View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E59 (Length: 618)

Name: R108-tnk507-E59
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E59
R108-tnk507-E59
[»] chr3 (75 HSPs)
chr3 (237-505)||(39934875-39935142)
chr3 (28-165)||(39935213-39935347)
chr3 (255-416)||(22304560-22304719)
chr3 (264-416)||(32589704-32589853)
chr3 (275-416)||(43346799-43346940)
chr3 (276-415)||(12114571-12114710)
chr3 (275-416)||(37990647-37990788)
chr3 (275-416)||(37990985-37991126)
chr3 (275-416)||(42342396-42342537)
chr3 (256-415)||(39389062-39389219)
chr3 (275-415)||(54017825-54017965)
chr3 (276-416)||(29644910-29645050)
chr3 (275-416)||(15772863-15773004)
chr3 (275-416)||(33803260-33803401)
chr3 (275-416)||(35946531-35946672)
chr3 (275-415)||(54018207-54018347)
chr3 (275-418)||(29644587-29644730)
chr3 (256-401)||(50612470-50612618)
chr3 (289-415)||(41359774-41359900)
chr3 (275-418)||(25755403-25755546)
chr3 (275-413)||(52634685-52634822)
chr3 (275-416)||(25739433-25739574)
chr3 (275-417)||(22303962-22304097)
chr3 (296-416)||(45395661-45395781)
chr3 (275-418)||(53577373-53577516)
chr3 (275-416)||(15773201-15773344)
chr3 (275-414)||(32462910-32463050)
chr3 (289-416)||(42342098-42342225)
chr3 (255-380)||(4823646-4823769)
chr3 (275-416)||(21832353-21832492)
chr3 (275-413)||(39914261-39914399)
chr3 (275-415)||(33175668-33175813)
chr3 (275-398)||(3135099-3135222)
chr3 (256-414)||(51886553-51886703)
chr3 (275-417)||(49336693-49336836)
chr3 (324-413)||(22303670-22303759)
chr3 (276-416)||(42584832-42584970)
chr3 (275-416)||(31190026-31190159)
chr3 (256-416)||(37726496-37726646)
chr3 (306-416)||(1634323-1634432)
chr3 (295-416)||(44160555-44160673)
chr3 (306-416)||(45901754-45901864)
chr3 (275-416)||(3135462-3135610)
chr3 (275-384)||(8327913-8328022)
chr3 (295-414)||(11661980-11662099)
chr3 (275-414)||(53117985-53118123)
chr3 (308-398)||(47964544-47964634)
chr3 (295-368)||(33362349-33362422)
chr3 (306-413)||(32462569-32462676)
chr3 (275-416)||(9240158-9240299)
chr3 (308-413)||(12749211-12749316)
chr3 (255-373)||(3384317-3384433)
chr3 (275-358)||(7767380-7767463)
chr3 (255-321)||(22304237-22304301)
chr3 (336-415)||(54017557-54017636)
chr3 (308-378)||(46546371-46546441)
chr3 (316-374)||(52634990-52635048)
chr3 (308-394)||(39336000-39336086)
chr3 (351-416)||(41359499-41359564)
chr3 (275-333)||(11661544-11661602)
chr3 (308-398)||(25317200-25317290)
chr3 (308-373)||(39336280-39336345)
chr3 (275-416)||(47964923-47965064)
chr3 (275-322)||(43346659-43346706)
chr3 (333-384)||(53596027-53596078)
chr3 (333-384)||(53596342-53596393)
chr3 (333-384)||(53596542-53596593)
chr3 (334-372)||(17735043-17735081)
chr3 (334-372)||(19036312-19036350)
chr3 (351-384)||(11661605-11661638)
chr3 (321-374)||(17731954-17732007)
chr3 (321-374)||(19033185-19033238)
chr3 (346-416)||(43978873-43978947)
chr3 (351-418)||(7766789-7766854)
chr3 (376-416)||(22304303-22304343)
[»] chr8 (73 HSPs)
chr8 (255-418)||(3669678-3669839)
chr8 (256-418)||(1014251-1014411)
chr8 (275-414)||(45122067-45122206)
chr8 (256-416)||(3670052-3670210)
chr8 (275-420)||(34834885-34835030)
chr8 (275-413)||(34835218-34835356)
chr8 (290-416)||(45122648-45122774)
chr8 (275-416)||(3038298-3038439)
chr8 (255-416)||(30441072-30441235)
chr8 (256-403)||(20870594-20870741)
chr8 (275-416)||(25561823-25561965)
chr8 (295-416)||(9483195-9483316)
chr8 (275-404)||(33113387-33113516)
chr8 (275-416)||(40518591-40518732)
chr8 (255-418)||(1013877-1014038)
chr8 (295-413)||(34835504-34835622)
chr8 (295-413)||(34835770-34835888)
chr8 (275-416)||(37544498-37544639)
chr8 (289-416)||(6876870-6876997)
chr8 (275-418)||(30359280-30359423)
chr8 (278-416)||(5420663-5420801)
chr8 (275-416)||(30359618-30359759)
chr8 (275-403)||(70295-70423)
chr8 (298-416)||(40518103-40518221)
chr8 (275-404)||(147460-147589)
chr8 (275-416)||(1513923-1514064)
chr8 (275-416)||(8918772-8918913)
chr8 (275-416)||(9309364-9309504)
chr8 (275-416)||(9482612-9482753)
chr8 (295-416)||(40579514-40579635)
chr8 (275-416)||(45123015-45123156)
chr8 (289-416)||(45121664-45121791)
chr8 (296-414)||(18372004-18372122)
chr8 (275-416)||(9608754-9608895)
chr8 (275-416)||(45121918-45122059)
chr8 (327-416)||(5915928-5916017)
chr8 (255-420)||(6731895-6732049)
chr8 (289-403)||(9609108-9609222)
chr8 (275-416)||(9308986-9309131)
chr8 (275-416)||(18371669-18371805)
chr8 (275-379)||(43274824-43274928)
chr8 (303-416)||(9507819-9507932)
chr8 (275-415)||(4154290-4154429)
chr8 (275-418)||(6651512-6651646)
chr8 (276-415)||(12283883-12284021)
chr8 (275-338)||(18372785-18372848)
chr8 (275-414)||(32640542-32640676)
chr8 (275-401)||(41972167-41972296)
chr8 (256-343)||(41416252-41416335)
chr8 (295-416)||(32305506-32305627)
chr8 (345-416)||(41129067-41129138)
chr8 (275-384)||(8794120-8794229)
chr8 (334-414)||(147888-147968)
chr8 (275-398)||(9620704-9620825)
chr8 (289-356)||(3037776-3037843)
chr8 (275-338)||(18372342-18372405)
chr8 (275-374)||(18380067-18380166)
chr8 (278-370)||(18372988-18373077)
chr8 (251-383)||(4154707-4154836)
chr8 (295-374)||(18372656-18372731)
chr8 (276-339)||(25561729-25561792)
chr8 (345-416)||(40579277-40579348)
chr8 (351-416)||(8919152-8919217)
chr8 (352-404)||(16524451-16524503)
chr8 (302-358)||(18373236-18373292)
chr8 (337-378)||(12156704-12156745)
chr8 (345-398)||(20995442-20995495)
chr8 (303-415)||(43398077-43398192)
chr8 (275-382)||(5274784-5274891)
chr8 (310-363)||(33832022-33832075)
chr8 (279-371)||(20130462-20130553)
chr8 (360-416)||(43274643-43274699)
chr8 (308-365)||(40991795-40991852)
[»] chr6 (50 HSPs)
chr6 (256-414)||(3409251-3409407)
chr6 (255-416)||(29518911-29519070)
chr6 (256-416)||(29518495-29518653)
chr6 (256-416)||(32741171-32741329)
chr6 (255-416)||(2378117-2378276)
chr6 (256-416)||(35210196-35210354)
chr6 (255-416)||(3409651-3409810)
chr6 (254-416)||(3415448-3415610)
chr6 (289-417)||(10074370-10074498)
chr6 (256-414)||(26544041-26544197)
chr6 (275-416)||(2377763-2377904)
chr6 (256-416)||(3058218-3058376)
chr6 (275-416)||(16454916-16455057)
chr6 (256-416)||(14748350-14748504)
chr6 (275-416)||(2579880-2580021)
chr6 (256-415)||(1127352-1127509)
chr6 (257-416)||(1846741-1846898)
chr6 (275-415)||(16107687-16107827)
chr6 (275-416)||(2843563-2843705)
chr6 (275-416)||(10911574-10911716)
chr6 (295-416)||(2578451-2578572)
chr6 (275-416)||(6999804-6999945)
chr6 (275-416)||(16454584-16454725)
chr6 (303-416)||(10073624-10073737)
chr6 (275-418)||(2579498-2579641)
chr6 (275-409)||(1950200-1950334)
chr6 (276-413)||(5832038-5832174)
chr6 (275-416)||(10073999-10074140)
chr6 (275-391)||(9062383-9062498)
chr6 (275-375)||(32460629-32460729)
chr6 (275-413)||(593718-593858)
chr6 (275-416)||(5958615-5958752)
chr6 (290-416)||(2578843-2578968)
chr6 (275-357)||(16108072-16108154)
chr6 (276-414)||(2579119-2579253)
chr6 (275-412)||(12085046-12085182)
chr6 (275-386)||(8481936-8482046)
chr6 (351-414)||(12071701-12071764)
chr6 (308-415)||(12092491-12092598)
chr6 (289-382)||(2975575-2975668)
chr6 (308-398)||(6071174-6071264)
chr6 (312-398)||(30618643-30618727)
chr6 (289-339)||(35210501-35210551)
chr6 (334-386)||(11637759-11637811)
chr6 (303-343)||(14789285-14789325)
chr6 (358-402)||(10902452-10902496)
chr6 (329-416)||(31714732-31714818)
chr6 (275-401)||(17135092-17135218)
chr6 (308-398)||(34661635-34661725)
chr6 (334-374)||(22605305-22605345)
[»] chr1 (70 HSPs)
chr1 (258-392)||(32594748-32594880)
chr1 (255-416)||(44290832-44290992)
chr1 (251-416)||(41759470-41759633)
chr1 (255-416)||(44290466-44290625)
chr1 (255-416)||(48588496-48588655)
chr1 (276-416)||(3537607-3537747)
chr1 (275-415)||(41157384-41157524)
chr1 (295-415)||(41157020-41157140)
chr1 (256-416)||(3550712-3550867)
chr1 (275-418)||(34364516-34364659)
chr1 (275-417)||(40082416-40082557)
chr1 (275-416)||(41142381-41142523)
chr1 (275-416)||(26661530-26661671)
chr1 (276-416)||(3875339-3875479)
chr1 (289-416)||(31767169-31767296)
chr1 (275-418)||(34364934-34365077)
chr1 (275-414)||(9955916-9956057)
chr1 (275-416)||(14318876-14319017)
chr1 (275-415)||(37556120-37556260)
chr1 (275-403)||(29798208-29798336)
chr1 (275-416)||(17294586-17294728)
chr1 (291-401)||(26661921-26662031)
chr1 (289-414)||(39066210-39066335)
chr1 (275-416)||(50052032-50052172)
chr1 (255-416)||(45493982-45494146)
chr1 (275-416)||(11977289-11977430)
chr1 (275-413)||(5319976-5320114)
chr1 (275-401)||(22077518-22077644)
chr1 (275-416)||(24600322-24600463)
chr1 (275-416)||(34649447-34649588)
chr1 (275-416)||(37850608-37850749)
chr1 (276-419)||(5528759-5528902)
chr1 (295-416)||(32168706-32168821)
chr1 (275-409)||(38804370-38804504)
chr1 (275-412)||(45084391-45084522)
chr1 (255-343)||(3537228-3537314)
chr1 (303-416)||(22077118-22077231)
chr1 (300-385)||(44043811-44043896)
chr1 (275-415)||(37555739-37555878)
chr1 (275-416)||(66480-66621)
chr1 (275-360)||(41184489-41184574)
chr1 (275-425)||(22793287-22793438)
chr1 (275-413)||(24131999-24132134)
chr1 (278-414)||(30630648-30630784)
chr1 (289-413)||(66100-66223)
chr1 (278-416)||(5575116-5575252)
chr1 (275-416)||(22077837-22077977)
chr1 (313-414)||(45839678-45839779)
chr1 (339-389)||(9956208-9956258)
chr1 (289-391)||(10351183-10351285)
chr1 (303-398)||(30576609-30576704)
chr1 (275-415)||(19283464-19283604)
chr1 (281-413)||(44091909-44092041)
chr1 (275-380)||(44685465-44685570)
chr1 (303-380)||(4956228-4956305)
chr1 (351-416)||(11977029-11977094)
chr1 (321-381)||(35154046-35154106)
chr1 (336-416)||(50051697-50051776)
chr1 (365-415)||(4266807-4266855)
chr1 (276-343)||(21378122-21378189)
chr1 (320-398)||(1188614-1188692)
chr1 (337-415)||(47380176-47380254)
chr1 (275-325)||(50469180-50469230)
chr1 (275-331)||(4266875-4266931)
chr1 (275-334)||(30630912-30630972)
chr1 (310-401)||(24448321-24448412)
chr1 (320-389)||(1187399-1187468)
chr1 (311-404)||(5996892-5996984)
chr1 (351-384)||(31973375-31973408)
chr1 (315-360)||(41184152-41184197)
[»] chr2 (69 HSPs)
chr2 (255-416)||(36178613-36178772)
chr2 (275-416)||(15511503-15511644)
chr2 (255-416)||(37106179-37106338)
chr2 (256-416)||(14745675-14745833)
chr2 (255-416)||(5542633-5542792)
chr2 (275-416)||(962607-962748)
chr2 (275-416)||(6421394-6421535)
chr2 (256-416)||(41283483-41283641)
chr2 (275-416)||(42514658-42514799)
chr2 (255-416)||(5543006-5543165)
chr2 (251-416)||(37105911-37106074)
chr2 (275-416)||(15880272-15880413)
chr2 (289-416)||(6422133-6422260)
chr2 (275-416)||(40679637-40679778)
chr2 (289-413)||(36178182-36178306)
chr2 (266-413)||(33731648-33731795)
chr2 (275-418)||(40733526-40733669)
chr2 (275-416)||(6712985-6713127)
chr2 (303-416)||(36005888-36006001)
chr2 (278-404)||(28254259-28254383)
chr2 (256-373)||(36178320-36178435)
chr2 (255-416)||(7598600-7598751)
chr2 (275-416)||(37632605-37632746)
chr2 (256-414)||(1769884-1770040)
chr2 (255-416)||(14745301-14745461)
chr2 (277-418)||(40163378-40163520)
chr2 (275-416)||(35580732-35580872)
chr2 (275-413)||(38796629-38796769)
chr2 (275-418)||(28531320-28531463)
chr2 (303-416)||(23346274-23346386)
chr2 (320-416)||(3673122-3673218)
chr2 (278-414)||(7598240-7598376)
chr2 (275-389)||(33561486-33561600)
chr2 (328-416)||(6421793-6421881)
chr2 (295-410)||(5367484-5367599)
chr2 (275-416)||(16590897-16591033)
chr2 (338-416)||(3672773-3672851)
chr2 (275-377)||(31468797-31468895)
chr2 (275-403)||(12529049-12529177)
chr2 (275-418)||(29676912-29677060)
chr2 (289-413)||(29873548-29873672)
chr2 (275-416)||(40733892-40734032)
chr2 (275-373)||(16542458-16542556)
chr2 (277-398)||(30313189-30313309)
chr2 (328-416)||(6421688-6421776)
chr2 (275-354)||(31899496-31899575)
chr2 (290-374)||(31259666-31259750)
chr2 (319-411)||(36784273-36784365)
chr2 (289-371)||(28254165-28254247)
chr2 (275-416)||(29676544-29676679)
chr2 (277-374)||(29874073-29874170)
chr2 (308-397)||(31385779-31385868)
chr2 (275-343)||(38796299-38796367)
chr2 (264-396)||(41678396-41678527)
chr2 (308-383)||(30323506-30323581)
chr2 (275-398)||(33953797-33953920)
chr2 (275-374)||(37895111-37895210)
chr2 (308-414)||(3594188-3594294)
chr2 (333-384)||(28226404-28226455)
chr2 (275-416)||(9231258-9231399)
chr2 (275-323)||(36785664-36785712)
chr2 (275-373)||(12910237-12910335)
chr2 (308-384)||(30312831-30312907)
chr2 (330-370)||(35580494-35580534)
chr2 (320-379)||(25390313-25390372)
chr2 (308-365)||(2336666-2336723)
chr2 (345-382)||(13792536-13792573)
chr2 (339-396)||(15689427-15689484)
chr2 (303-384)||(37894732-37894813)
[»] chr7 (69 HSPs)
chr7 (275-416)||(1085624-1085765)
chr7 (276-416)||(6054570-6054710)
chr7 (275-415)||(7517589-7517729)
chr7 (255-416)||(14681501-14681658)
chr7 (275-414)||(19122741-19122879)
chr7 (275-418)||(30244279-30244422)
chr7 (255-416)||(37533019-37533177)
chr7 (276-414)||(45434646-45434784)
chr7 (258-416)||(29157559-29157715)
chr7 (275-416)||(37533372-37533513)
chr7 (275-415)||(40094783-40094923)
chr7 (275-413)||(11845200-11845338)
chr7 (275-416)||(23385-23526)
chr7 (289-418)||(22567045-22567174)
chr7 (275-416)||(34218042-34218183)
chr7 (275-418)||(30245086-30245225)
chr7 (275-413)||(45754725-45754862)
chr7 (275-395)||(7554034-7554154)
chr7 (275-418)||(36939739-36939882)
chr7 (276-401)||(24838724-24838850)
chr7 (289-415)||(45433264-45433390)
chr7 (275-413)||(47129104-47129242)
chr7 (275-416)||(9901654-9901793)
chr7 (275-374)||(22566712-22566811)
chr7 (275-413)||(41854644-41854781)
chr7 (275-416)||(24177444-24177585)
chr7 (276-404)||(118319-118449)
chr7 (275-385)||(16569205-16569315)
chr7 (275-385)||(16596347-16596457)
chr7 (270-416)||(30032571-30032717)
chr7 (308-418)||(30253534-30253640)
chr7 (275-402)||(36622969-36623096)
chr7 (278-415)||(36534795-36534930)
chr7 (295-392)||(1085280-1085377)
chr7 (276-385)||(40230330-40230439)
chr7 (289-416)||(37167810-37167931)
chr7 (275-414)||(8128451-8128590)
chr7 (275-385)||(43241504-43241614)
chr7 (312-416)||(28300261-28300366)
chr7 (275-400)||(20599323-20599450)
chr7 (275-339)||(30245503-30245567)
