View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E31 (Length: 771)

Name: R108-tnk507-E31
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E31
R108-tnk507-E31
[»] chr5 (2 HSPs)
chr5 (347-771)||(12643038-12643462)
chr5 (1-352)||(12642681-12643042)
[»] chr4 (1 HSPs)
chr4 (351-466)||(24146366-24146482)


Alignment Details
Target: chr5 (Bit Score: 315; Significance: 1e-177; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 347 - 771
Target Start/End: Complemental strand, 12643462 - 12643038
Alignment:
347 caattggttccttctacgagcagtatcatcatctccttgttgaaaaccatgttccataaattccaaatattgtgagcttttagatgagttgtcatcaaaa 446  Q
    |||||||| ||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12643462 caattggtcccttctacgagtagtatcatcaactccttgttgaaaaccatgttccataaattccaaatattgtgagcttttagatgagttgtcatcaaaa 12643363  T
447 gttcccaataactaaaatcttttgttccttacacactcaaactatatatatannnnnnngttttcccctcacattgtaggacctaacctgctgtgatatc 546  Q
    ||||||||||||||||||||||||||||||||||||||||||||| | | |        |||||||||||||||||||||||||||||||||||||||||    
12643362 gttcccaataactaaaatcttttgttccttacacactcaaactatttttttttttttttgttttcccctcacattgtaggacctaacctgctgtgatatc 12643263  T
547 aatttgatatcagtaagacataaatcactcaaactcatacactaattatgtatctgggannnnnnnnnnnnnnnnnnnttttacaacaacactatatttt 646  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                   ||||||||||||||||||||||    
12643262 aatttgatatcagtaagacataaatcactcaaactcatacactaattatgtatctgggaaagaagagagaagaagagattttacaacaacactatatttt 12643163  T
647 cattcacaaattgatttgcaatattgattcatgaaaggttattagcatagtcttttataggcttagttacttaatacttaagaaaagaaagtcttatatg 746  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
12643162 cattcacaaattgatttgcaatattgattcatgaaaggttattagcatagtcttttataggcttagttacttaatacttaagaaaagcaagtcttatatg 12643063  T
747 cttagaaagtaaacggcggtgctgc 771  Q
    |||||||||||||||||||||||||    
12643062 cttagaaagtaaacggcggtgctgc 12643038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 352
Target Start/End: Complemental strand, 12643042 - 12642681
Alignment:
1 gctgcatcacggtgcttacaggatcatgagaccttaatgcctaagcaaaaaccttaatggctaaggataatacaacatttttctttggtccgaaaaacac 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||    
12643042 gctgcatcgcggtgcttacaggatcatgagaccttaatgcctaagcaaaaaccttaatggctaaggataatgcaacgtttttctttggtccgaaaaacac 12642943  T
101 ttcctatgctcagtgccattctcaattcttctagatagtttggtttaatatccaaaagagaaggatgaagcctcatgttgccactaccatgatcgctagt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12642942 ttcctatgctcagtgccattctcaattcttctagatagtttggtttaatatccaaaagagaaggatgaagcctcatgttgccactaccatgatcgctagt 12642843  T
201 atcaaacaggtcaaattgctatcaa----------agaacacaagttatatggttgttctgaagttgtagatcagactatatgattttaagttgtgggct 290  Q
    |||||||||||||||||||||||||          ||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||    
12642842 atcaaacaggtcaaattgctatcaaagaaggataaagaacacaagttatatgattgttctgaagctgtagatcagactatatgattttaagttgtgggct 12642743  T
291 gcaaccgcagttgcagcagtaatatcagagattttgaagtttctatgacaacatcgcaattg 352  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12642742 gcgaccgcagttgcagcagtaatatcagagattttgaagtttctatgacaacatcgcaattg 12642681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 351 - 466
Target Start/End: Complemental strand, 24146482 - 24146366
Alignment:
351 tggttccttctacgagcagtatcatcatctccttgttgaaaaccatgttccataaat-tccaaatattgtgagcttttagatgagttgtcatcaaaagtt 449  Q
    |||| |||||||||||||   |||||| |||||||||| ||||||   || | |||  |||| || ||||||||||| ||||| |||||||||| || ||    
24146482 tggtcccttctacgagcaagttcatcagctccttgttgtaaaccaaactcaacaaagctccatatgttgtgagctttaagatgtgttgtcatcataaatt 24146383  T
450 cccaataactaaaatct 466  Q
    |||||||||| ||||||    
24146382 cccaataactgaaatct 24146366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105825 times since January 2019
Visitors: 1319