View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E56 (Length: 588)

Name: R108-tnk507-E56
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E56
R108-tnk507-E56
[»] chr2 (5 HSPs)
chr2 (51-503)||(15396900-15397354)
chr2 (74-441)||(15388352-15388720)
chr2 (464-501)||(15388822-15388859)
chr2 (294-413)||(36034670-36034789)
chr2 (1-29)||(15396851-15396879)
[»] chr3 (2 HSPs)
chr3 (275-373)||(2131470-2131568)
chr3 (312-371)||(20880633-20880692)
[»] chr7 (1 HSPs)
chr7 (293-391)||(24356494-24356592)
[»] chr8 (1 HSPs)
chr8 (233-412)||(4681652-4681837)
[»] chr1 (1 HSPs)
chr1 (322-412)||(39235918-39236009)


Alignment Details
Target: chr2 (Bit Score: 373; Significance: 0; HSPs: 5)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 51 - 503
Target Start/End: Original strand, 15396900 - 15397354
Alignment:
51 attaagaaataaatttactataagggagagagaaaatgcaacttgtaggaggatgtgaaatcatctaaaggagatatagaaaaatacattgaaaatttgc 150  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
15396900 attaagaaataaatttactataagggagagagaaaatgcaacttgtaggaggatatgaaatcatctaaaggagatatagaaaaatacattgaaaatttgc 15396999  T
151 aaaataggaactaatcattgcgacattaaaaagggcctttcctaatt-ctttacattgaagggtctaagaactactaacttcgtccctaaatataggact 249  Q
    || |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
15397000 aatataggaactaatcattgcgacattaaaaagggcctttcctaatttctttacattgaagggtctaagaactactaacttcgtccctaaatataggact 15397099  T
250 cgttgaccaaatcacgggaactaacaaagttgttagtaacatcaaatttgttgacaactagtattgttttgcaagtttacccttgaggagacataattag 349  Q
    |||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
15397100 cgttgaccaaatcacgggaactaagaaagttgttagtgacatcaaatttgttgacaactagtactgttttgcaagtttacccttgaggagacataattag 15397199  T
350 nttatgtttccatcatagtatttagtacaggttgcacaaaaagtgtaacataattaggggtatagngggtacagaaataat-atgcagctgaatgaagnc 448  Q
     ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||| ||| |||||||||||| |    
15397200 tttatgtttcaatcatagtatttagtacaggttgcacaaaaagtgtaacataattaggggtatagt-ggtacagaaataataatgtagctgaatgaaggc 15397298  T
449 ttacntattgnc-accatatgcagtttatcatcaaccagcaaatgaaggcttactt 503  Q
    |||| | ||| | || ||||||||||||||||||||||||||||||||||||||||    
15397299 ttacatgttgtcaacaatatgcagtttatcatcaaccagcaaatgaaggcttactt 15397354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 74 - 441
Target Start/End: Original strand, 15388352 - 15388720
Alignment:
74 gggagagagaaaatgcaacttgtaggaggatgtgaaatcatctaaaggagatatagaaaaatacattgaaaatttgcaaaataggaactaatcattgcga 173  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||| ||| ||||||||||||||||||||||||| ||||||| |||||||| |||    
15388352 gggagagagaaaatgcaacttgtaggaggatatgaaatcatctaaaggacatagagaaaaatacattgaaaatttgcaacataggaattaatcattacga 15388451  T
174 cattaaaaagggcctttcctaatt-ctttacattgaagggtctaagaactactaacttcgtccctaaatataggactcgttgaccaaatcacgggaacta 272  Q
    |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||||||| ||| |||||||||||||||||||||| ||    
15388452 cattaaaaagggcctttcctaatttctttacatcgaagggtctaagaactactaactttgtccctaaatacagggctcgttgaccaaatcacgggaaata 15388551  T
273 acaaagttgttagtaacatcaaatttgttgacaactagtattgttttgcaagtttacccttgaggagacataattagnttatgtttccatcatagtattt 372  Q
    | |||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||    
15388552 agaaagttgttagtaatatcagatttgttgacaactagtattgttttgcaagtttacctttgaggagacataattagtttatgtttctatcatagtattt 15388651  T
373 agtacaggttgcacaaaaagtgtaacataattaggggtatagngggtacagaaataat-atgcagctgaa 441  Q
    ||||||||||||| |||||||| |||| | |||||||||||   ||||||||||| || |||||||||||    
15388652 agtacaggttgcagaaaaagtgcaacagacttaggggtata-ttggtacagaaatgataatgcagctgaa 15388720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 464 - 501
Target Start/End: Original strand, 15388822 - 15388859