chr7 (275-416)||(41910594-41910743)
chr7 (264-391)||(37345916-37346043)
chr7 (351-416)||(47129454-47129519)
chr7 (275-354)||(28301613-28301692)
chr7 (351-416)||(28300576-28300642)
chr7 (277-339)||(30255350-30255412)
chr7 (335-383)||(23569043-23569091)
chr7 (275-334)||(36109007-36109066)
chr7 (334-413)||(40094424-40094503)
chr7 (354-416)||(37532759-37532821)
chr7 (333-398)||(21619071-21619136)
chr7 (275-336)||(30244710-30244771)
chr7 (315-398)||(4124114-4124197)
chr7 (333-384)||(21416181-21416232)
chr7 (308-402)||(15902342-15902436)
chr7 (367-416)||(30244453-30244502)
chr7 (367-416)||(30253671-30253720)
chr7 (358-411)||(45755019-45755072)
chr7 (279-371)||(44361517-44361608)
chr7 (338-397)||(2512575-2512634)
chr7 (337-391)||(37345652-37345706)
chr7 (374-411)||(7517765-7517802)
chr7 (374-411)||(7518031-7518068)
chr7 (367-416)||(30245256-30245305)
chr7 (275-316)||(40094502-40094543)
chr7 (337-378)||(48071457-48071498)
chr7 (338-398)||(7109754-7109814)
chr7 (333-373)||(27598052-27598092)
[»] chr4 (86 HSPs)
chr4 (255-415)||(50630762-50630920)
chr4 (256-416)||(55933130-55933288)
chr4 (275-416)||(25483345-25483486)
chr4 (275-416)||(54017601-54017742)
chr4 (261-415)||(50002423-50002575)
chr4 (275-416)||(36629246-36629387)
chr4 (256-416)||(41370349-41370507)
chr4 (289-416)||(54936219-54936345)
chr4 (275-416)||(1731653-1731794)
chr4 (275-416)||(36608667-36608808)
chr4 (275-416)||(39792866-39793007)
chr4 (275-414)||(39404407-39404546)
chr4 (288-414)||(18932757-18932883)
chr4 (278-416)||(22027967-22028105)
chr4 (275-416)||(3340816-3340957)
chr4 (275-416)||(32941129-32941270)
chr4 (289-414)||(54108936-54109060)
chr4 (276-418)||(54343012-54343147)
chr4 (273-416)||(44620360-44620503)
chr4 (289-416)||(44621025-44621152)
chr4 (289-395)||(45496828-45496934)
chr4 (275-404)||(4955335-4955464)
chr4 (278-416)||(22028375-22028515)
chr4 (275-416)||(39404027-39404168)
chr4 (275-415)||(3244458-3244598)
chr4 (275-414)||(52884704-52884844)
chr4 (275-414)||(50459730-50459869)
chr4 (275-414)||(52884896-52885038)
chr4 (275-413)||(16888825-16888963)
chr4 (256-385)||(49880152-49880279)
chr4 (275-416)||(10245929-10246069)
chr4 (275-416)||(49302913-49303056)
chr4 (289-412)||(4390111-4390234)
chr4 (275-416)||(20826226-20826367)
chr4 (275-404)||(34646667-34646796)
chr4 (295-415)||(54108565-54108686)
chr4 (275-416)||(22183270-22183411)
chr4 (275-416)||(44620669-44620809)
chr4 (275-416)||(51768066-51768207)
chr4 (275-374)||(2741080-2741179)
chr4 (275-414)||(36572028-36572167)
chr4 (297-416)||(49076837-49076955)
chr4 (275-397)||(41707490-41707611)
chr4 (275-416)||(20825845-20825986)
chr4 (275-418)||(2740709-2740850)
chr4 (308-404)||(15841386-15841482)
chr4 (320-416)||(23817687-23817783)
chr4 (275-414)||(34004593-34004730)
chr4 (278-373)||(54741227-54741322)
chr4 (275-397)||(3341137-3341259)
chr4 (275-385)||(6975493-6975603)
chr4 (275-416)||(16889542-16889683)
chr4 (289-374)||(54017750-54017835)
chr4 (278-418)||(45489336-45489475)
chr4 (306-416)||(43827480-43827589)
chr4 (275-416)||(3700374-3700507)
chr4 (312-416)||(18879852-18879956)
chr4 (317-416)||(31691203-31691304)
chr4 (275-416)||(43174515-43174657)
chr4 (289-416)||(3271807-3271939)
chr4 (275-403)||(40067052-40067181)
chr4 (275-360)||(49076510-49076595)
chr4 (275-398)||(23556890-23557013)
chr4 (308-418)||(28034271-28034381)
chr4 (275-412)||(19504714-19504842)
chr4 (268-398)||(760191-760320)
chr4 (275-332)||(44620305-44620362)
chr4 (295-384)||(48111736-48111825)
chr4 (308-391)||(34544148-34544232)
chr4 (352-415)||(45489721-45489784)
chr4 (277-343)||(10246358-10246424)
chr4 (346-416)||(41370738-41370808)
chr4 (358-416)||(43174233-43174291)
chr4 (275-340)||(11348410-11348475)
chr4 (320-380)||(2891864-2891924)
chr4 (303-416)||(39698950-39699065)
chr4 (333-384)||(11197293-11197344)
chr4 (355-414)||(11348272-11348330)
chr4 (308-367)||(41603246-41603305)
chr4 (256-318)||(50788087-50788147)
chr4 (275-332)||(44621435-44621492)
chr4 (333-385)||(922485-922537)
chr4 (289-332)||(44620968-44621011)
chr4 (333-384)||(53468038-53468089)
chr4 (308-400)||(6876123-6876212)
chr4 (278-391)||(15841016-15841128)
[»] chr5 (59 HSPs)
chr5 (256-418)||(32487386-32487545)
chr5 (256-416)||(6500443-6500600)
chr5 (275-416)||(18603128-18603269)
chr5 (255-416)||(6500814-6500972)
chr5 (275-416)||(40296323-40296464)
chr5 (261-416)||(36492225-36492378)
chr5 (289-416)||(3295353-3295479)
chr5 (255-416)||(624187-624346)
chr5 (275-409)||(41170643-41170777)
chr5 (256-416)||(27502044-27502202)
chr5 (254-385)||(9498693-9498822)
chr5 (275-418)||(11416983-11417126)
chr5 (264-416)||(3295023-3295172)
chr5 (275-416)||(25327944-25328085)
chr5 (275-420)||(26074150-26074295)
chr5 (275-420)||(26074621-26074766)
chr5 (276-416)||(41632792-41632932)
chr5 (275-410)||(13415774-13415909)
chr5 (275-416)||(15370108-15370249)
chr5 (278-416)||(26075169-26075308)
chr5 (275-416)||(35150016-35150156)
chr5 (276-416)||(34753033-34753173)
chr5 (270-420)||(38427552-38427701)
chr5 (275-416)||(42405606-42405745)
chr5 (275-416)||(299498-299639)
chr5 (261-401)||(29549278-29549416)
chr5 (275-415)||(12662661-12662801)
chr5 (256-413)||(623810-623965)
chr5 (278-416)||(33747783-33747921)
chr5 (275-416)||(1028525-1028666)
chr5 (303-416)||(15370439-15370552)
chr5 (275-415)||(24489215-24489353)
chr5 (303-418)||(26590916-26591031)
chr5 (289-416)||(35167846-35167973)
chr5 (256-405)||(5723810-5723957)
chr5 (275-416)||(36568577-36568716)
chr5 (275-404)||(6224205-6224334)
chr5 (275-398)||(26074807-26074931)
chr5 (290-403)||(41635212-41635325)
chr5 (277-410)||(300970-301095)
chr5 (251-341)||(7768837-7768925)
chr5 (310-392)||(36522269-36522351)
chr5 (275-398)||(36521922-36522045)
chr5 (275-416)||(2411016-2411157)
chr5 (275-343)||(26074327-26074395)
chr5 (309-384)||(13786041-13786116)
chr5 (280-374)||(19275543-19275636)
chr5 (352-416)||(26900025-26900089)
chr5 (275-342)||(35914858-35914925)
chr5 (289-361)||(42508635-42508707)
chr5 (351-402)||(795254-795305)
chr5 (333-384)||(13042606-13042657)
chr5 (333-380)||(13112604-13112651)
chr5 (353-413)||(38427306-38427366)
chr5 (275-326)||(6225053-6225104)
chr5 (324-391)||(32445943-32446010)
chr5 (275-361)||(31509632-31509718)
chr5 (275-336)||(39309693-39309754)
chr5 (351-416)||(42435512-42435577)
[»] scaffold0734 (2 HSPs)
scaffold0734 (275-415)||(5405-5546)
scaffold0734 (275-401)||(5786-5917)
[»] scaffold0702 (2 HSPs)
scaffold0702 (275-416)||(522-663)
scaffold0702 (255-416)||(155-309)
[»] scaffold0391 (2 HSPs)
scaffold0391 (275-416)||(1114-1255)
scaffold0391 (313-384)||(1731-1802)
[»] scaffold0171 (1 HSPs)
scaffold0171 (275-382)||(17496-17605)
[»] scaffold0027 (1 HSPs)
scaffold0027 (289-416)||(47383-47510)
[»] scaffold0078 (2 HSPs)
scaffold0078 (275-385)||(5366-5476)
scaffold0078 (278-416)||(4994-5132)
[»] scaffold0504 (1 HSPs)
scaffold0504 (275-344)||(10191-10260)
[»] scaffold0113 (1 HSPs)
scaffold0113 (308-398)||(39498-39588)


Alignment Details
Target: chr3 (Bit Score: 180; Significance: 7e-97; HSPs: 75)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 180; E-Value: 7e-97
Query Start/End: Original strand, 237 - 505
Target Start/End: Complemental strand, 39935142 - 39934875
Alignment:
237 ggacgtggttatggatttgtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacc 336  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||||||||||||||||||||| |    
39935142 ggacgtggttatggatttgtgttggtttgcaagtgtgagagttatatgtcctacatcggataaaagagtaaaggttgaacaccttataagtaagaggatc 39935043  T
337 cataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtggatgatgacccctgaaccagac 436  Q
    ||||||| ||||| ||||| |||||| |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||    
39935042 cataaacccattgccttaaagttttgagtaagagtgtgatgtctctcttgcttgtgtggttgttctagcctcgatgtggatgatgacccctgaaccagac 39934943  T
437 gtataanaacggatgaccaaccggttttgatttaacaggttaanttttaggtgcaaatatccaatnaaa 505  Q
     ||||  || |||||||| ||| ||||| | ||||  |||||| ||||||||||||||||||||| |||    
39934942 ttatagaaatggatgaccgacc-gttttaaattaatcggttaaattttaggtgcaaatatccaataaaa 39934875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 120; E-Value: 4e-61
Query Start/End: Original strand, 28 - 165
Target Start/End: Complemental strand, 39935347 - 39935213
Alignment:
28 gaatcttgttttctagaatgatgaatagaaactatgattttctagaatatttgattaatcacatagttttttcacacaggtacataagaagattattctc 127  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39935347 gaatcttgttttctagaatcatgaatagaaactatgattttctagaatatttgattaatcacatagttttttcacacaggtacataagaagattattctc 39935248  T
128 gcaactttattaatgagagaggggaagatatgattcag 165  Q
    ||||||   |||||||||||||||||||||||||||||    
39935247 gcaact---ttaatgagagaggggaagatatgattcag 39935213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 255 - 416
Target Start/End: Original strand, 22304560 - 22304719
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctta 354  Q
    |||||||||||||||||||||   ||||||||  ||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||    
22304560 gtgttggtttgcaagtgtgagc--tatatgtcccacatcggataaaatagtaaaggttgaataccttataagtaagaggacccataaacacattgcctta 22304657  T
355 aggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||||||||||||| |||||||||| |||||| |||||||||||||||||||||||    
22304658 aggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagtctcgatgtgga 22304719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 103; E-Value: 6e-51
Query Start/End: Original strand, 264 - 416
Target Start/End: Original strand, 32589704 - 32589853
Alignment:
264 tgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgg 363  Q
    ||||||||||||   ||||||||  |||| |||||||||| ||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||    
32589704 tgcaagtgtgag---tatatgtcccacataagataaaataataaaggttgaacaccttataagtaagaggacccataaacccattgccttaaggttttgg 32589800  T
364 gtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||| |||||||||||| |||||||||||||||||| |||||||||||    
32589801 gtaagagtgcgatgtctctcttgcttgtgtggttgttctaggctcgatgtgga 32589853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 43346940 - 43346799
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  |||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||||||||||    
43346940 gagttatatgtcccacatcagataaaatagtaaaggttgaacaccttataagtaagagaacccataaactcattgccttaaggttttgggtaagagtgtg 43346841  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     |||||||||| |||||| ||||||||||| ||| |||||||    
43346840 gtgtctctcttgcttgtgcggttgttctagcctctatgtgga 43346799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 96; E-Value: 9e-47
Query Start/End: Original strand, 276 - 415
Target Start/End: Complemental strand, 12114710 - 12114571
Alignment:
276 agttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtga 375  Q
    |||||||| ||  ||||| |||| || ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||     
12114710 agttatatatcccacatcggatagaaaagtaaaggttgaacaccttataagtaagaggacccataaacccattgtcttaaggttttgggtaagagtgtgg 12114611  T
376 tgtctctcttacttgtgtggttgttctagtctcgatgtgg 415  Q
    ||||||||||||||||| ||||||||||| | ||||||||    
12114610 tgtctctcttacttgtgcggttgttctagccacgatgtgg 12114571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 37990788 - 37990647
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||   ||||| |||||||||||||| |||||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||    
37990788 gagttatatgttccacatcggataaaatagtaaatgttgaacaccttataagtaagaggactcataaactcattgccttaaggttttgggtaagagtgtg 37990689  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     |||||||||| |||||||| ||||||||| |||||||||||    
37990688 gtgtctctcttgcttgtgtgattgttctagcctcgatgtgga 37990647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 37991126 - 37990985
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||  |||||||||||||||||||||||||||||||||||||||||| |||||| ||| | ||||||||||||||||||||||||    
37991126 gagttatatgtctcacattggataaaatagtaaaggttgaacaccttataagtaagaggacctataaactcatcgccttaaggttttgggtaagagtgtg 37991027  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     |||||||||| ||| |||||||||||||| |||||||||||    
37991026 gtgtctctcttgcttatgtggttgttctagcctcgatgtgga 37990985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 42342537 - 42342396
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||| |||||||||| |||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||    
42342537 gagttatatgtcccacatccgataaaagagtaaaggttcaacaccttataagtaagaggacccataaatccattgtcttaaggttttgggtaagagtgtg 42342438  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    | ||||||||| |||||| ||||||||||| ||| |||||||    
42342437 acgtctctcttgcttgtgcggttgttctagcctcaatgtgga 42342396  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 93; E-Value: 6e-45
Query Start/End: Original strand, 256 - 415
Target Start/End: Original strand, 39389062 - 39389219
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||||||||||  ||||||||| |||||| |||||||||||||||||||||||||||| || ||||||||||||||||| |||||||||||    
39389062 tgttggtttgcaagtgtgag--ttatatgtcctacatcggataaaatagtaaaggttgaacaccttaaaactaagaggacccataaacccattgtcttaa 39389159  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgg 415  Q
    ||||||||||||||||||| ||||||| || | ||||   ||||||||| || |||||||    
39389160 ggttttgggtaagagtgtggtgtctcttttgcctgtgcaattgttctagccttgatgtgg 39389219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 93; E-Value: 6e-45
Query Start/End: Original strand, 275 - 415
Target Start/End: Complemental strand, 54017965 - 54017825
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||  |  | ||||||||||||||||||||||||    
54017965 gagttatatgtcctacatcggataaaagagtaaaggttgaacaccttataagtaagaggactcataaacctaacgccttaaggttttgggtaagagtgtg 54017866  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgg 415  Q
     |||||||||||||||||||||||||||||  |||||||||    
