View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E30 (Length: 132)

Name: R108-tnk507-E30
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E30
R108-tnk507-E30
[»] chr6 (2 HSPs)
chr6 (1-67)||(3078047-3078115)
chr6 (64-123)||(3078268-3078327)


Alignment Details
Target: chr6 (Bit Score: 58; Significance: 8e-25; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 8e-25
Query Start/End: Original strand, 1 - 67
Target Start/End: Complemental strand, 3078115 - 3078047
Alignment:
1 gtttaccggctcggtgatggattggcgtt--gtgtggaggcggcgtttctttatttgggaggaacaatt 67  Q
    |||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||    
3078115 gtttaccggctcggtgatggattggcgttttgtgtggaggcggcgtttctttatttgggaggaacaatt 3078047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 64 - 123
Target Start/End: Complemental strand, 3078327 - 3078268
Alignment:
64 aattcctcaagatggtggaaggatttagttagtattgaaggaagagatgggtcgcattgg 123  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
3078327 aattcctcaagatggtggaaggatttagttagtattgaaggaagagatgggtcgtattgg 3078268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360812 times since January 2019
Visitors: 487