View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E09 (Length: 701)

Name: R108-tnk507-E09
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E09
R108-tnk507-E09
[»] chr3 (6 HSPs)
chr3 (92-297)||(19329329-19329535)
chr3 (101-198)||(19467557-19467654)
chr3 (462-568)||(23384535-23384643)
chr3 (214-297)||(19356372-19356455)
chr3 (4-91)||(19467437-19467524)
chr3 (462-568)||(22096985-22097094)
[»] scaffold0015 (1 HSPs)
scaffold0015 (412-580)||(184892-185063)
[»] chr8 (2 HSPs)
chr8 (412-580)||(27353217-27353388)
chr8 (416-498)||(36737766-36737848)
[»] chr6 (2 HSPs)
chr6 (412-557)||(24162125-24162271)
chr6 (422-537)||(14478761-14478876)
[»] chr7 (3 HSPs)
chr7 (432-539)||(12188641-12188748)
chr7 (425-500)||(27952170-27952245)
chr7 (441-557)||(12695967-12696084)
[»] chr2 (2 HSPs)
chr2 (416-568)||(29226432-29226587)
chr2 (416-568)||(29339731-29339886)


Alignment Details
Target: chr3 (Bit Score: 139; Significance: 2e-72; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 92 - 297
Target Start/End: Original strand, 19329329 - 19329535
Alignment:
92 agcgagtacatggattggtatatgagaaatacccgaaagttcatagggaggcctatttctctgtcacccgggtttcggagaatggtaagaatatgtttca 191  Q
    |||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| ||| ||||| ||||| |||||| ||||||||||    
19329329 agcgagtacatggattggtatatgagaattacccgcaagttcatagggaggcctatttctctgtcatccgagtttcagagaacggtaaggatatgtttca 19329428  T
192 tgagtttaag-tttatatatcttgtagcaatcatagattaagtttgaaatgctttttatagaaaataaacaaatgcttgcagaatgttggtccgagagat 290  Q
     |||||| || |||||||||||||||||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||| ||||| |||||||    
19329429 ggagttttagttttatatatcttgtagcaatgatagatgaagtttgaaatgcttttaatagaaaataaacaaatgcttgcagaatgctggtctgagagat 19329528  T
291 atcgcac 297  Q
    || ||||    
19329529 attgcac 19329535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 101 - 198
Target Start/End: Original strand, 19467557 - 19467654
Alignment:
101 atggattggtatatgagaaatacccgaaagttcatagggaggcctatttctctgtcacccgggtttcggagaatggtaagaatatgtttcatgagttt 198  Q
    |||||||||||| ||||||||||  | || ||||||||||||||||||||||  ||  ||| ||||| |||||||||||| |||||||||||||||||    
19467557 atggattggtatgtgagaaatacgtgcaaattcatagggaggcctatttctccatcctccgagtttctgagaatggtaaggatatgtttcatgagttt 19467654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 462 - 568
Target Start/End: Complemental strand, 23384643 - 23384535
Alignment:
462 aactatgaatgtggaaccagtcctaagcncaaaatttacatcataaantcnaaacnaaaacatgatcgtctatgaacc-cncctaacncncttctttgc- 559  Q
    ||||||||||||| ||| |||||||| | | |||||||||||||||| |  |||  |||||||||||||||||||||| | |||||| | |||||||||     
23384643 aactatgaatgtgaaacaagtcctaaacaccaaatttacatcataaaattaaaaaaaaaacatgatcgtctatgaaccacacctaacacacttctttgca 23384544  T
560 agtagatga 568  Q
    |||||||||    
23384543 agtagatga 23384535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 214 - 297
Target Start/End: Original strand, 19356372 - 19356455
Alignment:
214 gtagcaatcatagattaagtttgaaatgctttttatagaaaataaacaaatgcttgcagaatgttggtccgagagatatcgcac 297  Q
    ||||||||||||||| |||||||||||| ||| ||||||| ||| ||| |||||||||||||| ||||| |||| |||| ||||    
19356372 gtagcaatcatagatgaagtttgaaatgatttatatagaagatacacacatgcttgcagaatgctggtctgagaaatattgcac 19356455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 4 - 91
Target Start/End: Original strand, 19467437 - 19467524
Alignment:
4 ttatcctcaacatttggagcgacattttgaattgttggacttattttcacctaaatgtttcacgattgatttccatttgttcttagat 91  Q
    ||||||||| || | |||||  ||||||| | ||||||| ||| ||||||||||||||| |||||||||||||| |||||||||||||    