54017865 gtgtctctcttacttgtgtggttgttctagcttcgatgtgg 54017825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 276 - 416
Target Start/End: Complemental strand, 29645050 - 29644910
Alignment:
276 agttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtga 375  Q
    |||||||||||  ||||| ||||||| |||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||     
29645050 agttatatgtcccacatcggataaaagagtaaaggttaaacaccttataagtaagaggacccataaacccattgtcttaaggttttgggtaagagtgtgg 29644951  T
376 tgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     ||||||||| ||| || ||||||| ||| |||||||||||    
29644950 cgtctctcttgcttatgcggttgttttagcctcgatgtgga 29644910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 15772863 - 15773004
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  | ||| ||||||| |||||| |||||||||||||||||||||||||||||||||| |||||  |||||||||||| ||||||||||    
15772863 gagttatatgtcccatatcggataaaagagtaaatgttgaacaccttataagtaagaggacccataaactcattgctttaaggttttggataagagtgtg 15772962  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     |||||||||| |||||||||||||||||  |||||||||||    
15772963 gtgtctctcttgcttgtgtggttgttctaacctcgatgtgga 15773004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 33803401 - 33803260
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |||||  ||||||| |||||||||||||||    
33803401 gagttatatgtcccacatcggataaaatagtaaaggttgaacaccatataagtaagaggacccataaacccattgcattaaggtattgggtaagagtgtg 33803302  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
      ||||| ||  |||||||||||||||||| |||||||||||    
33803301 gcgtctccctctcttgtgtggttgttctagcctcgatgtgga 33803260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 35946531 - 35946672
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||| ||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||| ||||||    
35946531 gagttatatgtcccacatcggataaaacagtaaaggttgaacaccttataagtaagaggacccataaacccgttgccttaaggttttgggtaaaagtgtg 35946630  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     |||||||||| ||||||   ||||||||| |||||||||||    
35946631 gtgtctctcttgcttgtgcaattgttctagcctcgatgtgga 35946672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 275 - 415
Target Start/End: Complemental strand, 54018347 - 54018207
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||| | |||| ||||||| ||||||| |||||||||||||||||||||||||||||||||  |  | ||||||||||||||||||||||||    
54018347 gagttatatgtcctgcatcggataaaagagtaaagattgaacaccttataagtaagaggacccataaacctaacgccttaaggttttgggtaagagtgtg 54018248  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgg 415  Q
     |||||||| | |||||||||||||||||| ||||||||||    
54018247 gtgtctctcatgcttgtgtggttgttctagcctcgatgtgg 54018207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 275 - 418
Target Start/End: Complemental strand, 29644730 - 29644587
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||| ||| |||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
29644730 gagttatatgtcccacatcggattaaagagtaaaggttgaacaccttataagtaagagaacccataaacccattgtcttaaggttttgggtaagagtgtg 29644631  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtggatg 418  Q
      ||||||||| ||| || ||||||| |||  ||||||||||||    
29644630 gcgtctctcttgcttatgcggttgttttagcttcgatgtggatg 29644587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 256 - 401
Target Start/End: Complemental strand, 50612618 - 50612470
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaa-----cacattgt 350  Q
    ||||||||||||||||||||  |||||||||  ||||| ||||||||||||||| ||||||||||||||||||||||||| ||||||     || ||| |    
50612618 tgttggtttgcaagtgtgag--ttatatgtcccacatcggataaaatagtaaagattgaacaccttataagtaagaggactcataaatctaacatattat 50612521  T
351 cttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttc 401  Q
    ||||||||||||||||||||||||||||||||||| |||| ||||||||||    
50612520 cttaaggttttgggtaagagtgtgatgtctctcttgcttgagtggttgttc 50612470  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 289 - 415
Target Start/End: Complemental strand, 41359900 - 41359774
Alignment:
289 acatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttact 388  Q
    ||||| |||| |||||||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||| ||||  ||||||||  ||    
41359900 acatcggatacaatagtaaaggttgaataccttataagtaagaggacccataaacccattgccttaaggttttgggtaagaatgtggcgtctctctcgct 41359801  T
389 tgtgtggttgttctagtctcgatgtgg 415  Q
    |||||||||||||||| ||||||||||    
41359800 tgtgtggttgttctagcctcgatgtgg 41359774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 275 - 418
Target Start/End: Original strand, 25755403 - 25755546
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||  ||||||| ||| ||| ||||||| ||||||    
25755403 gagttatatgtctcacatcagataaaagagtaaaggttgaataccttataagtaagaggactcataaatccattgtcctaaagttgtgggtaaaagtgtg 25755502  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtggatg 418  Q
      ||||||||| |||||| ||||||||||| |||||||||||||    
25755503 gcgtctctcttgcttgtgcggttgttctagcctcgatgtggatg 25755546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 275 - 413
Target Start/End: Original strand, 52634685 - 52634822
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||| |||||||||||||| ||||||||||||||| |||||||||| ||||| ||||||||||||||||||||||||    
52634685 gagttatatgtcccacatcggataaaacagtaaaggttgaacgccttataagtaagag-acccataaacccattgccttaaggttttgggtaagagtgtg 52634783  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgt 413  Q
    | ||||||||| ||||||  |||||||||| || |||||    
52634784 acgtctctcttgcttgtgcagttgttctagccttgatgt 52634822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 25739574 - 25739433
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| |||||||||||||| |||||||| | ||||||||||||||||||||||| |||||  || ||||||||||||||||||||    
25739574 gagttatatgtcccacatcggataaaatagtaaaagttgaacatcatataagtaagaggacccataaactcattgcttttaggttttgggtaagagtgtg 25739475  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    | ||||||||  |||||| ||| ||||||| |||||||||||    
25739474 acgtctctctagcttgtgcggtagttctagcctcgatgtgga 25739433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 275 - 417
Target Start/End: Complemental strand, 22304097 - 22303962
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  |||||||||||||||||||||||       |||||||||||| |||||||||||| ||||| ||||||||||||| ||||||||||    
22304097 gagttatatgtcccacatcagataaaatagtaaaggt-------cttataagtaagcggacccataaacccattgccttaaggttttggataagagtgtg 22304005  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtggat 417  Q
     |||||||||| |||| ||||||||||||| ||||||||||||    
22304004 gtgtctctcttgcttgagtggttgttctagcctcgatgtggat 22303962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 296 - 416
Target Start/End: Complemental strand, 45395781 - 45395661
Alignment:
296 ataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtgg 395  Q
    |||||| |||||||||| ||||| ||||||||||||||| |||||||| ||||||||||| |||||||||||||||||| ||||||||| ||||||| ||    
45395781 ataaaagagtaaaggttaaacacgttataagtaagaggatccataaacccattgtcttaatgttttgggtaagagtgtggtgtctctctcacttgtgggg 45395682  T
396 ttgttctagtctcgatgtgga 416  Q
    ||| ||||| |||||||||||    
45395681 ttgctctagcctcgatgtgga 45395661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 275 - 418
Target Start/End: Original strand, 53577373 - 53577516
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||| ||||| ||||||| ||||||||||||||| |||| || |||| ||| ||||||||| |||| |||||||| |||||||||||||||    
53577373 gagttatatgtcacacatcggataaaacagtaaaggttgaacatcttaaaaataagtggatccataaacatattgccttaaggtcttgggtaagagtgtg 53577472  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtggatg 418  Q
     |||||||||| |  ||||||||||||||| |||| ||||||||    
53577473 gtgtctctcttgcaagtgtggttgttctagcctcggtgtggatg 53577516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 15773201 - 15773344
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  |||||  |||||| |||||| |||||||| ||||||||||||||||| ||||| | ||||| ||||| ||||||||||||||||||    
15773201 gagttatatgtcccacatcgaataaaagagtaaaagttgaacatcttataagtaagaggactcataagctcattgccttaaagttttgggtaagagtgtg 15773300  T
375 atgtctct--cttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||  ||| |||||||||||||||||  |||||||||||    
15773301 atgtctcttgcttgcttgtgtggttgttctaacctcgatgtgga 15773344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 275 - 414
Target Start/End: Complemental strand, 32463050 - 32462910
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaa-ggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgt 373  Q
    ||||||||||||  ||||| |||| || |||||| ||||||| ||||||||||||||| ||| ||||||| ||||| |||||||||||| ||||||||||    
32463050 gagttatatgtcccacatcggatagaagagtaaaaggttgaataccttataagtaagaagactcataaacccattgccttaaggttttgagtaagagtgt 32462951  T
374 gatgtctctcttacttgtgtggttgttctagtctcgatgtg 414  Q
    | |||||||||| |||||| ||||||||||| |||||||||    
32462950 ggtgtctctcttgcttgtgcggttgttctagcctcgatgtg 32462910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 289 - 416
Target Start/End: Complemental strand, 42342225 - 42342098
Alignment:
289 acatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttact 388  Q
    ||||| ||||||| |||||| ||| ||  |||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||  ||||||||| ||    
42342225 acatcggataaaagagtaaatgttcaatgccttataagtaagaggactcataaactcattgccttaaggttttgggtaagagtgtggcgtctctcttgct 42342126  T
389 tgtgtggttgttctagtctcgatgtgga 416  Q
    |||| ||||||||||| |||||||||||    
42342125 tgtgcggttgttctagcctcgatgtgga 42342098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 255 - 380
Target Start/End: Original strand, 4823646 - 4823769
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctta 354  Q
    |||||||||||||||||||||  ||||| |||  ||||| |||||||||||||| ||| ||||||||||||||| |||||||||||||| ||||| ||||    
4823646 gtgttggtttgcaagtgtgag--ttataagtctcacatcggataaaatagtaaaagttaaacaccttataagtaggaggacccataaactcattgcctta 4823743  T
355 aggttttgggtaagagtgtgatgtct 380  Q
    || ||||||||||||||||| |||||    
4823744 agattttgggtaagagtgtggtgtct 4823769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 21832492 - 21832353
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||  |||| || ||||||||||||||||||||||||||||||||| ||||||| ||| | |||||||||||||||||||  |||    
21832492 gagttatatgtcccacattggatagaaaagtaaaggttgaacaccttataagtaagaggactcataaactcatagccttaaggttttgggtaaga--gtg 21832395  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
      ||||||||| ||||| |||||||||||| |||||||||||    
21832394 gcgtctctcttgcttgtctggttgttctagcctcgatgtgga 21832353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 275 - 413
Target Start/End: Original strand, 39914261 - 39914399
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||||||||||| |||| |||||||||||||||||| |||||||||||||||||  | || |||||  |||||| ||||||||||    
39914261 gagttatatgtctcacatcagataaaacagtagaggttgaacaccttataaataagaggacccataaacctaatgccttaatattttggataagagtgtg 39914360  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgt 413  Q
     ||||||||| |||| || ||||||||||| ||||||||    
39914361 gtgtctctctcacttatgcggttgttctagcctcgatgt 39914399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 275 - 415
Target Start/End: Complemental strand, 33175813 - 33175668
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggaccc---ataaacacattgtcttaaggttttgggtaaga-- 369  Q
    ||||||||||||  |||||||||| || |||||||||||||||||||||||||||||| ||||   |||||| ||| | |||||||||||||||||||      
33175813 gagttatatgtctcacatcagatagaaaagtaaaggttgaacaccttataagtaagagaacccataataaactcatagccttaaggttttgggtaagagt 33175714  T
370 gtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgg 415  Q
    |||||| |||||||| ||||||||| ||||||||| |||| |||||    
33175713 gtgtgacgtctctctcacttgtgtgattgttctagcctcggtgtgg 33175668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 275 - 398
Target Start/End: Complemental strand, 3135222 - 3135099
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| |||||||||||||| |||||||||||||||||||| || |||||||||| || || | |||||||||| |||||||||||    
3135222 gagttatatgtcccacatcggataaaatagtaaatgttgaacaccttataagtaaaagaacccataaacccactgccataaggttttgagtaagagtgtg 3135123  T
375 atgtctctcttacttgtgtggttg 398  Q
     |||||||||| |||||| |||||    
3135122 gtgtctctcttgcttgtgcggttg 3135099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 256 - 414
Target Start/End: Original strand, 51886553 - 51886703
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||||||||||  |||||||||  |||||  |||||||||||||||||||||| | ||||||||||||||||||||||| |||||          
51886553 tgttggtttgcaagtgtgag--ttatatgtctcacatcgaataaaatagtaaaggttgaacatcatataagtaagaggacccataaactcattg------ 51886644  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtg 414  Q
     ||||||| |||||||||||||||||| || |  ||||| |||||||| ||||||||||    
51886645 cgttttggataagagtgtgatgtctcttttgcaagtgtgattgttctaatctcgatgtg 51886703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 275 - 417
Target Start/End: Complemental strand, 49336836 - 49336693
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||| |||||  ||||| |||| || |||||||||||| |||||||||||||||||||||||||||| ||| ||||||| ||| ||||||||||||||    
49336836 gagttacatgtctcacatcggatagaaaagtaaaggttgaccaccttataagtaagaggacccataaacccatagtcttaaagttctgggtaagagtgtg 49336737  T
375 atgtctctc-ttacttgtgtggttgttctagtctcgatgtggat 417  Q
     |||||||| ||  ||||| ||||||||||  ||| ||||||||    
49336736 gtgtctctctttttttgtgcggttgttctatcctcaatgtggat 49336693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 324 - 413
Target Start/End: Complemental strand, 22303759 - 22303670
Alignment:
324 aagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgt 413  Q
    |||||||||||||||||||| ||||| |||||||||||||||||||||||| ||| ||||||||||||| | ||||||||| ||||||||    
22303759 aagtaagaggacccataaacccattgccttaaggttttgggtaagagtgtggtgtttctcttacttgtgcgattgttctagcctcgatgt 22303670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 276 - 416
