View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E42 (Length: 243)

Name: R108-tnk507-E42
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E42
R108-tnk507-E42
[»] chr1 (1 HSPs)
chr1 (1-239)||(29822255-29822493)


Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 29822493 - 29822255
Alignment:
1 cctccatgtttcatccacaatcatcgtaccaattttatgttaagttcctcaagactcagttatggtcacactcacactctttactattctcaccaaagat 100  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29822493 cctccatgtttcatccacaatcatcgtaccaattttatgttcagttcctcaagactcagttatggtcacactcacactctttactattctcaccaaagat 29822394  T
101 cttctgttcccactattgtttgttctgcttccaataaaccatctacttctcctcaaattaggtaccctttttctctcctatgaaaaacatatttggttat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29822393 cttctgttcccactattgtttgttctgcttccaataaaccatctacttctcctcaaattaggtaccctttttctctcctatgaaaaacatatttggttat 29822294  T
201 gaggtgattttagaatgtttgtttcttaantttgatatg 239  Q
    ||||||||||||||||||||||||||||| || ||||||    
29822293 gaggtgattttagaatgtttgtttcttaatttcgatatg 29822255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360363 times since January 2019
Visitors: 483