View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E15 (Length: 456)

Name: R108-tnk507-E15
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E15
R108-tnk507-E15
[»] chr3 (4 HSPs)
chr3 (115-456)||(53694891-53695226)
chr3 (290-455)||(53685746-53685913)
chr3 (1-85)||(53695222-53695306)
chr3 (6-85)||(53685919-53685997)


Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 115 - 456
Target Start/End: Original strand, 53694891 - 53695226
Alignment:
115 tatatgtggaggtaagaatacagtttgagggggtatgagacgagaattttccatccttttctggagaatgccatatctgacccaaaccgcacagtccatt 214  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
53694891 tatatgtggaggtaagaatacagtttgagggggtatgagacgagaattttccatccttttctggagaatgccatatctgacccaaacagcacagtccatt 53694990  T
215 aggcattagcatagctgtccttcccatctcatcactgtgtagtgtacagtgagagtgcgtcagaaagaacctcttgtatttttaacatagaagtcaaaac 314  Q
    ||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||    
53694991 aggcattagcatagctgtccttcccatctcatcactgtgtag-----agtgagagtgcgtcagaaagaacctcttgtatttttaacatagaagtcaaaac 53695085  T
315 ctcttctccataaaacttcatctccaattttggtgagccattgtaacattcctttgcatgccacttaaatttcgtttttggagttatctttgctttaatc 414  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53695086 ctcttctccataaaacttcatctccaattttggtgagtcattgtaacattcctttgcatgccacttaaatttcgtttttggagttatctttgctttaatc 53695185  T
415 acattcctttaattatgttgacatgttttaagggtttctatg 456  Q
    |||||||||||||||||| |||||||||| ||||||||||||    
53695186 acattcctttaattatgtagacatgtttt-agggtttctatg 53695226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 290 - 455
Target Start/End: Original strand, 53685746 - 53685913
Alignment:
290 gtatttttaacatagaagtcaaaacctcttctccataaaacttcatctccaattttggtg---agccattgtaacattcctttgcatgccacttaaattt 386  Q
    |||||||||||||||| ||||||||||||||||||||||||||||| | |||||||||||   || || ||||| ||||||||||||||| || ||||||    
53685746 gtatttttaacatagacgtcaaaacctcttctccataaaacttcatattcaattttggtggtgagtcagtgtaatattcctttgcatgccgctcaaattt 53685845  T
387 cgtttttggagttatctttgctttaatcacattcctttaattatgttgacatgttttaagggtttctat 455  Q
    || ||||||||||||||||| ||||||||||||||||| ||||||| |||||||||| |||||||||||    
53685846 cgattttggagttatctttgttttaatcacattcctttgattatgtagacatgtttt-agggtttctat 53685913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 53695222 - 53695306
Alignment:
1 ctatggatttaggtttctctgcttttgtttgtttcaatgttttgtattttctttggatcacaaaatctaactatattattgaatt 85  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53695222 ctatggatttaggtttctctgcttttgtttgtttcaatgttttgtattttctttggatcacaaaatctaactatattattgaatt 53695306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 6 - 85
Target Start/End: Original strand, 53685919 - 53685997
Alignment:
6 gatttaggtttctctgcttttgtttgtttcaatgttttgtattttctttggatcacaaaatctaactatattattgaatt 85  Q
    ||||||||||| |||||||||| |||||||||||||||||  | ||||||||||||||||||||||||||| ||||||||    
53685919 gatttaggtttatctgcttttggttgtttcaatgttttgt-ctctctttggatcacaaaatctaactatatcattgaatt 53685997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 362051 times since January 2019
Visitors: 488