Target Start/End: Complemental strand, 42584970 - 42584832
Alignment:
276 agttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtga 375  Q
    |||||||||||  ||||| |||| || ||||||| |||||||||||||||||||||||| ||||||||  ||||||||||| ||||| | |||||||||     
42584970 agttatatgtcccacatcggatagaagagtaaagattgaacaccttataagtaagaggatccataaaccaattgtcttaagattttgagaaagagtgtg- 42584872  T
376 tgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     || |||||||||| || |||||||||||| || |||||||    
42584871 -gtgtctcttacttatgcggttgttctagtttcaatgtgga 42584832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 31190026 - 31190159
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||| |||||||  ||||| ||||||| ||||||||||||||||||||||||| ||||||||||||        | ||||||||||||||||||||||||    
31190026 gagtgatatgtcccacatcggataaaagagtaaaggttgaacaccttataagttagaggacccata--------gccttaaggttttgggtaagagtgtg 31190117  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     |||||||||| |||||  ||||||||||| |||||| ||||    
31190118 gtgtctctcttgcttgtcgggttgttctagcctcgatttgga 31190159  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 256 - 416
Target Start/End: Original strand, 37726496 - 37726646
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||||||||||  |||||||||  ||||| |||||||||||||| |||||| |||||||||||||||||| |        ||||| ||| |    
37726496 tgttggtttgcaagtgtgag--ttatatgtctcacatcggataaaatagtaaatgttgaataccttataagtaagaggatc--------cattgccttta 37726585  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |||||||| ||||||||||| || | |||||||||| | |||||||||| |||||||||||    
37726586 ggttttggataagagtgtgacgtttatcttacttgtatagttgttctagcctcgatgtgga 37726646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 306 - 416
Target Start/End: Complemental strand, 1634432 - 1634323
Alignment:
306 aaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagt 405  Q
    ||||||| ||||| |||||||||||||||||||||||| ||||| |||||||||||||||||||||| | | ||||||| || | | ||||||||||||     
1634432 aaaggttaaacacattataagtaagaggacccataaacccattggcttaaggttttgggtaagagtgcggtatctctctcac-tatatggttgttctagc 1634334  T
406 ctcgatgtgga 416  Q
    |||||||||||    
1634333 ctcgatgtgga 1634323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 295 - 416
Target Start/End: Complemental strand, 44160673 - 44160555
Alignment:
295 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtg 394  Q
    ||||||| | ||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||| ||||||| ||||  ||||||||||||  || |    
44160673 gataaaacaataaaggttgaacaccttataaataagaggatccataaacccattgtcttaaggtttt-ggtaagaatgtggcgtctctcttact--tgcg 44160577  T
395 gttgttctagtctcgatgtgga 416  Q
     ||||||||| |||||||||||    
44160576 attgttctagcctcgatgtgga 44160555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 306 - 416
Target Start/End: Original strand, 45901754 - 45901864
Alignment:
306 aaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagt 405  Q
    |||||||||||||||||||||||||||||| ||||||| ||| | ||||| ||||| |||||||||||| |||||||||||||| |  ||||||||||      
45901754 aaaggttgaacaccttataagtaagaggacgcataaactcatggccttaaagtttttggtaagagtgtggtgtctctcttacttatagggttgttctaac 45901853  T
406 ctcgatgtgga 416  Q
     ||||||||||    
45901854 ttcgatgtgga 45901864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 3135610 - 3135462
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataa-----gtaagaggaccc--ataaacacattgtcttaaggttttgggtaa 367  Q
    ||||||||||||  || |||||||||| |||||| |||||||||||||| |     ||||||||||||  |||||| ||||| ||||||||||| | |||    
3135610 gagttatatgtcccacctcagataaaagagtaaaagttgaacaccttattatattagtaagaggacccccataaacccattgccttaaggttttagataa 3135511  T
368 gagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||| ||||||| || |||||| ||||||||||| |||||||||||    
3135510 gagtgtggtgtctcttttgcttgtgcggttgttctagcctcgatgtgga 3135462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 275 - 384
Target Start/End: Original strand, 8327913 - 8328022
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||| |||||||| |||| | |||||||||||||| ||||||||||  | || ||||||||||||||||||||||||    
8327913 gagttatatgtcccacatcggataaaagagtaaaggatgaatatcttataagtaagagaacccataaacgtaatgccttaaggttttgggtaagagtgtg 8328012  T
375 atgtctctct 384  Q
     |||||||||    
8328013 gtgtctctct 8328022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 295 - 414
Target Start/End: Original strand, 11661980 - 11662099
Alignment:
295 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaagg-ttttgggtaagagtgtgatgtctctcttacttgtgt 393  Q
    ||||||| |||||||||||||||||||| |||| ||||| | |||||||  |||| ||||||| ||||||||||||||| | ||||||||| | ||||||    
11661980 gataaaagagtaaaggttgaacaccttaaaagtgagaggcctcataaaccaattgccttaaggtttttgggtaagagtgaggtgtctctctca-ttgtgt 11662078  T
394 ggttgttctagtctcgatgtg 414  Q
    ||||||||||| |||||||||    
11662079 ggttgttctagcctcgatgtg 11662099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 275 - 414
Target Start/End: Complemental strand, 53118123 - 53117985
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||   | ||| ||||||| ||||||||||||||||||||||||| ||||||  || |||| ||||| |||||| ||||||||||||||||     
53118123 gagttatatgttccatatcggataaaagagtaaaggttgaacaccttataagtgagaggattca-aaacccattgccttaagattttgggtaagagtgta 53118025  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtg 414  Q
     ||||||||| ||  |||||||||||||||  ||||||||    
53118024 gtgtctctctcacaagtgtggttgttctagcatcgatgtg 53117985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 51; E-Value: 6e-20
Query Start/End: Original strand, 308 - 398
Target Start/End: Complemental strand, 47964634 - 47964544
Alignment:
308 aggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttg 398  Q
    ||||||||| |  ||||||| |||||||||||||||  |||| ||||||||||||||||||||||||  |||||||| |||||||||||||    
47964634 aggttgaacgctatataagtgagaggacccataaacctattgccttaaggttttgggtaagagtgtggcgtctctctcacttgtgtggttg 47964544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 295 - 368
Target Start/End: Complemental strand, 33362422 - 33362349
Alignment:
295 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaag 368  Q
    ||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||  |||||| |||||||||||    
33362422 gataaaataataaaggttgaataccttataagtaagaggacccataaacccatttccttaagattttgggtaag 33362349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 306 - 413
Target Start/End: Complemental strand, 32462676 - 32462569
Alignment:
306 aaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagt 405  Q
    |||||||||||||||||||||||||| || ||||||||  ||||  |||||||||||| ||||||||||  |||||||||  ||||| | ||||| |||     
32462676 aaaggttgaacaccttataagtaagatgatccataaacctattgctttaaggttttggataagagtgtggggtctctcttgtttgtgggattgttttagc 32462577  T
406 ctcgatgt 413  Q
    ||||||||    
32462576 ctcgatgt 32462569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 9240158 - 9240299
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||   ||||| |||| |  |||||| | |||||||||||||||||||||||||||||||  ||||  |||||| ||| || ||||| ||||    
9240158 gagttatatgttccacatcggatagagaagtaaaagctgaacaccttataagtaagaggacccataaatccattaccttaagatttcggataagaatgtg 9240257  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     ||||||||| | | ||| |||| |||||| |||||||||||    
9240258 gtgtctctctcaatagtgcggttattctagcctcgatgtgga 9240299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 308 - 413
Target Start/End: Original strand, 12749211 - 12749316
Alignment:
308 aggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtct 407  Q
    ||||||||||| ||||||||  ||||||||||||||  ||||  |||||||||| | ||||||||||   || ||||||||| |||||||||||||||||    
12749211 aggttgaacactttataagtgtgaggacccataaaccaattgcattaaggtttttgataagagtgtggactcactcttacttatgtggttgttctagtct 12749310  T
408 cgatgt 413  Q
     |||||    
12749311 ggatgt 12749316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 255 - 373
Target Start/End: Complemental strand, 3384433 - 3384317
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctta 354  Q
    |||||||| |||||| |||||  |||||||||  ||||  ||||||| |||| ||||| ||||| ||||||| ||||||||||||||||  | || ||||    
3384433 gtgttggtgtgcaagcgtgag--ttatatgtcccacatatgataaaacagtataggttaaacactttataaggaagaggacccataaacttaatgcctta 3384336  T
355 aggttttgggtaagagtgt 373  Q
    | |||||||||||||||||    
3384335 aagttttgggtaagagtgt 3384317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 275 - 358
Target Start/End: Complemental strand, 7767463 - 7767380
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggt 358  Q
    ||||||||||||  ||||| |||| || ||||||||||| |||| |||||| ||||||||| ||||||| ||||||||||||||    
7767463 gagttatatgtcccacatcggatagaaaagtaaaggttggacactttataactaagaggactcataaacccattgtcttaaggt 7767380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 255 - 321
Target Start/End: Original strand, 22304237 - 22304301
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacacctt 321  Q
    |||||||||||||||||||||  |||||||||  ||||| |||||||||||||||||||||||||||    
22304237 gtgttggtttgcaagtgtgag--ttatatgtcccacatcggataaaatagtaaaggttgaacacctt 22304301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 336 - 415
Target Start/End: Complemental strand, 54017636 - 54017557
Alignment:
336 ccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgg 415  Q
    |||||||| ||||| |||||||||||||||||||||||| ||||||| |||||| |||| ||||| | | ||||||||||    
54017636 ccataaacccattgccttaaggttttgggtaagagtgtggtgtctctattacttatgtgattgttttggcctcgatgtgg 54017557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 308 - 378
Target Start/End: Complemental strand, 46546441 - 46546371
Alignment:
308 aggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgt 378  Q
    ||||||||||| |||||||| |||| | |||||||| ||||| |||||||||||| |||||||||||||||    
46546441 aggttgaacactttataagttagagaatccataaacccattgccttaaggttttgtgtaagagtgtgatgt 46546371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 316 - 374
Target Start/End: Original strand, 52634990 - 52635048
Alignment:
316 caccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||| ||||||||||||||||| ||||| |||||| |||||||||||||||||    
52634990 caccttataaataagaggacccataaactcattgccttaagattttgggtaagagtgtg 52635048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 308 - 394
Target Start/End: Complemental strand, 39336086 - 39336000
Alignment:
308 aggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtg 394  Q
    ||||||||||| |||||| | | | ||| ||||||  ||||| |||||||||||||||||||||||| |||||||||  ||||||||    
39336086 aggttgaacactttataaatgataagactcataaaatcattgccttaaggttttgggtaagagtgtggtgtctctctcgcttgtgtg 39336000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 351 - 416
Target Start/End: Complemental strand, 41359564 - 41359499
Alignment:
351 cttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||||||||||||||||||  |||||| || |||||| ||||||||||| ||| |||||||    
41359564 cttaaggttttgggtaagagtgtggcgtctcttttgcttgtgcggttgttctagcctcaatgtgga 41359499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 275 - 333
Target Start/End: Original strand, 11661544 - 11661602
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagagg 333  Q
    ||||||||||||  ||||| ||||||||||||| |||| |||| |||||||||||||||    
11661544 gagttatatgtcccacatcggataaaatagtaacggttaaacatcttataagtaagagg 11661602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 308 - 398
Target Start/End: Original strand, 25317200 - 25317290
Alignment:
308 aggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttg 398  Q
    ||||||| ||| || ||| | |||||||||||||||   ||| ||||||||||||||||| |||||  ||| ||||| |||||||||||||    
25317200 aggttgagcactttgtaactgagaggacccataaacttgttgccttaaggttttgggtaaaagtgtagtgtgtctctcacttgtgtggttg 25317290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 308 - 373
Target Start/End: Complemental strand, 39336345 - 39336280
Alignment:
308 aggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgt 373  Q
    ||||||||||| |||||||| |||||| |||||||| |||||  |||||||||||| ||| |||||    
39336345 aggttgaacactttataagtgagaggatccataaactcattgctttaaggttttggataatagtgt 39336280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 47965064 - 47964923
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||  |||||| |||| || |||  ||||| ||||   ||||||| ||||| | ||||| | ||||| |||||| |||||||||||||||||    
47965064 gagttatatgttttacatcggatagaaaagtggaggttaaacattatataagtgagagggctcataagcccattgccttaagattttgggtaagagtgtg 47964965  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
      |||||||| |||| | || ||||||| | || ||||||||    
47964964 gcgtctctctcacttatatgattgttctggcctagatgtgga 47964923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 275 - 322
Target Start/End: Original strand, 43346659 - 43346706
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacacctta 322  Q
    ||||| ||||||  ||||| ||||||||||||||||||||||||||||    
43346659 gagttgtatgtcccacatcggataaaatagtaaaggttgaacacctta 43346706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 53596027 - 53596078
Alignment:
333 gacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctct 384  Q
    ||||||||||| | ||  |||||||||||||||||||||||| |||||||||    
53596027 gacccataaacccgttaccttaaggttttgggtaagagtgtggtgtctctct 53596078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 53596342 - 53596393
Alignment:
333 gacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctct 384  Q
    ||||||||||| | ||  |||||||||||||||||||||||| |||||||||    
53596342 gacccataaacccgttaccttaaggttttgggtaagagtgtggtgtctctct 53596393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 333 - 384
Target Start/End: Original strand, 53596542 - 53596593
Alignment:
333 gacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctct 384  Q
    ||||||||||| ||||| |||||| |||| |||||||||||| |||||||||    
53596542 gacccataaacccattgacttaagattttaggtaagagtgtggtgtctctct 53596593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 334 - 372
