||||||||||| ||||||||||||||||||||||| |||||    
38162941 attaattacacaatttcaatgcattaactactatataattttctttttcatacccttaaccagtgccccgg 38162871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 3784808 - 3784872
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| ||||||||||||    
3784808 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtg 3784872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 24178558 - 24178630
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||| ||||||||||||||||||||| |||||||||||| |||||||    
24178558 attaattacacaatttcaatgcattaactattatataatttcctttttcatatccttaaccagtgccccgggg 24178630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 249 - 320
Target Start/End: Original strand, 38702028 - 38702099
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggg 320  Q
    |||||||| | ||||| |||  ||||||||||||||| ||||||||||||||||||||||||||| ||||||    
38702028 attaattacataatttcaatgcattaactactatatagtttcctttttcatacccttaaccagtgccccggg 38702099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 249 - 312
Target Start/End: Original strand, 51368880 - 51368943
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    ||||| || ||||||| |||  ||||||||||||||||||||||||||||||||||||||||||    
51368880 attaactacacaatttcaatgcattaactactatataatttcctttttcatacccttaaccagt 51368943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 307
Target Start/End: Complemental strand, 6770428 - 6770370
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaa 307  Q
    |||||||| ||||||| |||| |||||||||||||||||||||||||||||| ||||||    
6770428 attaattacacaatttcaatacattaactactatataatttcctttttcatatccttaa 6770370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 249 - 307
Target Start/End: Complemental strand, 45431369 - 45431311
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaa 307  Q
    |||||||| ||||||| |||| |||||||||||||||||||||||||||||| ||||||    
45431369 attaattacacaatttcaatacattaactactatataatttcctttttcatatccttaa 45431311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 310
Target Start/End: Original strand, 23473559 - 23473620
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacca 310  Q
    |||||||||||||||| |||| ||||||| ||||||||| |||||||||||| |||||||||    
23473559 attaattatacaatttcaatacattaactgctatataatctcctttttcatatccttaacca 23473620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 310
Target Start/End: Original strand, 30294476 - 30294537
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacca 310  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||    
30294476 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaacca 30294537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 326
Target Start/End: Original strand, 35985716 - 35985793
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||| ||| |||||| |||||  |||||||||||    
35985716 attaattacacaatttcaatgcattaactactatataatttccttttttatatccttaaacagtgatccggggcaccg 35985793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 9266823 - 9266887
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  ||||| |||||||||||||||||||||||| ||||||||||||    
9266823 attaattacacaatttcaatgcattaaatactatataatttcctttttcatatccttaaccagtg 9266887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 12072157 - 12072229
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  ||||||||||| |||||||||||||||||| |||||||| ||| |||||||    
12072157 attaattacacaatttcaatgcattaactactacataatttcctttttcatatccttaaccggtgccccgggg 12072229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 15227830 - 15227766
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  ||||| |||||||||||||||||||||||| ||||||||||||    
15227830 attaattacacaatttcaatgcattaattactatataatttcctttttcatatccttaaccagtg 15227766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 317
Target Start/End: Complemental strand, 43286813 - 43286745
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtccc 317  Q
    |||||||| | ||||| || | |||||||| ||||||||||||||||||||| ||||||||||||||||    
43286813 attaattacataatttcaaaacattaactattatataatttcctttttcatatccttaaccagtgtccc 43286745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 271 - 326
Target Start/End: Original strand, 19011113 - 19011168
Alignment:
271 attaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||||||||||||||||||||||||||||| |||||||| ||| |||||| |||||    
19011113 attaactactatataatttcctttttcatatccttaacccgtgccccgggacaccg 19011168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 249 - 308
Target Start/End: Original strand, 19031910 - 19031969
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaac 308  Q
    |||||||| ||||||| ||| | ||||||||||||||||||||||||||||| |||||||    
19031910 attaattacacaatttcaatgttttaactactatataatttcctttttcatatccttaac 19031969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 245 - 308
Target Start/End: Original strand, 47532761 - 47532824
Alignment:
245 tatcattaattatacaattttaatatattaactactatataatttcctttttcatacccttaac 308  Q
    |||||||||||| ||||||| |||  ||||||||||||||||||| |||||||||| |||||||    
47532761 tatcattaattacacaatttcaatgcattaactactatataattttctttttcatatccttaac 47532824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 249 - 311
Target Start/End: Complemental strand, 3097750 - 3097688
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccag 311  Q
    |||||||| | ||||| |||  |||||||||||||||||||||||||||||| ||||||||||    
3097750 attaattacataatttcaatgcattaactactatataatttcctttttcatatccttaaccag 3097688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 5694412 - 5694342
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||| ||||||| |||  ||||||||||||||||||||| |||| ||| |||||||||||| |||||    
5694412 attaattacacaatttcaatgcattaactactatataatttccctttttatatccttaaccagtgccccgg 5694342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 249 - 307
Target Start/End: Complemental strand, 39497398 - 39497340