Alignment:
464 atatgcagtttatcatcaaccagcaaatgaaggcttac 501  Q
    |||||||||||||||| |||||||||||||| ||||||    
15388822 atatgcagtttatcattaaccagcaaatgaacgcttac 15388859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 294 - 413
Target Start/End: Complemental strand, 36034789 - 36034670
Alignment:
294 aatttgttgacaactagtattgttttgcaagtttacccttgaggagacataattagnttatgtttccatcatagtatttagtacaggttgcacaaaaag- 392  Q
    ||||||||||||| |  ||||||||| ||||||||||||| | |||| | |||||  |||| |||  ||||||||| ||| || |||||| | ||||||     
36034789 aatttgttgacaattgttattgttttacaagtttaccctttatgagagagaattaatttattttttaatcatagta-ttattataggttggagaaaaaga 36034691  T
393 tgtaacataattaggggtata 413  Q
    ||||||||||| ||| |||||    
36034690 tgtaacataatcaggagtata 36034670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 1 - 29
Target Start/End: Original strand, 15396851 - 15396879
Alignment:
1 gtttttccctcgcataaggttgtgagcca 29  Q
    |||||||||||||||||||||||||||||    
15396851 gtttttccctcgcataaggttgtgagcca 15396879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 44; Significance: 9e-16; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 9e-16
Query Start/End: Original strand, 275 - 373
Target Start/End: Original strand, 2131470 - 2131568
Alignment:
275 aaagttgttagtaacatcaaatttgttgacaactagtattgttttgcaagtttacccttgaggagacataattagnttatgtttccatcatagtattta 373  Q
    ||||||| |||||| || |||||||||||||| |  ||||| ||| ||| ||||||||| |||||| | |||||| |||||||| ||||||||||||||    
2131470 aaagttgatagtaatattaaatttgttgacaattgatattgctttacaaatttaccctttaggagagagaattagtttatgttttcatcatagtattta 2131568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 312 - 371
Target Start/End: Original strand, 20880633 - 20880692
Alignment:
312 attgttttgcaagtttacccttgaggagacataattagnttatgtttccatcatagtatt 371  Q
    |||||||| |||||||| |||| |||||| |||||||| |||||||||||||||||||||    
20880633 attgttttacaagtttatccttcaggagagataattaggttatgtttccatcatagtatt 20880692  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 293 - 391
Target Start/End: Complemental strand, 24356592 - 24356494
Alignment:
293 aaatttgttgacaactagtattgttttgcaagtttacccttgaggagacataattagnttatgtttccatcatagtatttagtacaggttgcacaaaaa 391  Q
    ||||||||||| || | |||||||||| |||||||||  || || ||| | |||| | ||||||||||| ||||||||||| |||| |||||| |||||    
24356592 aaatttgttgataattggtattgttttacaagtttacatttcagaagagagaatttgtttatgtttccaacatagtatttattacaagttgcataaaaa 24356494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 233 - 412
Target Start/End: Complemental strand, 4681837 - 4681652
Alignment:
233 tccctaaatatagga-ctcgttgaccaaatcacgggaactaacaaagttgttagtaacat---caaatttgttgacaactagtattgttttgcaagttta 328  Q
    ||||||||||||||| ||||||||  |||||||||||| |||  |||||| |||||| ||   ||||||||||||    || |||||||||  |||||||    
4681837 tccctaaatataggagctcgttgagtaaatcacgggaattaagcaagttgatagtaatatttacaaatttgttgatttttaatattgttttagaagttta 4681738  T
329 cccttgaggagacataattagnttatgtttccatcatagt-atttagtacaggttgcacaaaaag-tgtaacataattaggggtat 412  Q
     |||  |||||| | ||| || |||| ||| |||| |||| ||||  ||||| ||||| |||||| ||||| ||||||| ||||||    
4681737 gcctccaggagagagaatcagtttatcttttcatcgtagtaattttatacagattgcagaaaaagatgtaagataattaagggtat 4681652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 322 - 412
Target Start/End: Original strand, 39235918 - 39236009
Alignment:
322 aagtttacccttgaggagacataattagnttatgtttccatcatagtatttagtacaggttgcacaaaaag-tgtaacataattaggggtat 412  Q
    |||||||||||| |||||| | |||||  | |||| | ||||| |||||||| ||||| ||||| |||||| ||||| ||||||||| ||||    
39235918 aagtttacccttcaggagagaaaattacttaatgtattcatcagagtatttattacagattgcagaaaaagatgtaatataattaggagtat 39236009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108201 times since January 2019
Visitors: 1329