Target Start/End: Complemental strand, 17735081 - 17735043
Alignment:
334 acccataaacacattgtcttaaggttttgggtaagagtg 372  Q
    |||||||||| ||||| ||||||||||||||||||||||    
17735081 acccataaactcattgacttaaggttttgggtaagagtg 17735043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 334 - 372
Target Start/End: Complemental strand, 19036350 - 19036312
Alignment:
334 acccataaacacattgtcttaaggttttgggtaagagtg 372  Q
    |||||||||| ||||| ||||||||||||||||||||||    
19036350 acccataaactcattgacttaaggttttgggtaagagtg 19036312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 351 - 384
Target Start/End: Original strand, 11661605 - 11661638
Alignment:
351 cttaaggttttgggtaagagtgtgatgtctctct 384  Q
    |||||||||||||||||||||||| |||||||||    
11661605 cttaaggttttgggtaagagtgtggtgtctctct 11661638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 321 - 374
Target Start/End: Complemental strand, 17732007 - 17731954
Alignment:
321 tataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||| ||| | |||||||||| ||||| |||||||||||| |||||||||||    
17732007 tataagaaagggaacccataaacccattgccttaaggttttgagtaagagtgtg 17731954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 321 - 374
Target Start/End: Complemental strand, 19033238 - 19033185
Alignment:
321 tataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||| ||| | |||||||||| ||||| |||||||||||| |||||||||||    
19033238 tataagaaagggaacccataaacccattgccttaaggttttgagtaagagtgtg 19033185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 346 - 416
Target Start/End: Complemental strand, 43978947 - 43978873
Alignment:
346 attgtcttaaggttttgggtaag----agtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |||| ||||||||||||||||||    ||||||  |||||||| ||||||||| ||||||||  |||||||||||    
43978947 attgccttaaggttttgggtaagctagagtgtggcgtctctctcacttgtgtgtttgttctaacctcgatgtgga 43978873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 351 - 418
Target Start/End: Complemental strand, 7766854 - 7766789
Alignment:
351 cttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtggatg 418  Q
    ||||||||||| ||||||| ||||  |||||||  |||||| |||||||||||| |||||||| ||||    
7766854 cttaaggttttaggtaagattgtggcgtctctc--acttgtatggttgttctagcctcgatgtagatg 7766789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 376 - 416
Target Start/End: Original strand, 22304303 - 22304343
Alignment:
376 tgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||| |||||| ||||||||||| |||||||||||    
22304303 tgtctctcttgcttgtgcggttgttctagcctcgatgtgga 22304343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 117; Significance: 3e-59; HSPs: 73)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 3e-59
Query Start/End: Original strand, 255 - 418
Target Start/End: Original strand, 3669678 - 3669839
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctta 354  Q
    |||||||||||||||||||||  |||||||||  ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||    
3669678 gtgttggtttgcaagtgtgag--ttatatgtcccacatcagataaaatagtaaaggttgaacaccttataagtaagaggactcataaactcattgcctta 3669775  T
355 aggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtggatg 418  Q
    |||||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||||||||    
3669776 aggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtggatg 3669839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 108; E-Value: 6e-54
Query Start/End: Original strand, 256 - 418
Target Start/End: Complemental strand, 1014411 - 1014251
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||  |||||    
1014411 tgttggtttgcaagtgtgag--ttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccgtaaactcgttaccttaa 1014314  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtggatg 418  Q
     |||||||||||||||||| |||||||| | |||||| ||||||||||| |||||||||||||    
1014313 agttttgggtaagagtgtggtgtctctcctgcttgtgcggttgttctagcctcgatgtggatg 1014251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 275 - 414
Target Start/End: Complemental strand, 45122206 - 45122067
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||||    
45122206 gagttatatgtctcacatcggataaaatagtaaaggttgaacaccttataagtaagagaacccataaactcattttcttaaggttttgggtaagagtgtg 45122107  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtg 414  Q
     ||||||||||||||||| ||||||||||| |||||||||    
45122106 gtgtctctcttacttgtggggttgttctagcctcgatgtg 45122067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 98; E-Value: 6e-48
Query Start/End: Original strand, 256 - 416
Target Start/End: Original strand, 3670052 - 3670210
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||||||||||  |||||||||  ||||| |||||||||||||||||| ||||||||||||||| ||||||||||||||  |||  |||||    
3670052 tgttggtttgcaagtgtgag--ttatatgtcccacatcggataaaatagtaaaggtttaacaccttataagtatgaggacccataaacctatttccttaa 3670149  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||||||    
3670150 ggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 3670210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 98; E-Value: 6e-48
Query Start/End: Original strand, 275 - 420
Target Start/End: Original strand, 34834885 - 34835030
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||  |||||||||||||||||| |||||||||||||||||| ||| ||||||| ||||| ||||||||||||||||||||||||    
34834885 gagttatatgtcccacattggataaaatagtaaaggttaaacaccttataagtaagatgactcataaactcattgccttaaggttttgggtaagagtgtg 34834984  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtggatgat 420  Q
     |||||||||| |||||||||||||||||| |||||||||||||||    
34834985 gtgtctctcttgcttgtgtggttgttctagcctcgatgtggatgat 34835030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 95; E-Value: 4e-46
Query Start/End: Original strand, 275 - 413
Target Start/End: Original strand, 34835218 - 34835356
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||    
34835218 gagttatatgtcccacatccgataaaatagtaaaggttgaacaccttataagtaagaggacccataaactcattgccttaaagttttgggtaagagtgtg 34835317  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgt 413  Q
     |||| ||||| ||||||||||| |||||| ||||||||    
34835318 gtgtcactcttgcttgtgtggttattctagcctcgatgt 34835356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 95; E-Value: 4e-46
Query Start/End: Original strand, 290 - 416
Target Start/End: Original strand, 45122648 - 45122774
Alignment:
290 catcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttactt 389  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||  ||||||||| |||    
45122648 catcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaactcattgtcttaaggttttgggtatgagtgtggcgtctctcttgctt 45122747  T
390 gtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||||| || |||||||||||    
45122748 gtgtggttgttcaagcctcgatgtgga 45122774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 3038439 - 3038298
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| |||||||||||||||||||||||| |||||||||| ||||||||||||| ||||| ||||||||||||||||||||||||    
3038439 gagttatatgtcccacatcggataaaatagtaaaggttgaacactttataagtaaaaggacccataaacccattgccttaaggttttgggtaagagtgtg 3038340  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
       |||||||| |||||||||||||||||| |||||||||||    
3038339 gcatctctcttgcttgtgtggttgttctagcctcgatgtgga 3038298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 255 - 416
Target Start/End: Original strand, 30441072 - 30441235
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacacctta----taagtaagaggacccataaacacattgt 350  Q
    |||||||||||||||||||||  |||||||||  ||||| | ||||||||||||||||||||||||||    ||||||||||| ||||||||| |||||     
30441072 gtgttggtttgcaagtgtgag--ttatatgtcccacatcggctaaaatagtaaaggttgaacaccttaattataagtaagagggcccataaacccattgc 30441169  T
351 cttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||||||    
30441170 cttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 30441235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 256 - 403
Target Start/End: Complemental strand, 20870741 - 20870594
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||||||||||   |||||||   ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || || |||||    
20870741 tgttggtttgcaagtgtgagttatatatgttccacatcagataaaatagtaaaggttgaacatcttataagtaagaggacccataaacccactgccttaa 20870642  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttcta 403  Q
    | |||||| |||||||||| |||||||||| |||||||||||||||||    
20870641 gattttggataagagtgtggtgtctctcttgcttgtgtggttgttcta 20870594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 91; E-Value: 9e-44
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 25561965 - 25561823
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggtttt-gggtaagagtgt 373  Q
    ||||||||||||  ||||| ||||||| |||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||    
25561965 gagttatatgtcccacatcggataaaagagtaaacgttgaacaccttataagtaagaggacccataaactcattgtcttaaggttttggggtaagagtgt 25561866  T
374 gatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||  |||||||| |||||||||||| ||||| |||||||||||    
25561865 gacatctctcttgcttgtgtggttgctctagcctcgatgtgga 25561823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 295 - 416
Target Start/End: Complemental strand, 9483316 - 9483195
Alignment:
295 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtg 394  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||| || || ||| |    
9483316 gataaaagagtaaaggttgaacaccttataagtaagaggacccataaacccattgtcttaaggttttgggtaagagtgtggtgtctcttttgctcgtgcg 9483217  T
395 gttgttctagtctcgatgtgga 416  Q
    |||||||||| |||||||||||    
9483216 gttgttctagcctcgatgtgga 9483195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 275 - 404
Target Start/End: Complemental strand, 33113516 - 33113387
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||| |||||| ||||||||||||||||||||||  ||||||||||||||||||||||||| ||||| |||||| |||||||||||||||||    
33113516 gagttatatgtcctacatcggataaaatagtaaaggttgaacgtcttataagtaagaggacccataaactcattgccttaagattttgggtaagagtgtg 33113417  T
375 atgtctctcttacttgtgtggttgttctag 404  Q
     |||||||||| || |||||||||||||||    
33113416 gtgtctctcttgctagtgtggttgttctag 33113387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 40518591 - 40518732
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  |||||||||| || ||||||||||||||||||||||| ||||||||||||||||| || || ||||||||||||||||||||||||    
40518591 gagttatatgtcccacatcagatagaaaagtaaaggttgaacaccttataaataagaggacccataaacccaatgacttaaggttttgggtaagagtgtg 40518690  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    | ||| ||||| |||||||||||||||||| ||| |||||||    
40518691 acgtcactcttgcttgtgtggttgttctagcctcaatgtgga 40518732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 255 - 418
Target Start/End: Complemental strand, 1014038 - 1013877
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctta 354  Q
    |||||||||||||||||||||  ||||||||   ||||| |||||||||||||| |||||||||| |||||||||||||||| |||||| ||||| ||||    
1014038 gtgttggtttgcaagtgtgag--ttatatgttccacatcggataaaatagtaaaagttgaacaccctataagtaagaggaccaataaacccattgcctta 1013941  T
355 aggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtggatg 418  Q
      |||||| ||||||||||| ||||||| ||||||||| ||||||||||| |||||||||||||    
1013940 gagttttgagtaagagtgtgttgtctcttttacttgtgcggttgttctagcctcgatgtggatg 1013877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 295 - 413
Target Start/End: Original strand, 34835504 - 34835622
Alignment:
295 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtg 394  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||| |||| ||||| ||||||||    
34835504 gataaaatagtaaaggtttaacaccttataagtaagaggacccataaactcattgccttaaagttttgggtaagagtgtggtgtcactcttgcttgtgtg 34835603  T
395 gttgttctagtctcgatgt 413  Q
    ||| |||||| ||||||||    
34835604 gttattctagcctcgatgt 34835622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 295 - 413
Target Start/End: Original strand, 34835770 - 34835888
Alignment:
295 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtg 394  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||||| |||| ||||| ||||||||    
34835770 gataaaatagtaaaggtttaacaccttataagtaagaggacccataaactcattgccttaaagttttgggtaagagtgtggtgtcactcttgcttgtgtg 34835869  T
395 gttgttctagtctcgatgt 413  Q
    ||| |||||| ||||||||    
34835870 gttattctagcctcgatgt 34835888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 37544639 - 37544498
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||| |||  ||||| |||||||||||||||||||||||| ||||||| |||||||||||||||  ||||   |||||||||||||||||||||||    
37544639 gagttataagtcgcacatcggataaaatagtaaaggttgaacacattataagaaagaggacccataaatccattactttaaggttttgggtaagagtgtg 37544540  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     ||||| ||||||||||| ||||||||||| |||||||||||    
37544539 gtgtctttcttacttgtgcggttgttctagcctcgatgtgga 37544498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 289 - 416
Target Start/End: Complemental strand, 6876997 - 6876870
Alignment:
289 acatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttact 388  Q
    ||||| ||||||| ||||||||||||||||||||||| ||||| |||||||| || |||||||||| ||||||||||||||||||| ||| ||||||  |    
6876997 acatcggataaaaaagtaaaggttgaacaccttataaataagatgacccatacactcattgtcttagggttttgggtaagagtgtggtgtttctcttgtt 6876898  T
389 tgtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||||||||| |||||||||||    
6876897 tgtgtggttgttctagcctcgatgtgga 6876870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 275 - 418
Target Start/End: Original strand, 30359280 - 30359423
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||| |||||| ||||||||||||||||| |||||||||||||||| ||| | ||||||||||||||||||||||||    
30359280 gagttatatgtctcacatcggataaaagagtaaatgttgaacaccttataagcaagaggacccataaacccatagccttaaggttttgggtaagagtgtg 30359379  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtggatg 418  Q
     |||||||||| ||||||  |||||| ||| ||| |||||||||    
30359380 gtgtctctctttcttgtgatgttgttttagcctcaatgtggatg 30359423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 278 - 416