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaa 307  Q
    |||||||||| |||||||||  ||||||||||||||||||| |||||||||| ||||||    
39497398 attaattatataattttaatgcattaactactatataattttctttttcatatccttaa 39497340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 249 - 310
Target Start/End: Original strand, 8473009 - 8473070
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacca 310  Q
    |||||||| |||||||||||  |||||||| ||||||||||||||||| ||| |||||||||    
8473009 attaattacacaattttaatgcattaactattatataatttccttttttatatccttaacca 8473070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 321
Target Start/End: Original strand, 3838872 - 3838944
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| |||||||||||  |||||||| |||||||||||||||||  ||  ||||||||||||| |||||    
3838872 attaattacacaattttaatgcattaactattatataatttcctttttagtatgcttaaccagtgtcgcgggg 3838944  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 317
Target Start/End: Complemental strand, 38335260 - 38335192
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtccc 317  Q
    |||||||| ||||||  |||  ||||| |||||||||||||||||||||||| | ||||||||||||||    
38335260 attaattacacaattacaatgcattaattactatataatttcctttttcatatctttaaccagtgtccc 38335192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 312
Target Start/End: Original strand, 35700745 - 35700808
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    |||||||| ||||||| ||| ||||||||||| |||||||||||||||  || |||||||||||    
35700745 attaattacacaatttcaatgtattaactactgtataatttcctttttagtatccttaaccagt 35700808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 249 - 312
Target Start/End: Complemental strand, 48071573 - 48071510
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagt 312  Q
    |||||||| ||||||| |||  |||||||| |||||||||||||||| |||| |||||||||||    
48071573 attaattacacaatttcaatgcattaactattatataatttccttttacatatccttaaccagt 48071510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 255 - 310
Target Start/End: Complemental strand, 52749687 - 52749632
Alignment:
255 tatacaattttaatatattaactactatataatttcctttttcatacccttaacca 310  Q
    |||||||||| |||| |||||||| ||||||||||||||||||||| | |||||||    
52749687 tatacaatttcaatacattaactattatataatttcctttttcatatctttaacca 52749632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 260 - 313
Target Start/End: Original strand, 10976008 - 10976061
Alignment:
260 aattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||||  ||||||||||||||||| |||||||||||| ||||||| ||||    
10976008 aattttaatgcattaactactatataatctcctttttcatatccttaacaagtg 10976061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 29683287 - 29683214
Alignment:
249 attaattatacaattttaatatattaactactatataatttcct-ttttcatacccttaaccagtgtcccgggg 321  Q
    ||||||||||| |||| |||  |||||||||||||||||||||| |||| ||| | |||||||||| |||||||    
29683287 attaattatacgatttcaatgcattaactactatataatttcctttttttatatctttaaccagtgccccgggg 29683214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 249 - 294
Target Start/End: Complemental strand, 37503305 - 37503260
Alignment:
249 attaattatacaattttaatatattaactactatataatttccttt 294  Q
    |||||||| ||||||| ||| |||||||||||||||||||||||||    
37503305 attaattacacaatttcaatgtattaactactatataatttccttt 37503260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 36446420 - 36446483
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||| |||  |||||||||||    
36446420 attaattacacaatttcaatgcattaactactatataatttccttttt-atattcttaaccagtg 36446483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 274 - 321
Target Start/End: Original strand, 14881086 - 14881133
Alignment:
274 aactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    ||||| ||||||||||||||||||||| ||||||||||| || |||||    
14881086 aactattatataatttcctttttcatatccttaaccagtatcacgggg 14881133  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 249 - 320
Target Start/End: Complemental strand, 30657699 - 30657628
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggg 320  Q
    |||||||| | ||||| |||  |||||||||||||||||||| |||||||||  |||||| |||| ||||||    
30657699 attaattacataatttcaatgcattaactactatataatttcttttttcatatgcttaactagtgccccggg 30657628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 249 - 307
Target Start/End: Original strand, 50128267 - 50128325
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaa 307  Q
    |||||||| ||||||| |||  |||||||||||| |||||| |||||||||| ||||||    
50128267 attaattacacaatttcaatgcattaactactatgtaattttctttttcatatccttaa 50128325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 250 - 323
Target Start/End: Original strand, 45449340 - 45449413
Alignment:
250 ttaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggca 323  Q
    ||||||| || ||||||||  ||||||||||||||||||| |||||| ||| | ||||||| |  |||||||||    
45449340 ttaattacactattttaatgcattaactactatataattttcttttttatatctttaaccaataccccggggca 45449413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 13961302 - 13961231
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||||||||||||||  ||||| ||| |||||||| ||| |||||||    
13961302 attaattacacaatttcaatgcattaactactatataattt-tttttttatatccttaacccgtgccccgggg 13961231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 26228284 - 26228220
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| | ||||| |||  |||||||||||||||||||| ||||| ||  ||||||||||||    
26228284 attaattacataatttcaatgcattaactactatataatttcattttttatctccttaaccagtg 26228220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 39081892 - 39081828
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||||| ||||| |||| |||||||| ||||||||||| |||||  ||  |||||||||||    
39081892 attaattataaaatttcaatacattaactagtatataatttcatttttagtatgcttaaccagtg 39081828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0674 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold0674
Description:

