View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E35 (Length: 644)

Name: R108-tnk507-E35
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E35
R108-tnk507-E35
[»] chr5 (7 HSPs)
chr5 (1-507)||(31760914-31761425)
chr5 (227-496)||(31749520-31749791)
chr5 (276-496)||(31767678-31767900)
chr5 (274-477)||(31753333-31753537)
chr5 (4-190)||(31749266-31749463)
chr5 (1-80)||(31768182-31768261)
chr5 (5-71)||(31753879-31753945)
[»] chr3 (1 HSPs)
chr3 (302-340)||(27887869-27887907)


Alignment Details
Target: chr5 (Bit Score: 370; Significance: 0; HSPs: 7)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 370; E-Value: 0
Query Start/End: Original strand, 1 - 507
Target Start/End: Complemental strand, 31761425 - 31760914
Alignment:
1 gtcgtatcatgcgccgatattttagctatagctgctcgagactctgttgccattgtaagtctttcaaatatttttcacttctaaacaaggttttaatttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31761425 gtcgtatcatgcgccgatattttagctatagctgctcgagactctgttgccattgtaagtctttcaaatatttttcacttctaaacaaggttttaatttg 31761326  T
101 tgtaaccacggttgtttcagaaaatataaaagattttaaggtctata----accgcaattttgaatacatagactgcatttaaccgcgatcaaaactgaa 196  Q
    ||||||||| ||||||||||||||||||||||||||| |||||||||    ||||||||||||||||||||||||||||||||||| |||||||||||||    
31761325 tgtaaccacagttgtttcagaaaatataaaagattttgaggtctatatataaccgcaattttgaatacatagactgcatttaaccg-gatcaaaactgaa 31761227  T
197 atttcgactactatannnnnnnnattggtaaatttggagtagtatatataaccctagaaactaagaaattttgctttcatcaattaacagctgggtggta 296  Q
    ||||||| || ||||        |||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||    
31761226 atttcgagtagtatattttttttattggtgaatttggagtagtatatataaccctagcaactaagaaattttgctttcatcatttaacagctgggtggta 31761127  T
297 agcaatattggtaccaagtgttactaggaagaagagattcaagatttgcaagcagggatgcagcaaatacnaatcttcctcctccatttttcaatttctc 396  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
31761126 agcaatattggtaccaagtgttactaggaagaagagattcaagatttgcaagcagggatgcagcaaatacaaatcttcctcctccatttttcaatttctc 31761027  T
397 acanctcatcacaaatttcaggtcgcatggactaanccttaaggacttagttggtctctctggnggccac-caattgga-tttcccaatgcnctaacttt 494  Q
    ||| |||||||||||||||| ||| |||||||| | |||||| |||||||||| ||| ||||| |||||| |||||||| ||||| ||||| ||||||||    
31761026 acaactcatcacaaatttcaagtctcatggacttaaccttaaagacttagttgttctatctggtggccacacaattggattttccaaatgcactaacttt 31760927  T
495 agggacnggatct 507  Q
    || ||| ||||||    
31760926 agagacaggatct 31760914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 169; E-Value: 3e-90
Query Start/End: Original strand, 227 - 496
Target Start/End: Original strand, 31749520 - 31749791
Alignment:
227 aatttggagtagtatatataaccctagaaactaagaaattttgctttcatcaattaacagctgggtggtaagcaatattggtaccaagtgttactaggaa 326  Q
    ||||| || |||| ||| |||| |||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
31749520 aatttcgaatagtgtatgtaacactagcaactaagaaattttgctttcatcatttaacagctgggtggtaagcaatattggtaccaagtgttactaggaa 31749619  T
327 gaagagattcaagatttgcaagcagggatgcagcaaatacnaatcttcctcctccatttttcaatttctcacanctcatcacaaatttcaggtcgcatgg 426  Q
    ||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| || || |||||||| ||||||| |||||||| ||| |||||    
31749620 gaagagattcaagatttgcaagcagagatgcagcaaatacaaatcttcctcctccattctttaacttctcacaactcatcaaaaatttcaagtcacatgg 31749719  T
427 actaanccttaaggacttagttggtctctctggnggccac-caattgga-tttcccaatgcnctaactttag 496  Q
    ||||| ||||||||||||||||| ||| ||||| || ||| |||||||| ||||| ||||| ||||||||||    
31749720 actaaaccttaaggacttagttgttctatctggtggacacacaattggattttccaaatgcactaactttag 31749791  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 276 - 496
