View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E32 (Length: 343)

Name: R108-tnk507-E32
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E32
R108-tnk507-E32
[»] chr2 (5 HSPs)
chr2 (30-219)||(6667463-6667652)
chr2 (98-208)||(28922365-28922474)
chr2 (98-196)||(14456257-14456355)
chr2 (148-196)||(14456373-14456421)
chr2 (98-223)||(21922330-21922453)
[»] chr3 (4 HSPs)
chr3 (98-208)||(15291472-15291582)
chr3 (97-188)||(48909782-48909873)
chr3 (98-208)||(49235426-49235536)
chr3 (149-208)||(15996379-15996438)
[»] chr7 (1 HSPs)
chr7 (98-219)||(48850726-48850847)
[»] chr5 (1 HSPs)
chr5 (98-208)||(22780008-22780118)
[»] chr4 (1 HSPs)
chr4 (98-196)||(7810070-7810169)
[»] chr8 (2 HSPs)
chr8 (151-208)||(4966451-4966509)
chr8 (151-208)||(9888950-9889008)


Alignment Details
Target: chr2 (Bit Score: 151; Significance: 7e-80; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 30 - 219
Target Start/End: Complemental strand, 6667652 - 6667463
Alignment:
30 tggatattcatttgcatggaaaacacgaagagaggtatgntggaaataantatttgtgtgggaaagctaaagtggaatgctgattaggattagcatttag 129  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||    
6667652 tggatattcatttgcatggaaaacacgaagagaggtatgttggaaatagttatttgtgtgggaaagctaaagtggaatgctgattaggattagcatttag 6667553  T
130 aaagagttaatgctaatgcaatggagggaaaaattaggtttggattagggtaaataatagtttgaccngacaagctttanaacgnaagat 219  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| ||||||  |||||||||| || | |||||    
6667552 aaagagttaatgctaatgcaatggagggaaaaattaggttaggattagggtaaacaatagcttgaccaaacaagctttagaaagaaagat 6667463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 98 - 208
Target Start/End: Original strand, 28922365 - 28922474
Alignment:
98 aaagtggaatgctgattaggattagcatttagaaagagttaatgctaatgcaatggagggaaaaattaggtttggattagggtaaataatagtttgaccn 197  Q
    |||||||||||||||||||||||| || |||||| || ||||||||||  ||||||| ||||||||||||||  |||||||||||| ||||| ||||||     
28922365 aaagtggaatgctgattaggattaccacttagaatga-ttaatgctaacacaatggatggaaaaattaggttaagattagggtaaacaatagcttgacca 28922463  T
198 gacaagcttta 208  Q
    |||| ||||||    
28922464 gacatgcttta 28922474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 98 - 196
Target Start/End: Original strand, 14456257 - 14456355
Alignment:
98 aaagtggaatgctgattaggattagcatttagaaagagttaatgctaatgcaatggagggaaaaattaggtttggattagggtaaataatagtttgacc 196  Q
    ||||||||||| ||||||||| || || |||||| || |||||||||   |||||||||||||||||||  ||| |||||||||||| |||| ||||||    
14456257 aaagtggaatgttgattaggaataccacttagaaggatttaatgctatcacaatggagggaaaaattagagttgaattagggtaaatgatagcttgacc 14456355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 148 - 196
Target Start/End: Original strand, 14456373 - 14456421
Alignment:
148 caatggagggaaaaattaggtttggattagggtaaataatagtttgacc 196  Q
    |||||||||||||||||||| ||| |||||||||||| |||| ||||||    
14456373 caatggagggaaaaattagggttgaattagggtaaatgatagcttgacc 14456421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 98 - 223
Target Start/End: Complemental strand, 21922453 - 21922330
Alignment:
98 aaagtggaatgctgattaggattagcatttagaaagagttaatgctaatgcaatggagggaaaa-attaggtttggattagggtaaataatagtttgacc 196  Q
    ||||||||||||||||||||| | ||| |||||   ||||||||||||    | |||||||||| ||||||||  ||||||||||| | |||| |||| |    
21922453 aaagtggaatgctgattaggaattgcacttaga---agttaatgctaagattaaggagggaaaatattaggttaagattagggtaagttatagcttgatc 21922357  T
197 ngacaagctttanaacgnaagatgttg 223  Q
     ||||||||||| || | || ||||||    
21922356 agacaagctttagaaagaaaaatgttg 21922330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 72; Significance: 1e-32; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 98 - 208
Target Start/End: Complemental strand, 15291582 - 15291472
Alignment:
98 aaagtggaatgctgattaggattagcatttagaaagagttaatgctaatgcaatggagggaaaaattaggtttggattagggtaaataatagtttgaccn 197  Q
    ||||||||||| ||||||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||  |||||||||||| ||||| ||||||     
