View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E55 (Length: 545)

Name: R108-tnk507-E55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E55
R108-tnk507-E55
[»] scaffold0152 (1 HSPs)
scaffold0152 (1-342)||(11310-11651)
[»] chr7 (1 HSPs)
chr7 (412-474)||(18418111-18418175)


Alignment Details
Target: scaffold0152 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: scaffold0152
Description:

Target: scaffold0152; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 342
Target Start/End: Complemental strand, 11651 - 11310
Alignment:
1 atattaatacaaattgagacaatgatgaaacataaaggccattgcttctcttcatttcatcatcaatgggtccagtacaaacatataatagagaacaaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
11651 atattaatacaaattgagacaatgatgaaacataaaggccattgcttctcttcatttcatcatcaatgggtccagtataaacatataatagagaacaaac 11552  T
101 ttctactaattaagaaggaaatacaacttgttagacaaaacataatgaaaatactaaatgaagatagggattactaaagacat-nnnnnnnnnnnnnnnn 199  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                     
11551 ttctactaattaagaaggaaatacaacttgttagacaaaacataatgaaaatactaaatgaagatagggattactaaagacataaaaaaacgaaaaaaac 11452  T
200 nnnnncaacttagaaatagacaaggtcttgccaatttaaatcagtccacacttgcagagtatcgttacttcgaacaaccggtgcaccaaaccatcacatt 299  Q
         |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
11451 caaaacaacttagaaatagacaaagtcttgccaatttaaatcagtccacacttgcagagtatcgttacttcgaacaaccggtgcacc-aaccatcacatt 11353  T
300 agaaccttcacaaagccttctagcaagaaccattcgattgaaa 342  Q
    |||||||||||||||||||||||||||||||||||||||||||    
11352 agaaccttcacaaagccttctagcaagaaccattcgattgaaa 11310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 412 - 474
Target Start/End: Original strand, 18418111 - 18418175
Alignment:
412 ctctggataatagacaactggttctgag-aataaaacnaccnggatg-aaccnagagacncaaaa 474  Q
    |||| |||||||||||| |||||||||| |||||||| ||| ||||| |||| |||||| |||||    
18418111 ctcttgataatagacaattggttctgagaaataaaacaaccaggatgaaaccaagagacacaaaa 18418175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106065 times since January 2019
Visitors: 1319