Target Start/End: Original strand, 5420663 - 5420801
Alignment:
278 ttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatg 377  Q
    |||||||||  ||||| |||| |||||||||||||||||| ||||||||||||||||| ||||||| ||||| |||||||||||  |||||||||||| |    
5420663 ttatatgtcccacatcggatagaatagtaaaggttgaacatcttataagtaagaggactcataaacccattgccttaaggttttttgtaagagtgtgacg 5420762  T
378 tctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |||| || |||||||||||||||| || |||||||||||    
5420763 tctccctcacttgtgtggttgttcaagcctcgatgtgga 5420801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 30359618 - 30359759
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||||||||||| |||||| |||||||||||||||||||||||||| ||||||| |||   |||||| |||||||||||||||||    
30359618 gagttatatgtctcacatcagataaaagagtaaaagttgaacaccttataagtaagaggactcataaacccataaccttaagattttgggtaagagtgtg 30359717  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     |||||||||||||| || ||||||||||   ||||||||||    
30359718 gtgtctctcttacttatgcggttgttctaacttcgatgtgga 30359759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 275 - 403
Target Start/End: Complemental strand, 70423 - 70295
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||| |||||| |||||||| ||||||||||||||||||||||||| || || ||||||||||| ||||||||||||    
70423 gagttatatgtcccacatcggataaaagagtaaatgttgaacatcttataagtaagaggacccataaacccactgccttaaggttttaggtaagagtgtg 70324  T
375 atgtctctcttacttgtgtggttgttcta 403  Q
    | |||| |||| |||||||||||||||||    
70323 acgtctatcttgcttgtgtggttgttcta 70295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 298 - 416
Target Start/End: Original strand, 40518103 - 40518221
Alignment:
298 aaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggtt 397  Q
    |||| |||||||||||||||||||||||||||  |||||||||||| || || ||||||||||||||||||||||||  ||||||||| |||||||||||    
40518103 aaaaaagtaaaggttgaacaccttataagtaaatggacccataaacccaatgccttaaggttttgggtaagagtgtggcgtctctcttgcttgtgtggtt 40518202  T
398 gttctagtctcgatgtgga 416  Q
    ||||||| || ||||||||    
40518203 gttctagccttgatgtgga 40518221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 275 - 404
Target Start/End: Original strand, 147460 - 147589
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||| ||||||||||||||||||||||| |||||||||||||||||  |||| ||||| ||||||||||||||||||    
147460 gagttatatgtcccacatcggataaaagagtaaaggttgaacaccttataaataagaggacccataaacctattgccttaaagttttgggtaagagtgtg 147559  T
375 atgtctctcttacttgtgtggttgttctag 404  Q
      ||||||||| |||||| ||| |||||||    
147560 gcgtctctcttgcttgtgcggtagttctag 147589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 1514064 - 1513923
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||| ||  ||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||| |||   ||||||||||||||||| ||||||    
1514064 gagttatatatcccacatcggataaaagagtaaaggttgaacaccttataagtaagaggacccttaaacccataaccttaaggttttgggtaaaagtgtg 1513965  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     | |||||||||| |||| |||| |||||| |||||||||||    
1513964 gtatctctcttacatgtggggttattctagcctcgatgtgga 1513923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 8918913 - 8918772
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||| |||||  ||||||||||  | |||||||||||||||| ||||||||||||||||||||||||  |||| ||||||||||||||||||||||||    
8918913 gagttacatgtcccacatcagatagcagagtaaaggttgaacactttataagtaagaggacccataaacctattgacttaaggttttgggtaagagtgtg 8918814  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    | |||| |||| | |||||||||||| ||  |||||||||||    
8918813 acgtctttcttgcgtgtgtggttgttttaacctcgatgtgga 8918772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 9309364 - 9309504
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||| |||||| |||||||||||||||||||||||||||| ||||| ||||| |||||||| | |||||||||||||    
9309364 gagttatatgtcccacatcggataaaagagtaaatgttgaacaccttataagtaagaggacccttaaactcattgccttaaggtgtcgggtaagagtgtg 9309463  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     ||||||||| |  | |||||||||||||| |||||||||||    
9309464 gtgtctctctca-gtatgtggttgttctagcctcgatgtgga 9309504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 9482753 - 9482612
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||   ||||  ||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| || ||| |||||  ||||||||||    
9482753 gagttatatgttccacatgggataaaagagtaaaggttgaacaccttataagtaagaggacccataaacccattgcctaaagattttgtataagagtgtg 9482654  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     | |||||||| |||||| ||||||||||| |||||||||||    
9482653 gtatctctcttgcttgtgcggttgttctagcctcgatgtgga 9482612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 295 - 416
Target Start/End: Complemental strand, 40579635 - 40579514
Alignment:
295 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtg 394  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||  ||||  |||||||||| |||||||||||| ||||||| || |||||  |    
40579635 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacttattgctttaaggttttaggtaagagtgtggtgtctctattgcttgtacg 40579536  T
395 gttgttctagtctcgatgtgga 416  Q
    |||||||||  |||||||||||    
40579535 gttgttctatcctcgatgtgga 40579514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 45123015 - 45123156
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagag--tg 372  Q
    ||||||||||||  ||||| |||||||||||||||||| |||||||||  ||||||| |||||||||||  ||| |||||||||||||||||||||  ||    
45123015 gagttatatgtcccacatcggataaaatagtaaaggttaaacacctta--agtaagatgacccataaacctattttcttaaggttttgggtaagagagtg 45123112  T
373 tgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    || ||||||||||| ||||| |||||||||| ||||||||||||    
45123113 tggtgtctctcttatttgtggggttgttctaatctcgatgtgga 45123156  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 289 - 416
Target Start/End: Complemental strand, 45121791 - 45121664
Alignment:
289 acatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttact 388  Q
    ||||| ||||||| |||||||||||| ||||||||||||||||||| ||||||||  |  | |||||||||||| ||||||||||||| |||||||||||    
45121791 acatcggataaaagagtaaaggttgatcaccttataagtaagaggatccataaacctacagccttaaggttttgagtaagagtgtgatatctctcttact 45121692  T
389 tgtgtggttgttctagtctcgatgtgga 416  Q
    | || ||||||||||| |||||||||||    
45121691 tatggggttgttctagcctcgatgtgga 45121664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 71; E-Value: 7e-32
Query Start/End: Original strand, 296 - 414
Target Start/End: Complemental strand, 18372122 - 18372004
Alignment:
296 ataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtgg 395  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||| |||||  ||||||||||||||||||||||| ||| |||||  |||||| ||    
18372122 ataaaatagtaaaggttgaacaccttataagtaagaggatccataaactcattgctttaaggttttgggtaagagtgtggtgtttctctcgcttgtgcgg 18372023  T
396 ttgttctagtctcgatgtg 414  Q
    ||| ||||| ||| |||||    
18372022 ttgctctagcctcaatgtg 18372004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 9608754 - 9608895
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  | ||| |||| || ||||||||||||||||||||||||||||| ||||||||||| |||   |||||||||||||||| |||||||    
9608754 gagttatatgtcccatatcggatagaaaagtaaaggttgaacaccttataagtaagatgacccataaacccatcaccttaaggttttgggtatgagtgtg 9608853  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
      ||||||||| || ||| ||||||||||| |||||||||||    
9608854 gcgtctctcttgctagtgaggttgttctagcctcgatgtgga 9608895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 45122059 - 45121918
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  |||||  ||||||||||||||||||||||| |||||||||||||||| ||||||| ||||| |||||| |||||||||| ||||||    
45122059 gagttatatgtcccacatcgcataaaatagtaaaggttgaacactttataagtaagaggactcataaactcattgccttaagattttgggtaacagtgtg 45121960  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
      |||||| || || |||||||| ||| || |||||||||||    
45121959 gcgtctcttttgctcgtgtggttattcaagcctcgatgtgga 45121918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 66; E-Value: 7e-29
Query Start/End: Original strand, 327 - 416
Target Start/End: Original strand, 5915928 - 5916017
Alignment:
327 taagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||||||||||| ||||| |||||||||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||||||    
5915928 taagaggacccataaactcattgccttaaggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 5916017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 255 - 420
Target Start/End: Original strand, 6731895 - 6732049
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctta 354  Q
    |||||| ||||||||||||||  |||||||||  ||||| |||||||||||||||||||||         |||||||| |||||||||  ||||| ||||    
6731895 gtgttgttttgcaagtgtgag--ttatatgtcccacatcggataaaatagtaaaggttgaa---------agtaagagaacccataaattcattgcctta 6731983  T
355 aggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtggatgat 420  Q
    |||||||| ||||||||||| |||||||||| ||| || ||||||||||  |||||||||||||||    
6731984 aggttttgagtaagagtgtggtgtctctcttgcttatgcggttgttctaacctcgatgtggatgat 6732049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 289 - 403
Target Start/End: Original strand, 9609108 - 9609222
Alignment:
289 acatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttact 388  Q
    |||||||||| || ||||||||||||||| ||||||||||||| ||||||||||| ||| | ||||| ||||| ||||||||||||  ||||||||| ||    
9609108 acatcagatagaaaagtaaaggttgaacatcttataagtaagatgacccataaacccatcgccttaatgttttcggtaagagtgtggcgtctctcttgct 9609207  T
389 tgtgtggttgttcta 403  Q
     ||||||||||||||    
9609208 agtgtggttgttcta 9609222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 9308986 - 9309131
Alignment:
275 gagttatatgtcataca--tcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaag---a 369  Q
    |||||||||||| ||||  |||||||||| |||||| ||||||||  |||||||||||||||||||||||| ||||| || ||||||||||| |||   |    
9308986 gagttatatgtcctacacatcagataaaagagtaaaagttgaacatgttataagtaagaggacccataaacccattgcctaaaggttttgggcaagagta 9309085  T
370 gtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||| ||||||||| || | |||||||||||||| |||||||||||    
9309086 gtgtggtgtctctctcac-tatgtggttgttctagcctcgatgtgga 9309131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 18371805 - 18371669
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||| ||||| |||||||||||||||||||||||     ||||||||| ||||||||||| || || ||||||||||||||||||||||||    
18371805 gagttatatgtcacacatcggataaaatagtaaaggttgaaca----ttaagtaagaagacccataaaccca-tgccttaaggttttgggtaagagtgtg 18371711  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     ||| ||||| | ||||| ||||| |||||  ||||||||||    
18371710 gtgtgtctctcatttgtgcggttgctctagcttcgatgtgga 18371669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 275 - 379
Target Start/End: Complemental strand, 43274928 - 43274824
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||   ||||||||||||| ||||||||||||| |  ||||||||||||||||||||||||  ||||||||||||||||| |||||||||||    
43274928 gagttatatgtttcacatcagataaaagagtaaaggttgaatatattataagtaagaggacccataaacctattgtcttaaggttttgagtaagagtgtg 43274829  T
375 atgtc 379  Q
     ||||    
43274828 gtgtc 43274824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 303 - 416
Target Start/End: Original strand, 9507819 - 9507932
Alignment:
303 agtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttct 402  Q
    ||||||||||||| ||||||||||||||||||| ||||||| ||||  ||||||||||||||||||||||||  |||||| |  ||| | |||||||||     
9507819 agtaaaggttgaataccttataagtaagaggactcataaacccattaccttaaggttttgggtaagagtgtggcgtctctatctcttatatggttgttca 9507918  T
403 agtctcgatgtgga 416  Q
    || |||||||||||    
9507919 agcctcgatgtgga 9507932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 275 - 415
Target Start/End: Complemental strand, 4154429 - 4154290
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||| ||||||||||| || |||  ||||||||||| |||||||| |||| |||||||||| ||||| |||||  ||||||||||| |||||    
4154429 gagttatatgtcctacatcagatagaaaagtggaggttgaacactttataagtgagag-acccataaactcattgccttaatattttgggtaagtgtgtg 4154331  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgg 415  Q
    |||||||||| | |||| |||||| ||| | || |||||||    
4154330 atgtctctctcaattgtttggttgctctggcctagatgtgg 4154290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 275 - 418
Target Start/End: Original strand, 6651512 - 6651646
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||||||||||||||||| |         |||||| |||||||||  ||||| ||||||||||||||||||||||||    
6651512 gagttatatgtctcacatcggataaaatagtaaaggttgaaaa---------taagagaacccataaattcattgccttaaggttttgggtaagagtgtg 6651602  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtggatg 418  Q
     |||||||||| |||||| | ||||||||  |||||||||||||    
6651603 gtgtctctcttgcttgtgcgattgttctaacctcgatgtggatg 6651646  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 276 - 415
Target Start/End: Original strand, 12283883 - 12284021
Alignment:
276 agttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtga 375  Q
    |||||||||||  || |||||||||| |||||| |||||| | |||| |||||| | ||| ||||||| ||  ||||||||||||||| |||||||||      
12283883 agttatatgtcccacgtcagataaaaaagtaaatgttgaatatcttaaaagtaaaatgacacataaactcaa-gtcttaaggttttggataagagtgtag 12283981  T
376 tgtctctcttacttgtgtggttgttctagtctcgatgtgg 415  Q
    ||||||||| ||||||||||||||||||| ||| ||||||    
12283982 tgtctctctcacttgtgtggttgttctagcctctatgtgg 12284021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 275 - 338
Target Start/End: Complemental strand, 18372848 - 18372785
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggaccca 338  Q
    ||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||    
18372848 gagttatatgtcacacatcggataaaatagtaaaggttgaacaccttataagtaagaggaccca 18372785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 275 - 414
Target Start/End: Complemental strand, 32640676 - 32640542
