View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E33 (Length: 1366)

Name: R108-tnk507-E33
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E33
R108-tnk507-E33
[»] chr8 (3 HSPs)
chr8 (1-566)||(31243393-31243958)
chr8 (948-1366)||(31242979-31243397)
chr8 (831-953)||(31244194-31244316)
[»] scaffold0094 (2 HSPs)
scaffold0094 (948-1206)||(9690-9948)
scaffold0094 (948-1180)||(9958-10190)
[»] chr7 (2 HSPs)
chr7 (948-1195)||(17214989-17215236)
chr7 (948-1188)||(17215270-17215510)
[»] chr6 (3 HSPs)
chr6 (1165-1366)||(7206452-7206653)
chr6 (1-91)||(7206649-7206739)
chr6 (198-252)||(7206789-7206843)


Alignment Details
Target: chr8 (Bit Score: 411; Significance: 0; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 411; E-Value: 0
Query Start/End: Original strand, 1 - 566
Target Start/End: Original strand, 31243393 - 31243958
Alignment:
1 cttatttcgttcacaatcccagggatccttacatcttcaagaacccggctcacactgctaggatcaaaaactatgttcgacagctcttgactgttggtta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||  |||||||||||||||||||||||    
31243393 cttatttcgttcacaatcccagggatccttacatcttcaagaacccggatcacactgctaggatcaaaaactatgcccgacagctcttgactgttggtta 31243492  T
101 aaatactccacatcacatcaggattcaaaactaggcactgcagatccggtgtgcttagaaattctcttaaaaagtgaggattaatggaagcatgtattgg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
31243493 aaatactccacatcacatcaggattcaaaactaggcactgcagatccggtgtgcttagaaattctcttaaaaagtgaggattaatggaagcatgtagtgg 31243592  T
201 atggcagagctgcattggttcaaaatcttgaaatccttccccaagtaagccatccctctcaccatcagcatcaatgtccatatcgttggtcccatcattt 300  Q
    ||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
31243593 atggcagagctgcattggttcaaaatctgaaaatccttccccaagtaagccatccctctcaccatcagcatcaatgtccatattgttggtcccatcattt 31243692  T
301 gcatcggtgggtgcaaaacaacgaaccaaatagacagtatgatttggccccaaacctatagattacaaatgtaattcancatagttttgcaaaatagaaa 400  Q
    | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||| |||||||||||||||    
31243693 gtatcggtgggtgcataacaacgaaccaaatagacagtatgatttggccccaaacctatagattacaaatgtagttcaacatag-tttgcaaaatagaaa 31243791  T
401 agtttaaatgtagtcaaatgttgcgtattaaagcatcaccctaatagacgaaagaataattcacaaaataggcgaagtactcaaatatggtttagcatta 500  Q
    ||||||||||| || || ||||| |||||||||||||| ||||||||| |||||||||||||||||||||| ||||||| ||||||||| ||||||||||    
31243792 agtttaaatgtggtgaagtgttgtgtattaaagcatca-cctaatagatgaaagaataattcacaaaatagacgaagtattcaaatatgttttagcatta 31243890  T
501 cnat-aaaganatangcaangtggc-aatcgaanccanaaactaattaaaccattttaccttggaccc 566  Q
      || ||||| |||  ||| ||  | |||| || ||| |||||| ||||||||||||| |||| ||||    
31243891 acataaaagatataaacaatgttccaaatcaaaaccagaaactagttaaaccattttatcttgtaccc 31243958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 403; E-Value: 0
Query Start/End: Original strand, 948 - 1366
Target Start/End: Original strand, 31242979 - 31243397
Alignment:
948 tcaattgcaccaccattagtcacaatatggtaaatttttagttactccaagccttagaagcattacttagacataagcactgtactatttatagttacaa 1047  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31242979 tcaattgcaccaccattagtcacaatatggtaaatttttagttactccaagccttagaagcattacttagacataagcactgtactatttatagttacaa 31243078  T
1048 attactataataatcagacttaaaaatatattttttaaaaaacaaatttgttaacaagagatgtttattgtcgagtaaaaatattctagtgttagaactt 1147  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||| |||||||||||||||||||||    
31243079 attactataataatcagacttaaaaatatattttttaaaaaacaaatttgttaacaagagatgtcaattgtcgagtaacaatattctagtgttagaactt 31243178  T
1148 acatccagtaaaagaccaaggattgggaagtggagtagtatttggtaacgaagaaccagcatttgtttcactaccatttgactgatccctggcttggttt 1247  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31243179 acatccagtaaaagaccagggattgggaagtggagtagtatttggtaacgaagaaccagcatttgtttcactaccatttgactgatccctggcttggttt 31243278  T
