View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: R108-tnk507-E30 (Length: 132)
Name: R108-tnk507-E30
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] R108-tnk507-E30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 8e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 8e-25
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 3078115 - 3078047
Alignment:
Q |
1 |
gtttaccggctcggtgatggattggcgtt--gtgtggaggcggcgtttctttatttgggaggaacaatt |
67 |
Q |
|
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
3078115 |
gtttaccggctcggtgatggattggcgttttgtgtggaggcggcgtttctttatttgggaggaacaatt |
3078047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 64 - 123
Target Start/End: Complemental strand, 3078327 - 3078268
Alignment:
Q |
64 |
aattcctcaagatggtggaaggatttagttagtattgaaggaagagatgggtcgcattgg |
123 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
3078327 |
aattcctcaagatggtggaaggatttagttagtattgaaggaagagatgggtcgtattgg |
3078268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 360812 times since January 2019
Visitors: 487