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||| ||||  ||||| ||||||| |||||||||||||||     || ||||||||||| |||||| ||||| |||||||||||||||||||||||     
32640676 gagttatctgtctcacatcggataaaagagtaaaggttgaaca-----taggtaagaggaccgataaacccattgccttaaggttttgggtaagagtgtt 32640582  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtg 414  Q
      ||||||||| ||| |||| ||||||||| |||||||||    
32640581 gcgtctctcttgcttttgtgattgttctagcctcgatgtg 32640542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 275 - 401
Target Start/End: Original strand, 41972167 - 41972296
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggtt---ttgggtaagagt 371  Q
    ||||||||||||  ||||| |||| || ||||||||||||||||||||||||| | ||||||||||||| ||||| | ||| |||   ||||||||||||    
41972167 gagttatatgtcccacatcggatagaaaagtaaaggttgaacaccttataagtgataggacccataaacccattgccataaagttttgttgggtaagagt 41972266  T
372 gtgatgtctctcttacttgtgtggttgttc 401  Q
    |||  ||| ||||| |||||||||||||||    
41972267 gtggcgtcactcttgcttgtgtggttgttc 41972296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 256 - 343
Target Start/End: Complemental strand, 41416335 - 41416252
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaac 343  Q
    ||||||||||||||||    |||||||||||  ||||| |||||||||||||||||||||||||||||||||||||||| ||||||||    
41416335 tgttggtttgcaagtg----agttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggatccataaac 41416252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 295 - 416
Target Start/End: Original strand, 32305506 - 32305627
Alignment:
295 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtg 394  Q
    ||||||||||||||||||||||||||||||||||||| |||| |||||| ||||  |||||| |||||| ||||||||||  |||| | |||||| ||      
32305506 gataaaatagtaaaggttgaacaccttataagtaagaagacctataaacccattaccttaagattttggataagagtgtggcgtctttattacttatgca 32305605  T
395 gttgttctagtctcgatgtgga 416  Q
    |||||||||  || ||||||||    
32305606 gttgttctaaccttgatgtgga 32305627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 345 - 416
Target Start/End: Original strand, 41129067 - 41129138
Alignment:
345 cattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |  |||||||||||    
41129067 cattgtcttaaggttttgggtatgagtgtggtgtctctcttacttgtgtggttgttcaaacctcgatgtgga 41129138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 275 - 384
Target Start/End: Original strand, 8794120 - 8794229
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||| | |||| |||||||| ||||||||||||||||| |||||||  | | |||||||||||||||| |||||| |    
8794120 gagttatatgtctcacatcggataaaagaataaatgttgaacatcttataagtaagaggactcataaacctaatatcttaaggttttgggtgagagtgcg 8794219  T
375 atgtctctct 384  Q
     |||||||||    
8794220 gtgtctctct 8794229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 334 - 414
Target Start/End: Original strand, 147888 - 147968
Alignment:
334 acccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtg 414  Q
    ||||||||||  |||| |||||||||||||||||||||||| |||||||||||||||||  |||||||||| ||| |||||    
147888 acccataaacctattgccttaaggttttgggtaagagtgtggtgtctctcttacttgtgcagttgttctagcctcaatgtg 147968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 275 - 398
Target Start/End: Complemental strand, 9620825 - 9620704
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||| |||||| || |||| | ||||| ||| |||||||| ||||||||||||||| ||||| |||||| ||||   ||||||| ||    
9620825 gagttatatgtctcacaacagatagaaaagtagaagttgatcactttataagtgagaggacccataaactcattgccttaagatttt--ataagagtttg 9620728  T
375 atgtctctcttacttgtgtggttg 398  Q
    |||||||||| |||||||||||||    
9620727 atgtctctctcacttgtgtggttg 9620704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 289 - 356
Target Start/End: Complemental strand, 3037843 - 3037776
Alignment:
289 acatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaag 356  Q
    ||||| ||| |||||||||| |||||||||||||||||||||||||| ||||||| ||||||||||||    
3037843 acatcggatgaaatagtaaatgttgaacaccttataagtaagaggactcataaacccattgtcttaag 3037776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 275 - 338
Target Start/End: Complemental strand, 18372405 - 18372342
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggaccca 338  Q
    ||||||||||||  ||||| ||||||||||||||||||||||||||||||||||||| ||||||    
18372405 gagttatatgtctcacatcggataaaatagtaaaggttgaacaccttataagtaagaagaccca 18372342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 275 - 374
Target Start/End: Complemental strand, 18380166 - 18380067
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||| ||  |||||  ||||||||||||||||||||||||||||||||||| || || |||||| || |  |||||||||||| |||||||||||    
18380166 gagttatatatcccacatcgaataaaatagtaaaggttgaacaccttataagtaagggggcctataaacccactaccttaaggttttgagtaagagtgtg 18380067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 278 - 370
Target Start/End: Complemental strand, 18373077 - 18372988
Alignment:
278 ttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagag 370  Q
    |||||||||  || || ||||||||||||||||||||||||||||||| ||||||||| ||||||| ||||| |   ||||||||||||||||    
18373077 ttatatgtcccacttcggataaaatagtaaaggttgaacaccttataaataagaggactcataaactcattgcc---aggttttgggtaagag 18372988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 251 - 383
Target Start/End: Complemental strand, 4154836 - 4154707
Alignment:
251 atttgtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgt 350  Q
    |||||||||| | ||||||||||||  |||||||||  ||||| |||| || |||  ||||||||||| |||||||| | ||||||||||||| |||||     
4154836 atttgtgttg-tgtgcaagtgtgag--ttatatgtcccacatctgatagaaaagtggaggttgaacactttataagtgaaaggacccataaactcattgc 4154740  T
351 cttaaggttttgggtaagagtgtgatgtctctc 383  Q
    |  |||||||||||||||||||||  |||||||    
4154739 cccaaggttttgggtaagagtgtggcgtctctc 4154707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 295 - 374
Target Start/End: Complemental strand, 18372731 - 18372656
Alignment:
295 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||| |   ||||||||||||||||||||    
18372731 gataaaatagtaaaggttgaaca-cttataagtaagaggactcataaacccattgcc---aggttttgggtaagagtgtg 18372656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 276 - 339
Target Start/End: Complemental strand, 25561792 - 25561729
Alignment:
276 agttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccat 339  Q
    |||||||||||  ||||| ||||||| |||||||||||||||||||||||||||||| ||||||    
25561792 agttatatgtcccacatcggataaaagagtaaaggttgaacaccttataagtaagagtacccat 25561729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 345 - 416
Target Start/End: Complemental strand, 40579348 - 40579277
Alignment:
345 cattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||| |||| | ||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||||||    
40579348 cattgccttaggattttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 40579277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 351 - 416
Target Start/End: Complemental strand, 8919217 - 8919152
Alignment:
351 cttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||||||| |||||||||| ||||||| || ||||||||||||||||||  ||||||||||    
8919217 cttaaggttttggataagagtgtggtgtctcttttgcttgtgtggttgttctagcttcgatgtgga 8919152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 352 - 404
Target Start/End: Original strand, 16524451 - 16524503
Alignment:
352 ttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctag 404  Q
    ||||||||||| ||||||||||| ||||||||||||||||||||||| |||||    
16524451 ttaaggttttgagtaagagtgtggtgtctctcttacttgtgtggttgctctag 16524503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 302 - 358
Target Start/End: Complemental strand, 18373292 - 18373236
Alignment:
302 tagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggt 358  Q
    |||||||||||||||||||||||| |||||||| |||| ||| ||||||||||||||    
18373292 tagtaaaggttgaacaccttataaataagaggatccattaacccattgtcttaaggt 18373236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 337 - 378
Target Start/End: Complemental strand, 12156745 - 12156704
Alignment:
337 cataaacacattgtcttaaggttttgggtaagagtgtgatgt 378  Q
    ||||||| ||||||||||||||||||||||||||||||||||    
12156745 cataaacccattgtcttaaggttttgggtaagagtgtgatgt 12156704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 345 - 398
Target Start/End: Complemental strand, 20995495 - 20995442
Alignment:
345 cattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttg 398  Q
    ||||| ||||||||||||||||||| |||| ||||||||| |||||||||||||    
20995495 cattgccttaaggttttgggtaagaatgtggtgtctctctcacttgtgtggttg 20995442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 303 - 415
Target Start/End: Complemental strand, 43398192 - 43398077
Alignment:
303 agtaaaggttgaacaccttataagtaa---gaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgt 399  Q
    ||||||||||||||||||||||| |||   |||||||||||||  ||||| ||||| ||||||| ||||| ||||  || ||| ||||| ||| |||||     
43398192 agtaaaggttgaacaccttataaataagaggaggacccataaattcattgccttaaagttttggataagaatgtggcgtttcttttactagtgcggttgc 43398093  T
400 tctagtctcgatgtgg 415  Q
    ||||  ||||||||||    
43398092 tctaacctcgatgtgg 43398077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 275 - 382
Target Start/End: Original strand, 5274784 - 5274891
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||  |||||   |||||| || | ||||||||||| |||||| |  || ||||||||||  ||||| |||||| ||||| |||||||||||    
5274784 gagttatatgttctacattgaataaaaaaggagaggttgaacactttataaatgggaagacccataaaatcattgccttaagattttgagtaagagtgtg 5274883  T
375 atgtctct 382  Q
    ||||||||    
5274884 atgtctct 5274891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 310 - 363
Target Start/End: Original strand, 33832022 - 33832075
Alignment:
310 gttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgg 363  Q
    ||||||||| ||||||||||||||||| |||||||| || | ||||||||||||    
33832022 gttgaacactttataagtaagaggacctataaacacttttttttaaggttttgg 33832075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 279 - 371
Target Start/End: Original strand, 20130462 - 20130553
Alignment:
279 tatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagt 371  Q
    ||||||||  ||||| ||||||| |||||| |||||||||||| ||||||||| || |||||||| |||   |||| |||||| |||||||||    
20130462 tatatgtctcacatcggataaaagagtaaaagttgaacacctt-taagtaagatgatccataaacccataaccttacggttttaggtaagagt 20130553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 360 - 416
Target Start/End: Complemental strand, 43274699 - 43274643
Alignment:
360 ttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||| ||||||| |||||||||||||| || |||||||| || |||||||||||    
43274699 ttgggtatgagtgtggtgtctctcttacttatggggttgttccagcctcgatgtgga 43274643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 308 - 365
Target Start/End: Original strand, 40991795 - 40991852
Alignment:
308 aggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggt 365  Q
    ||||||||||| | |||||| ||||||||||||||| || || || ||||||||||||    
40991795 aggttgaacacttcataagtgagaggacccataaacccaatgcctcaaggttttgggt 40991852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 116; Significance: 1e-58; HSPs: 50)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 116; E-Value: 1e-58
Query Start/End: Original strand, 256 - 414
Target Start/End: Original strand, 3409251 - 3409407
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||||||||||  |||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||    
3409251 tgttggtttgcaagtgtgag--ttatatgtcccacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaactcattgccttaa 3409348  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtg 414  Q
    ||||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||||    
3409349 ggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtg 3409407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 111; E-Value: 1e-55
Query Start/End: Original strand, 255 - 416
Target Start/End: Original strand, 29518911 - 29519070
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctta 354  Q
    |||||||||||||||||||||  |||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||  ||||    
29518911 gtgttggtttgcaagtgtgag--ttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattacctta 29519008  T
355 aggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||||||    
29519009 aggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 29519070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 256 - 416
Target Start/End: Original strand, 29518495 - 29518653
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||||||||||  |||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||  |||||    
29518495 tgttggtttgcaagtgtgag--ttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaa 29518592  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||||||    
29518593 ggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 29518653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 110; E-Value: 4e-55
Query Start/End: Original strand, 256 - 416
Target Start/End: Original strand, 32741171 - 32741329
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||||||||||  |||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||  |||||    
32741171 tgttggtttgcaagtgtgag--ttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattaccttaa 32741268  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||||||    
32741269 ggttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 32741329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 103; E-Value: 6e-51
Query Start/End: Original strand, 255 - 416
Target Start/End: Original strand, 2378117 - 2378276
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctta 354  Q
    |||||||||||||||||||||  |||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||  ||||    
2378117 gtgttggtttgcaagtgtgag--ttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattacctta 2378214  T
355 aggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||| ||||||| |||| |||||||||| |||| ||||||||||||| |||||||||||    