1248 tcatagattcctgcagcgacattttcttctacaatgtcttcataaatgtacctcaactggtttaatcccccaggaatagattcaatgctgcccagttcga 1347  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31243279 tcatagattcctgcagcgacattttcttctacaatgtcttcataaatgtacctcaactggtttaatcccccaggaatagattcaatgctgcccagttcga 31243378  T
1348 ggtcagctagtctccttat 1366  Q
    |||||||||||||||||||    
31243379 ggtcagctagtctccttat 31243397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 111; E-Value: 2e-55
Query Start/End: Original strand, 831 - 953
Target Start/End: Original strand, 31244194 - 31244316
Alignment:
831 ttaggaaattttctctttaagcatattcttttcatatatataccaaaaatggttcatgcatgcacaaccaaatttcccaacacctgcgacacagtcccat 930  Q
    |||| ||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31244194 ttagaaaattttctctttaagcatattcttttcatatatattacaaaaatggttcatgcatgcacaaccaaatttcccaacacctgcgacacagtcccat 31244293  T
931 gcaaaattatggttaattcaatt 953  Q
    |||||||||||||||||||||||    
31244294 gcaaaattatggttaattcaatt 31244316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0094 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: scaffold0094
Description:

Target: scaffold0094; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 948 - 1206
Target Start/End: Original strand, 9690 - 9948
Alignment:
948 tcaattgcaccaccattagtcacaatatggtaaatttttagttactccaagccttagaagcattacttagacataagcactgtactatttatagttacaa 1047  Q
    |||||| || ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
9690 tcaattacaacaccattagtcacaatatggtaaatttatagttactccaagccttagaagcattacttagacataagcaccgtactatttatagttacaa 9789  T
1048 attactataataatcagacttaaaaatatattttttaaaaaacaaatttgttaacaagagatgtttattgtcgagtaaaaatattctagtgttagaactt 1147  Q
    |||||||||||||| ||||||||||| ||||||||| ||||||||||  |||||||| | ||||  |||||||||||| |||||||||||||||||||||    
9790 attactataataataagacttaaaaacatatttttttaaaaacaaataagttaacaaaatatgtcgattgtcgagtaacaatattctagtgttagaactt 9889  T
1148 acatccagtaaaagaccaaggattgggaagtggagtagtatttggtaacgaagaaccag 1206  Q
    || ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||    
9890 acttcctgtaaaagatcaaggattgggaagtggagtagtatttggtaacgaagaaccag 9948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0094; HSP #2
Raw Score: 165; E-Value: 1e-87
Query Start/End: Original strand, 948 - 1180
Target Start/End: Complemental strand, 10190 - 9958
Alignment:
948 tcaattgcaccaccattagtcacaatatggtaaatttttagttactccaagccttagaagcattacttagacataagcactgtactatttatagttacaa 1047  Q
    |||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
10190 tcaattacaacaccattagtcacaatatggtaaatttatagttactccaagccttagaagcattacttagacataagcattgtactatttatagttacaa 10091  T
1048 attactataataatcagacttaaaaatatattttttaaaaaacaaatttgttaacaagagatgtttattgtcgagtaaaaatattctagtgttagaactt 1147  Q
    |||||||||||||||||||||||||| ||| |||| |||||| ||||  |||||||||||||||  |||||||||||| |||||||||||||||||||||    
10090 attactataataatcagacttaaaaagataattttaaaaaaagaaataagttaacaagagatgtcgattgtcgagtaacaatattctagtgttagaactt 9991  T
1148 acatccagtaaaagaccaaggattgggaagtgg 1180  Q
    || ||  |||||||| |||||||||||||||||    
9990 acttcttgtaaaagagcaaggattgggaagtgg 9958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 176; Significance: 4e-94; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 176; E-Value: 4e-94
Query Start/End: Original strand, 948 - 1195
Target Start/End: Original strand, 17214989 - 17215236
Alignment:
948 tcaattgcaccaccattagtcacaatatggtaaatttttagttactccaagccttagaagcattacttagacataagcactgtactatttatagttacaa 1047  Q
    |||||| || ||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||    