15291582 aaagtggaatgttgattaggattagcacttagaaggagttaatgctaatacaatggagggaaaaattaggttaagattagggtaaacaatagcttgacca 15291483  T
198 gacaagcttta 208  Q
     ||||||||||    
15291482 aacaagcttta 15291472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 97 - 188
Target Start/End: Original strand, 48909782 - 48909873
Alignment:
97 taaagtggaatgctgattaggattagcatttagaaagagttaatgctaatgcaatggagggaaaaattaggtttggattagggtaaataata 188  Q
    ||||||||||||||||||||||||||||||||||| |||||||  ||||| ||||| ||||||||||||||||  |||||||||||| ||||    
48909782 taaagtggaatgctgattaggattagcatttagaaggagttaacactaatacaatgaagggaaaaattaggttaagattagggtaaacaata 48909873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 98 - 208
Target Start/End: Original strand, 49235426 - 49235536
Alignment:
98 aaagtggaatgctgattaggattagcatttagaaagagttaatgctaatgcaatggagggaaaaattaggtttggattagggtaaataatagtttgaccn 197  Q
    ||||||||||||||||||||| || || ||| ||||| |||||| ||   ||||||||| ||||||||   ||| |||||||||||| |||| ||||||     
49235426 aaagtggaatgctgattaggaataccacttaaaaagatttaatgttatcacaatggaggaaaaaattaatgttgaattagggtaaatgatagcttgacca 49235525  T
198 gacaagcttta 208  Q
     |||| |||||    
49235526 aacaaacttta 49235536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 149 - 208
Target Start/End: Original strand, 15996379 - 15996438
Alignment:
149 aatggagggaaaaattaggtttggattagggtaaataatagtttgaccngacaagcttta 208  Q
    |||| |||||||||||||||| | ||||||||||| ||||| |||| | |||||||||||    
15996379 aatgcagggaaaaattaggttagaattagggtaaacaatagcttgatcagacaagcttta 15996438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 98 - 219
Target Start/End: Complemental strand, 48850847 - 48850726
Alignment:
98 aaagtggaatgctgattaggattagcatttagaaagagttaatgctaatgcaatggagggaaaaattaggtttggattagggtaaataatagtttgaccn 197  Q
    |||||| |||||||||||||||||||| |||||| |||||||||||||   |||||||||||||||||||||  |||||||||||| ||||| |||| |     
48850847 aaagtgaaatgctgattaggattagcacttagaaggagttaatgctaacataatggagggaaaaattaggttaagattagggtaaacaatagcttgatca 48850748  T
198 gacaagctttanaacgnaagat 219  Q
    ||||||||||| || | |||||    
48850747 gacaagctttagaaagaaagat 48850726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 64; Significance: 6e-28; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 98 - 208
Target Start/End: Original strand, 22780008 - 22780118
Alignment:
98 aaagtggaatgctgattaggattagcatttagaaagagttaatgctaatgcaatggagggaaaaattaggtttggattagggtaaataatagtttgaccn 197  Q
    |||||| ||||||||||| |||||||| |||||| |||||||||||||  ||||||||||||||||||||||  |||||||||||| ||||| |||| |     
22780008 aaagtgaaatgctgattatgattagcacttagaaggagttaatgctaacacaatggagggaaaaattaggttaagattagggtaaacaatagcttgatca 22780107  T
198 gacaagcttta 208  Q
    |||||||||||    
22780108 gacaagcttta 22780118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 98 - 196
Target Start/End: Complemental strand, 7810169 - 7810070
Alignment:
98 aaagtggaatgctgattaggattagcattta--gaaagagttaatgctaatgcaatggagggaaaaattaggtttggattagggtaaataatagtttgac 195  Q
    ||||||||||| ||||||||||||||| |||  ||| |||||||| | ||  ||||||||||||||||||||||  |||||||||||| ||||| |||||    
7810169 aaagtggaatgttgattaggattagcacttatagaaggagttaatccgaaa-caatggagggaaaaattaggttaagattagggtaaacaatagcttgac 7810071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 151 - 208
Target Start/End: Complemental strand, 4966509 - 4966451
Alignment:
151 tggagggaaaaattaggtttgga-ttagggtaaataatagtttgaccngacaagcttta 208  Q
    |||||||||| ||||||||| || |||||||||| ||||| |||||| |||||||||||    
4966509 tggagggaaatattaggtttagaattagggtaaacaatagcttgaccagacaagcttta 4966451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 151 - 208
Target Start/End: Original strand, 9888950 - 9889008
Alignment:
151 tggagggaaaaattaggtttgga-ttagggtaaataatagtttgaccngacaagcttta 208  Q
    |||||||||| ||||||||| || |||||||||| ||||| |||||| |||||||||||    
9888950 tggagggaaatattaggtttagaattagggtaaacaatagcttgaccagacaagcttta 9889008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108470 times since January 2019
Visitors: 1329