View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E11 (Length: 218)

Name: R108-tnk507-E11
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E11
R108-tnk507-E11
[»] chr8 (3 HSPs)
chr8 (153-218)||(33003577-33003642)
chr8 (1-60)||(33003638-33003697)
chr8 (56-104)||(33003519-33003567)


Alignment Details
Target: chr8 (Bit Score: 66; Significance: 2e-29; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 153 - 218
Target Start/End: Original strand, 33003577 - 33003642
Alignment:
153 actttagcatttaaattcaaagtttggtacatggcattttaaaatgttgggtttcaaggtaagttt 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33003577 actttagcatttaaattcaaagtttggtacatggcattttaaaatgttgggtttcaaggtaagttt 33003642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 33003638 - 33003697
Alignment:
1 agtttcttctaaacaccaagtgtgctataaattagtttcaaatgtcaatatcatcaattg 60  Q
    ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||    
33003638 agtttcttcaaaacaccaagtgtgccataaattagtttcaaatgtcaatatcatcaattg 33003697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 33003519 - 33003567
Alignment:
56 aattggtcatggcttttaaaattttgacatttaattcaatataatctca 104  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||    
33003519 aattggtcatggcttttaaaattttgatatttaattcaatataatctca 33003567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108407 times since January 2019
Visitors: 1329