Target: scaffold0674; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 249 - 323
Target Start/End: Original strand, 7992 - 8066
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggca 323  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||||| || ||||||    
7992 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgcccgggggca 8066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0549 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold0549
Description:

Target: scaffold0549; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 249 - 323
Target Start/End: Complemental strand, 7379 - 7305
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggca 323  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| |||||||||||| || ||||||    
7379 attaattacacaatttcaatgcattaactactatataatttcctttttcatatccttaaccagtgcccgggggca 7305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0264 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: scaffold0264
Description:

Target: scaffold0264; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 249 - 326
Target Start/End: Complemental strand, 23052 - 22974
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg-tcccggggcaccg 326  Q
    |||||||| ||||||| ||| |||||| |||||||||||||||||||||||| |||||||||||| ||| |||||||||    
23052 attaattacacaatttcaatgtattaattactatataatttcctttttcatatccttaaccagtgctccgggggcaccg 22974  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045 (Bit Score: 47; Significance: 8e-18; HSPs: 2)
Name: scaffold0045
Description:

Target: scaffold0045; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 249 - 319
Target Start/End: Complemental strand, 50639 - 50569
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgg 319  Q
    |||||||||||||||| || | |||||||||||||||||||||||||||||| | |||||||||| |||||    
50639 attaattatacaatttcaaaacattaactactatataatttcctttttcatatctttaaccagtgccccgg 50569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0045; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 249 - 315
Target Start/End: Original strand, 53441 - 53507
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtc 315  Q
    |||||||||||||||| |||  |||||||||||||||||||||||||| ||| ||||||||||||||    
53441 attaattatacaatttcaatgcattaactactatataatttccttttttatatccttaaccagtgtc 53507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0206 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0206
Description:

Target: scaffold0206; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 250 - 325
Target Start/End: Original strand, 11066 - 11140
Alignment:
250 ttaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcacc 325  Q
    ||||||| ||||||| |||  |||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||    
11066 ttaattacacaatttcaatgcattaactaatatataatttcctttttcatatccttaaccagtgt-ccggggcacc 11140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0014 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0014
Description:

Target: scaffold0014; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 258 - 321
Target Start/End: Original strand, 68394 - 68457
Alignment:
258 acaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||||||  |||||||||||||||||||| ||||||||| |||||||||||| |||||||    
68394 acaattttaatgcattaactactatataatttcatttttcatatccttaaccagtgccccgggg 68457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 249 - 308
Target Start/End: Original strand, 147000 - 147059
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaac 308  Q
    |||||||| ||||||| ||| ||||||||||||||||||||||||||||||| |||||||    
147000 attaattacacaatttcaatgtattaactactatataatttcctttttcatatccttaac 147059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 69317 - 69253
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| | ||||||||| |||||||||||||||||||| |||||||||| ||||||| ||||    
69317 attaattacataattttaatgtattaactactatataatttactttttcatatccttaacgagtg 69253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 313
Target Start/End: Original strand, 33776 - 33840
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| ||| ||||||||| |||||||||||| |||| |||  |||||| ||||    
33776 attaattacacaatttcaatgtattaactattatataatttccattttaatatacttaacaagtg 33840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0021 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0021
Description:

Target: scaffold0021; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 249 - 321
Target Start/End: Complemental strand, 116295 - 116223
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| | |||||| ||| |||||||    
116295 attaattacacaatttcaatgcattaactactatataatttcctttttcatatctttaacctgtgccccgggg 116223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0188 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0188
Description:

Target: scaffold0188; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 250 - 326
Target Start/End: Original strand, 6206 - 6283
Alignment:
250 ttaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtccc-ggggcaccg 326  Q
    ||||||| ||||||  |||  ||||||||||||||| |||||||||||||| |||||||||||| ||| |||||||||    
6206 ttaattacacaattccaatgcattaactactatatagtttcctttttcatatccttaaccagtgccccaggggcaccg 6283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1152 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold1152
Description:

Target: scaffold1152; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 309
Target Start/End: Complemental strand, 769 - 709
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||||| ||||||| |||  |||||||||||||||||||||||||||||| | ||||||    
769 attaattacacaatttcaatggattaactactatataatttcctttttcatatctttaacc 709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0524 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: scaffold0524
Description:

Target: scaffold0524; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 249 - 313
Target Start/End: Complemental strand, 916 - 852
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtg 313  Q
    |||||||| ||||||| |||  ||||||||||||||||||| |||||||||| ||||||| ||||    
916 attaattacacaatttcaatgcattaactactatataattttctttttcatatccttaactagtg 852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1266 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: scaffold1266
Description:

Target: scaffold1266; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 253 - 326
Target Start/End: Complemental strand, 379 - 306
Alignment:
253 attatacaattttaatatattaactactatataatttcctttttcatacccttaaccagtgtcccggggcaccg 326  Q
    |||| ||||||| |||  |||||||| |||||||||| ||||||||||  ||||||||||| || |||||||||    
379 attacacaatttcaatgcattaactattatataattttctttttcatatgcttaaccagtgccctggggcaccg 306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 249 - 309
Target Start/End: Complemental strand, 25809 - 25750
Alignment:
249 attaattatacaattttaatatattaactactatataatttcctttttcatacccttaacc 309  Q
    |||||||| ||||||| |||| ||||| |||||||||| ||||||||||||| ||||||||    
25809 attaattacacaatttcaatacattaattactatataa-ttcctttttcatatccttaacc 25750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0190 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0190
Description:

Target: scaffold0190; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 271 - 321
Target Start/End: Complemental strand, 14965 - 14915
Alignment:
271 attaactactatataatttcctttttcatacccttaaccagtgtcccgggg 321  Q
    |||||||||||||||||||| ||||| ||| | |||||||||| |||||||    
14965 attaactactatataatttctttttttatatctttaaccagtgccccgggg 14915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0533 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0533
Description:

Target: scaffold0533; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 249 - 289
Target Start/End: Complemental strand, 5130 - 5090
Alignment:
249 attaattatacaattttaatatattaactactatataattt 289  Q
    |||||||| ||||||| |||| |||||||||||||||||||    
5130 attaattacacaatttcaataaattaactactatataattt 5090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126357 times since January 2019
Visitors: 1390