17214989 tcaattacaacaccattagtcacaatatggtaaatttatagttattccaagccttagaagcattacttagacataagcaatgtattatttatagttacaa 17215088  T
1048 attactataataatcagacttaaaaatatattttttaaaaaacaaatttgttaacaagagatgtttattgtcgagtaaaaatattctagtgttagaactt 1147  Q
    |||||||||||||| ||||||||||| ||||||||||||||||||||  ||||||||||||| |  |||||||||||| |||||||||||||||||||||    
17215089 attactataataattagacttaaaaagatattttttaaaaaacaaataagttaacaagagatatcgattgtcgagtaacaatattctagtgttagaactt 17215188  T
1148 acatccagtaaaagaccaaggattgggaagtggagtagtatttggtaa 1195  Q
    || ||| |||||||||||||||||||| ||||||| ||||||||||||    
17215189 acttcctgtaaaagaccaaggattggggagtggaggagtatttggtaa 17215236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 153; E-Value: 2e-80
Query Start/End: Original strand, 948 - 1188
Target Start/End: Complemental strand, 17215510 - 17215270
Alignment:
948 tcaattgcaccaccattagtcacaatatggtaaatttttagttactccaagccttagaagcattacttagacataagcactgtactatttatagttacaa 1047  Q
    |||||| || ||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |||    
17215510 tcaattacaacaccattagtcacaatatgataaatttatagttactccaagccttagaagcattacttagatataaacactgtactatttatagtttcaa 17215411  T
1048 attactataataatcagacttaaaaatatattttttaaaaaacaaatttgttaacaagagatgtttattgtcgagtaaaaatattctagtgttagaactt 1147  Q
    |||||||||||||| ||||||||||||||| ||||| ||||||||||  |||||||| ||||||  ||| | || ||| |||||||||||||||||||||    
17215410 attactataataattagacttaaaaatatagtttttgaaaaacaaataagttaacaacagatgtcgatttttgaataacaatattctagtgttagaactt 17215311  T
1148 acatccagtaaaagaccaaggattgggaagtggagtagtat 1188  Q
    || ||| |||||||||||||||||||| |||||||||||||    
17215310 acttcctgtaaaagaccaaggattggggagtggagtagtat 17215270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 142; Significance: 7e-74; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 142; E-Value: 7e-74
Query Start/End: Original strand, 1165 - 1366
Target Start/End: Original strand, 7206452 - 7206653
Alignment:
1165 aaggattgggaagtggagtagtatttggtaacgaagaaccagcatttgtttcactaccatttgactgatccctggcttggttttcatagattcctgcagc 1264  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||| | |||||||||||||||||    
7206452 aaggattgggaagtggagtagtatttggtaaggaagaaccagcatttgtttcactactagttgactgatccctggcttggctgtcatagattcctgcagc 7206551  T
1265 gacattttcttctacaatgtcttcataaatgtacctcaactggtttaatcccccaggaatagattcaatgctgcccagttcgaggtcagctagtctcctt 1364  Q
    |||||||||||||||||| |||||||||||||||||||||  ||| ||||||| ||||||||||| || | ||| |||||||||||| ||||||||||||    
7206552 gacattttcttctacaatatcttcataaatgtacctcaacgagttgaatcccctaggaatagatttaacgatgctcagttcgaggtccgctagtctcctt 7206651  T
1365 at 1366  Q
    ||    
7206652 at 7206653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 63; E-Value: 1e-26
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 7206649 - 7206739
Alignment:
1 cttatttcgttcacaatcccagggatccttacatcttcaagaacccggctcacactgctaggatcaaaaactatgttcgacagctcttgac 91  Q
    |||||||| | ||| ||||||||||||||| |||||||| ||||||||||||||||| ||||||||||||||||| |||||||||||||||    
7206649 cttatttcatgcacgatcccagggatccttgcatcttcacgaacccggctcacactgttaggatcaaaaactatgctcgacagctcttgac 7206739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 39; E-Value: 0.000000000002
Query Start/End: Original strand, 198 - 252
Target Start/End: Original strand, 7206789 - 7206843
Alignment:
198 tggatggcagagctgcattggttcaaaatcttgaaatccttccccaagtaagcca 252  Q
    |||||| ||| |||||||||||||||||||| ||||||||||||||| |||||||    
7206789 tggatgacagcgctgcattggttcaaaatctggaaatccttccccaactaagcca 7206843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 312699 times since January 2019
Visitors: 445