View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E26 (Length: 537)

Name: R108-tnk507-E26
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E26
R108-tnk507-E26
[»] chr6 (2 HSPs)
chr6 (1-272)||(34000698-34000971)
chr6 (354-482)||(34001040-34001170)


Alignment Details
Target: chr6 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 34000698 - 34000971
Alignment:
1 gaaagcaccactttgaaaaagttcatgattattatctgctttgagttataggtagtggatcaaagatattttttaaaaattaatttactacac--acacc 98  Q
    |||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||  |||||    
34000698 gaaagcaccactttgaaaaaattcatgattattatctgcttttagttataggtagtggatcaaagatattttttaaaaattaatttactacacacacacc 34000797  T
99 atcaaatacttcgagttatactgttaggaaaaatactttgagttatagtttaacacattatctttaaatacaacctcttattagatttcaaatgatgtta 198  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||    
34000798 atcaaatacttcgagttatactgttaagaaaaatactttgagttatagtttaacacattatctttaaatataacatcttattagatttcaaatgatgtta 34000897  T
199 caattagatataccatcaaacaagataaaaaatactccattaatatatttaattgcatgcactgatctggatct 272  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
34000898 caattagatataccatcaaacaagataaaaaatactccattaatatatttaattgcatgcactgatcgggatct 34000971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 91; E-Value: 8e-44
Query Start/End: Original strand, 354 - 482
Target Start/End: Original strand, 34001040 - 34001170
Alignment:
354 aggtactctgatacgtttgtgtacatttgcaaatttccgcgtacaattacgtggaagtatcacgaattggtttgcgtgaaacaattcatgattctccgga 453  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||  |    
34001040 aggtactctgatacgtttgtgtacatttgcaaatttccgcgaacaattacgtggaagtatcacgaattggtttgcgtgaaacaattcgtgattctccata 34001139  T
454 agg-aattatg-ttcatatttcagttggtaa 482  Q
     || ||||| | |||||||||||||||||||    
34001140 gggtaattacgtttcatatttcagttggtaa 34001170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 204464 times since January 2019
Visitors: 1518