Target Start/End: Complemental strand, 31767900 - 31767678
Alignment:
276 tcaattaacagctgggtggtaagcaatattggtaccaagtgttactaggaagaagagattcaagatttgcaagcagggatgcagcaaatacnaatcttcc 375  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
31767900 tcaattaacagttgggtggtaagcaatattggtaccaagtgttactaggaagaagagattcaagatttgcaagcagggatgcagcaaatacaaatcttcc 31767801  T
376 tcctccatttttcaatttctcacanctcatcacaaatttcaggtcgcatggactaanccttaaggacttagttggtctctctggnggccac-caattgga 474  Q
    ||||||||| || || |||||||| |||||||||||||||| ||| |||||||||| |||||| || ||||||| ||| ||||| || ||| ||||||||    
31767800 tcctccattctttaacttctcacaactcatcacaaatttcaagtcacatggactaaaccttaaagatttagttgttctatctggtggtcacacaattgga 31767701  T
475 -tttcccaatgcnctaactttag 496  Q
     ||||| ||||| ||||||||||    
31767700 ttttccaaatgcactaactttag 31767678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 274 - 477
Target Start/End: Complemental strand, 31753537 - 31753333
Alignment:
274 catcaattaacagctgggtggtaagcaatattggtaccaagtgttactaggaagaagagattcaagatttgcaagcagggatgcagcaaatacnaatctt 373  Q
    ||||||||||||| |||| ||| |  |||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||  ||||||    
31753537 catcaattaacagttgggcggtcacaaatattggtaccaagtgttactgggcagaagagattcaagatttgcaagcagagatgcagcaaatataaatctt 31753438  T
374 cctcctccatttttcaatttctcacanctcatcacaaatttcaggtcgcatggactaanccttaaggacttagttggtctctctggnggccac-caattg 472  Q
    || ||  ||||||| || |||||||| |||||| |||||||   ||| || ||||||| |||||| |||||||||| ||| ||||| || ||| ||||||    
31753437 ccaccggcattttttaacttctcacaactcatcgcaaattttcagtctcaaggactaaaccttaaagacttagttgttctatctggtggtcacacaattg 31753338  T
473 gattt 477  Q
    |||||    
31753337 gattt 31753333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 4 - 190
Target Start/End: Original strand, 31749266 - 31749463
Alignment:
4 gtatcatgcgccgatattttagctatagctgctcgagactctgttgccattgtaagtctttcaaatatttttcacttctaaacaaggttttaatttgtgt 103  Q
    |||||||| || ||||||||||||||||| |||||||| || |||||||| ||||||||||| |||||||| ||||||||||||||||||||| |||  |    
31749266 gtatcatgtgcagatattttagctatagcagctcgagattccgttgccatagtaagtctttccaatattttgcacttctaaacaaggttttaaattgcat 31749365  T
104 aaccac----ggttgtttcaga-------aaatataaaagattttaaggtctataaccgcaattttgaatacatagactgcatttaaccgcgatcaaa 190  Q
    ||||||      ||||| ||||        ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||    
31749366 aaccacaatatattgttgcagacttgcagcaatataaaagattttgaggtctataaccgcaattttgaatacatcgactgcatttaaccgcgatcaaa 31749463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 1 - 80
Target Start/End: Complemental strand, 31768261 - 31768182
Alignment:
1 gtcgtatcatgcgccgatattttagctatagctgctcgagactctgttgccattgtaagtctttcaaatatttttcactt 80  Q
    ||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |||||    
31768261 gtcgtatcatgtgccgatattttagctatagcagctcgagactctgttgccattgtaagtctttccaatattttgcactt 31768182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 5 - 71
Target Start/End: Complemental strand, 31753945 - 31753879
Alignment:
5 tatcatgcgccgatattttagctatagctgctcgagactctgttgccattgtaagtctttcaaatat 71  Q
    ||||||| || ||||| ||||||||||| |||||||| ||||||||||| |||||| |||| |||||    
31753945 tatcatgtgcagatatcttagctatagcagctcgagattctgttgccatagtaagtatttccaatat 31753879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 302 - 340
Target Start/End: Original strand, 27887869 - 27887907
Alignment:
302 tattggtaccaagtgttactaggaagaagagattcaaga 340  Q
    ||||||||||||||| ||||||||||||||||| |||||    
27887869 tattggtaccaagtgctactaggaagaagagatgcaaga 27887907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110614 times since January 2019
Visitors: 1335