View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E10 (Length: 349)

Name: R108-tnk507-E10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E10
R108-tnk507-E10
[»] chr8 (2 HSPs)
chr8 (1-157)||(43551186-43551342)
chr8 (159-237)||(43551001-43551077)


Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 43551186 - 43551342
Alignment:
1 atgtcaaacactaacatcttccctttgctttcattgacaatataataaggtaacaaaatttgggtgcagagaacctttttatataatgataggcagagaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
43551186 atgtcaaacactaacatcttccctttgctttcattgacaatataataaggtaacaaaatttgggttcagagaacctttttatataatgataggcagagaa 43551285  T
101 aatcagagtaagaaatccatgtaatttgtgatattttcttcttgtcattcttgaatt 157  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
43551286 aatcagagtaagaaatcaatgtaatttgtgatattttcttcttgtcattcttgaatt 43551342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 159 - 237
Target Start/End: Original strand, 43551001 - 43551077
Alignment:
159 accaaatatactatatatggnttggtgccaatctcagtagtacgnggggaaattngaagcattatacaaaattacaacg 237  Q
    |||||| | ||||||||||| ||| ||||||||||||| ||||| | | ||||| ||||||||||||||||||||||||    
43551001 accaaacacactatatatggtttg-tgccaatctcagtggtacgtgtg-aaatttgaagcattatacaaaattacaacg 43551077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110409 times since January 2019
Visitors: 1335