19467437 ttatcctcagcactcggagcagcattttgcaatgttggagttactttcacctaaatgttgcacgattgatttccttttgttcttagat 19467524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 462 - 568
Target Start/End: Complemental strand, 22097094 - 22096985
Alignment:
462 aactatgaatgtggaaccagtcctaagcncaaaatttacatcat-aaantcnaaacnaaaacatgatcgtctatgaacc-cncctaacncncttctttgc 559  Q
    ||||||||||||| ||| |||||||||| | ||||||||||||| ||| || |||| ||||||||| |||||||| ||| | | |||| | |||||||||    
22097094 aactatgaatgtgaaacaagtcctaagcaccaaatttacatcataaaattcaaaacaaaaacatgaacgtctatgtaccacacttaacacacttctttgc 22096995  T
560 -agtagatga 568  Q
     |||||||||    
22096994 aagtagatga 22096985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 104; Significance: 2e-51; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 412 - 580
Target Start/End: Complemental strand, 185063 - 184892
Alignment:
412 caattgtaattgcgcgggcaagcatgaagccttccactaatctaagcacaaactatgaatgtggaaccagtcctaagcncaaaatttacatcataaa-nt 510  Q
    |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||  |    
185063 caattgtaattgcgcgggcaagcatgaagccttctacttatctaagcacaaactatgaatgtgaaaccagtcctaagcacaaaatttacatcataaattt 184964  T
511 cnaaacnaaaacatgatcgtctatgaacc-cncctaacncncttctttgc-agtagatgaaaccacgcnata 580  Q
    | |||| |||||||||||||||||||||| | |||||| | ||||||||| ||||||||| || |||| |||    
184963 caaaacaaaaacatgatcgtctatgaaccacacctaacacacttctttgcaagtagatgagacaacgcaata 184892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 104; Significance: 2e-51; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 412 - 580
Target Start/End: Complemental strand, 27353388 - 27353217
Alignment:
412 caattgtaattgcgcgggcaagcatgaagccttccactaatctaagcacaaactatgaatgtggaaccagtcctaagcncaaaatttacatcataaa-nt 510  Q
    |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||  |    
27353388 caattgtaattgcgcgggcaagcatgaagccttctactgatctaagcacaaactatgaatgtgaaaccagtcctaagcacaaaatttacatcataaattt 27353289  T
511 cnaaacnaaaacatgatcgtctatgaacc-cncctaacncncttctttgc-agtagatgaaaccacgcnata 580  Q
    | |||| |||||||||||||||||||||| | |||||| | ||||||||| ||||||||| || |||| |||    
27353288 caaaacaaaaacatgatcgtctatgaaccacacctaacacacttctttgcaagtagatgagacaacgcaata 27353217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 416 - 498
Target Start/End: Original strand, 36737766 - 36737848
Alignment:
416 tgtaattgcgcgggcaagcatgaagccttccactaatctaagcacaaactatgaatgtggaaccagtcctaagcncaaaattt 498  Q
    ||||| || ||||||||||||||||   |||||||||| |||||||||||||||||||| ||| |||||||||| ||| ||||    
36737766 tgtaaatgtgcgggcaagcatgaagttctccactaatccaagcacaaactatgaatgtgaaacaagtcctaagcacaagattt 36737848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 78; Significance: 6e-36; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 412 - 557
Target Start/End: Original strand, 24162125 - 24162271
Alignment:
412 caattgtaattgcgcgggcaagcatgaagccttccactaatctaagcacaaactatgaatgtggaaccagtcctaagcncaaaatttacatcataaantc 511  Q
    ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||| ||| |     
24162125 caattgtaattgcgcgggcaaccatgaagtcttccactaatctaagcacaaactatgaatgtgaaacaagtcctaagcacaaaatttacatcacaaagtt 24162224  T
512 naaacnaaaacatgatcgtctatgaacc-cncctaacncncttcttt 557  Q
     |||  | |||||||  ||||||||||| | |||||| | |||||||    
24162225 caaatcacaacatgactgtctatgaaccacacctaacacacttcttt 24162271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 422 - 537
Target Start/End: Complemental strand, 14478876 - 14478761
Alignment:
422 tgcgcgggcaagcatgaagccttccactaatctaagcacaaactatgaatgtggaaccagtcctaagcncaaaatttacatcat-aaantcnaaacnaaa 520  Q
    |||||||||||||||||||   || | ||||| ||| |||| ||||||||||| ||| |||||||||| |||| |||||||||| ||| || |||| |||    
14478876 tgcgcgggcaagcatgaagttctctattaatccaagtacaa-ctatgaatgtgaaacaagtcctaagcacaaagtttacatcataaaattcaaaacaaaa 14478778  T
521 acatgatcgtctatgaa 537  Q
    |||||||||||||||||    
14478777 acatgatcgtctatgaa 14478761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 60; Significance: 3e-25; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 432 - 539
Target Start/End: Complemental strand, 12188748 - 12188641
Alignment:
432 agcatgaagccttccactaatctaagcacaaactatgaatgtggaaccagtcctaagcncaaaatttacatcataaantcnaaacnaaaacatgatcgtc 531  Q
    ||||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||| ||| |  |||  | |||||||  |||    
12188748 agcatgaagtcttccactaatctaagcacaaactatgaatgtgaaacaagtcctaagcacaaaatttacatcacaaagttcaaatcacaacatgactgtc 12188649  T
532 tatgaacc 539  Q
    ||||||||    
12188648 tatgaacc 12188641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 425 - 500
Target Start/End: Original strand, 27952170 - 27952245
Alignment:
425 gcgggcaagcatgaagccttccactaatctaagcacaaactatgaatgtggaaccagtcctaagcncaaaatttac 500  Q
    |||||||||||||||| |||||| |||||||| ||||||||||||||||| ||| |||||||||| ||||||||||    
27952170 gcgggcaagcatgaagtcttccattaatctaaccacaaactatgaatgtgaaacaagtcctaagcacaaaatttac 27952245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 441 - 557
Target Start/End: Original strand, 12695967 - 12696084
Alignment:
441 ccttccactaatctaagcacaaactatgaatgtggaaccagtcctaagcncaaaatttacatcataaantcnaaacnaaaacatgatcgtctatgaacc- 539  Q
    ||||||||  |||||||||||||||||||||||| ||| |||||||||| |||||||||||||| ||| |  |||  | |||||||  |||||||||||     
12695967 ccttccacctatctaagcacaaactatgaatgtgaaacaagtcctaagcacaaaatttacatcacaaaattcaaatcacaacatgactgtctatgaacca 12696066  T
540 cncctaacncncttcttt 557  Q
    | |||||| | |||||||    
12696067 cacctaacacacttcttt 12696084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 47; Significance: 2e-17; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 416 - 568
Target Start/End: Complemental strand, 29226587 - 29226432
Alignment:
416 tgtaattgcgcgggcaagcatgaagccttccactaatctaagcacaaactatgaatgtggaaccagtcctaagcncaaaatttacatcat-aaantcnaa 514  Q
    ||||| |||| |||||||||||||| | |||||| ||||||||| |||||||||||||| ||  |||||||||| |||||| |||||| | ||| || ||    
29226587 tgtaaatgcgtgggcaagcatgaagtcatccactcatctaagcataaactatgaatgtgaaataagtcctaagcacaaaatatacatcctaaaattcaaa 29226488  T
515 acnaaaacatgatcgtctatgaacc-cncctaacncncttctttgc-agtagatga 568  Q
    |   ||||||||   |||||||||| | |||||| | ||||||||| |||||||||    
29226487 atataaacatgactatctatgaaccacacctaacacacttctttgcaagtagatga 29226432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 416 - 568
Target Start/End: Complemental strand, 29339886 - 29339731
Alignment:
416 tgtaattgcgcgggcaagcatgaagccttccactaatctaagcacaaactatgaatgtggaaccagtcctaagcncaaaatttacatcat-aaantcnaa 514  Q
    ||||| |||| |||||||||||||| | |||||| ||||||||| |||||||||||||| ||  |||||||||| |||||| |||||| | ||| || ||    
29339886 tgtaaatgcgtgggcaagcatgaagtcatccactcatctaagcataaactatgaatgtgaaataagtcctaagcacaaaatatacatcctaaaattcaaa 29339787  T
515 acnaaaacatgatcgtctatgaacc-cncctaacncncttctttgc-agtagatga 568  Q
    |   ||||||||   |||||||||| | |||||| | ||||||||| |||||||||    
29339786 atataaacatgactatctatgaaccacacctaacacacttctttgcaagtagatga 29339731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111083 times since January 2019
Visitors: 1335