2378215 aggttttaggtaagaatgtggtgtctctcttgcttgagtggttgttctagcctcgatgtgga 2378276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 98; E-Value: 6e-48
Query Start/End: Original strand, 256 - 416
Target Start/End: Original strand, 35210196 - 35210354
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||||||||||  |||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||  ||||| |||||    
35210196 tgttggtttgcaagtgtgag--ttatatgtctcacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaaaccattgccttaa 35210293  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||||||||||||| ||| ||| || |||||| ||||| ||||| |||||||||||    
35210294 ggttttgggtaagagtgtggtgtttcttttgcttgtgcggttgctctagcctcgatgtgga 35210354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 95; E-Value: 4e-46
Query Start/End: Original strand, 255 - 416
Target Start/End: Original strand, 3409651 - 3409810
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctta 354  Q
    |||||||||||||||||||||  ||||||||   |||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||| |||     
3409651 gtgttggtttgcaagtgtgag--ttatatgtaccacatcagataaaatagtaaaagttgaacatcttataagtaagaggacccataaacccattgccttt 3409748  T
355 aggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |  ||||||||||||||||| |||||||||| |||||| ||||||||||| |||||||||||    
3409749 attttttgggtaagagtgtggtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 3409810  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 95; E-Value: 4e-46
Query Start/End: Original strand, 254 - 416
Target Start/End: Original strand, 3415448 - 3415610
Alignment:
254 tgtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctt 353  Q
    ||||||||||||| ||||||||  |||||||||  |||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |||    
3415448 tgtgttggtttgcgagtgtgag--ttatatgtcccacatcacataaaatagtaaaggttgaacaccatataagtaagaggacccataaacccattgcctt 3415545  T
354 aaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgt--tctagtctcgatgtgga 416  Q
    |||||||| |||||||||||| |||||||||| |||||| ||||||  ||||| |||||||||||    
3415546 aaggtttttggtaagagtgtggtgtctctcttgcttgtgcggttgttctctagcctcgatgtgga 3415610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 93; E-Value: 6e-45
Query Start/End: Original strand, 289 - 417
Target Start/End: Complemental strand, 10074498 - 10074370
Alignment:
289 acatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttact 388  Q
    ||||| |||| || ||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| ||||||||| |||    
10074498 acatcggatagaaaagtaaaggttgaacaccttataagtaagaggacccataaactcattgccttaaggttttgggtaagagtgtggtgtctctctcact 10074399  T
389 tgtgtggttgttctagtctcgatgtggat 417  Q
     ||||||||||||||| ||||||||||||    
10074398 agtgtggttgttctagcctcgatgtggat 10074370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 256 - 414
Target Start/End: Original strand, 26544041 - 26544197
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||||||||||  |||||||||  ||||| |||||||||||||||||||||||| |||||||||||||||||||||||| ||  | |||||    
26544041 tgttggtttgcaagtgtgag--ttatatgtcccacatcggataaaatagtaaaggttgaacacgttataagtaagaggacccataaacccaccgccttaa 26544138  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtg 414  Q
    ||||||| |||||||||||||||||||||| |||||| | ||||||||| ||| |||||    
26544139 ggttttgagtaagagtgtgatgtctctcttgcttgtgcgattgttctagcctcaatgtg 26544197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 2377763 - 2377904
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| | ||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||    
2377763 gagttatatgtcccacatcggttaaaagagtaaaggttgaacaccttataagtaagaggacccataaacccattgccttaaggttttgggtaagagtgtg 2377862  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     ||||| |||| |||| |||||| |||||| |||||||||||    
2377863 gtgtctttcttgcttgagtggtttttctagcctcgatgtgga 2377904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 256 - 416
Target Start/End: Original strand, 3058218 - 3058376
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||||||| ||  |||||||||  ||||| |||||||||||||||||||||||||||||||||| ||||| |||||||| ||||| |||||    
3058218 tgttggtttgcaagtgttag--ttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtatgaggatccataaacccattgccttaa 3058315  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||||||||||||| |||||||||| |||||  ||| ||||||  |||||||||||    
3058316 ggttttgggtaagagtgtggtgtctctcttgcttgtagggtggttctaacctcgatgtgga 3058376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 16454916 - 16455057
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||| ||||  ||||||||||||| ||||||||||||||||||||||||||| |||||||||||||  |||| ||||||||||||||||||||||||    
16454916 gagttatgtgtcccacatcagataaaagagtaaaggttgaacaccttataagtaataggacccataaacctattgccttaaggttttgggtaagagtgtg 16455015  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
      ||||||||| |||||| ||||||||||| |||||||||||    
16455016 gcgtctctcttgcttgtgcggttgttctagcctcgatgtgga 16455057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 256 - 416
Target Start/End: Complemental strand, 14748504 - 14748350
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||| ||||||||||||||  |||||||||  ||||| ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||  ||||    
14748504 tgttgatttgcaagtgtgag--ttatatgtcccacatcggataaaatagtaaaggttgaacaccttataaataagaggacccataaactcattgcgttaa 14748407  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||||||||||||     |||||| |||||||||||||||||| |||||||||||    
14748406 ggttttgggtaagagtgtg----gtctcttgcttgtgtggttgttctagcctcgatgtgga 14748350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 2580021 - 2579880
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||| |||||||||||||||| |||||||||||||||||||||||| ||  | ||||||||||||||||||| ||||    
2580021 gagttatatgtcccacatcggataaaagagtaaaggttgaacacattataagtaagaggacccataaacccacagccttaaggttttgggtaagaatgtg 2579922  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     |||||||||| |||||| ||||||||||| |||||||||||    
2579921 gtgtctctcttgcttgtgcggttgttctagcctcgatgtgga 2579880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 256 - 415
Target Start/End: Original strand, 1127352 - 1127509
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    ||||||||||||| ||||||  |||||| ||  ||||| | ||||||||||||||||||||||||||||||||||||||| ||||||| ||||  |||||    
1127352 tgttggtttgcaactgtgag--ttatatatcccacatcgggtaaaatagtaaaggttgaacaccttataagtaagaggactcataaacccattaccttaa 1127449  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgg 415  Q
    |||||||||||||||||||  ||||||||||||| |||||||| ||||  ||||||||||    
1127450 ggttttgggtaagagtgtggcgtctctcttacttatgtggttgctctaacctcgatgtgg 1127509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 257 - 416
Target Start/End: Original strand, 1846741 - 1846898
Alignment:
257 gttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaag 356  Q
    ||||| ||||||||||||   || ||||||  ||||| |||||||||||||||||||||||||||||||||||||| |||||||||  ||||| ||||||    
1846741 gttgggttgcaagtgtgaa--ttctatgtctcacatcggataaaatagtaaaggttgaacaccttataagtaagagcacccataaatccattgccttaag 1846838  T
357 gttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||| |||||||||| ||||||| || |||||| ||||||||||| |||||||||||    
1846839 gttttggataagagtgtggtgtctcttttgcttgtgcggttgttctagcctcgatgtgga 1846898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 275 - 415
Target Start/End: Original strand, 16107687 - 16107827
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||   ||||| ||||||| |||||||||| |||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||    
16107687 gagttatatgtgtcacatcggataaaaaagtaaaggttaaacaccttataagtaagaggactcataaacccattgccttaaggttttgggtaagagtgtg 16107786  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgg 415  Q
     |||||||||| |||||| ||||| ||||| ||||||||||    
16107787 gtgtctctcttgcttgtgcggttgctctagcctcgatgtgg 16107827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 2843563 - 2843705
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggaccc-ataaacacattgtcttaaggttttgggtaagagtgt 373  Q
    |||||||||||   ||||| ||||||||| |||| |||||||||||||||||||||||||||| |||||| ||||| |||||||||||||||||||||||    
2843563 gagttatatgtttcacatcggataaaataataaaagttgaacaccttataagtaagaggaccccataaactcattgccttaaggttttgggtaagagtgt 2843662  T
374 gatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    | | |||||||| |||| ||||||||||||| |||||||||||    
2843663 ggtatctctcttgcttgagtggttgttctagcctcgatgtgga 2843705  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 10911574 - 10911716
Alignment:
275 gagttatatgtcatacatcagataaaata-gtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgt 373  Q
    |||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||||| ||||||| ||||| ||||| ||||||  |||||||||    
10911574 gagttatatgtcctacatcagataaaaaaagtaaaggttgaacaccttataagtaagaggactcataaactcattgccttaaagttttgaataagagtgt 10911673  T
374 gatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||||||||  ||| ||||||| || |||||||||||    
10911674 gatgtctctcttactaatgttgttgttcaagcctcgatgtgga 10911716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 295 - 416
Target Start/End: Complemental strand, 2578572 - 2578451
Alignment:
295 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtg 394  Q
    ||||||| |||||||||||||||| |||||||||||||||||||||||| ||| | |||||||||||||||||||||||| ||||||| || |||||| |    
2578572 gataaaagagtaaaggttgaacactttataagtaagaggacccataaacccatagccttaaggttttgggtaagagtgtggtgtctcttttgcttgtgcg 2578473  T
395 gttgttctagtctcgatgtgga 416  Q
    |||||||||| |||||||||||    
2578472 gttgttctagcctcgatgtgga 2578451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 6999945 - 6999804
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||| |||||| ||||||| |||||| ||||||||||||||| ||||||||| |||||||| || || ||||||||||||| ||||||||||    
6999945 gagttatatgtcctacatcggataaaaaagtaaaagttgaacaccttatatgtaagaggatccataaactcactgccttaaggttttggataagagtgtg 6999846  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
      ||||||||| ||  ||||||||||||||||||||||||||    
6999845 gcgtctctcttgctaatgtggttgttctagtctcgatgtgga 6999804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 16454584 - 16454725
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||| ||||  ||||||||||||| | |||| |||||||||||||||||||||||||||||||||| ||||| |||||| |||||| ||||||||||    
16454584 gagttatgtgtcccacatcagataaaagaataaaagttgaacaccttataagtaagaggacccataaacccattgccttaagattttggataagagtgtg 16454683  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
      ||||||||| |||||| ||||||||||| |||||||||||    
16454684 gcgtctctcttgcttgtgcggttgttctagcctcgatgtgga 16454725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 78; E-Value: 5e-36
Query Start/End: Original strand, 303 - 416
Target Start/End: Complemental strand, 10073737 - 10073624
Alignment:
303 agtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttct 402  Q
    |||||||||||||||||||||||||||||||| |||||||| ||||| |||||| ||||||||||||||||| ||||||||| ||| |||||||||||||    
10073737 agtaaaggttgaacaccttataagtaagaggatccataaactcattggcttaagattttgggtaagagtgtggtgtctctctcactagtgtggttgttct 10073638  T
403 agtctcgatgtgga 416  Q
    ||  ||||||||||    
10073637 agcatcgatgtgga 10073624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 76; E-Value: 8e-35
Query Start/End: Original strand, 275 - 418
Target Start/End: Complemental strand, 2579641 - 2579498
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| || |||| ||||||||| | | ||||||||||||||||| ||||||||| ||||| ||||||||||||||||| ||| ||    
2579641 gagttatatgtcccacatcggacaaaaaagtaaaggtcggataccttataagtaagagggcccataaactcattgccttaaggttttgggtaaaagtatg 2579542  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtggatg 418  Q
     |||||||||| |||||||||||||||||  |||||||||||||    
2579541 gtgtctctcttgcttgtgtggttgttctaacctcgatgtggatg 2579498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 275 - 409
Target Start/End: Complemental strand, 1950334 - 1950200
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||| |||||||||||||||||||| ||||||||||| |||||||   | || |||||||||||| |||||||||||    
1950334 gagttatatgtcccacatcggataaaagagtaaaggttgaacaccttacaagtaagaggagccataaatctaatgccttaaggttttgagtaagagtgtg 1950235  T
375 atgtctctcttacttgtgtggttgttctagtctcg 409  Q
    | |||||||||||||||| ||||||||||| ||||    
1950234 acgtctctcttacttgtgcggttgttctagcctcg 1950200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 276 - 413
Target Start/End: Complemental strand, 5832174 - 5832038
Alignment:
276 agttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtga 375  Q
    |||||||||||  ||||  ||||||| ||||||||||||||||||||||||||||||||||||||||  ||    |||||| |||||||||| ||||||     
5832174 agttatatgtcccacattggataaaagagtaaaggttgaacaccttataagtaagaggacccataaagccaccc-cttaagattttgggtaaaagtgtgg 5832076  T
376 tgtctctcttacttgtgtggttgttctagtctcgatgt 413  Q
    ||||||||||||||||||||||||||||| ||||||||    
5832075 tgtctctcttacttgtgtggttgttctagcctcgatgt 5832038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 10074140 - 10073999
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||| ||  ||||| |||| || |||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||    
10074140 gagttatatatcccacatcggatagaaaagtaaacgttgaacaccttataagtaagaggacccataaacccattgccttaaggttttgggtaaaagtgtg 10074041  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     |||||||||  ||| | |||||||||||| ||||| |||||    
10074040 gtgtctctctcgcttatttggttgttctagcctcgacgtgga 10073999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 275 - 391
Target Start/End: Complemental strand, 9062498 - 9062383
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| ||||||||||||||||||||||| ||||||||||||||||| ||||||| ||||||||||| ||||||||||| ||||||    
9062498 gagttatatgtcccacatcggataaaatagtaaaggttgaacatcttataagtaagaggactcataaactcattgtcttaa-gttttgggtaaaagtgtg 9062400  T
375 atgtctctcttacttgt 391  Q
     | ||||||||||||||    
9062399 gtatctctcttacttgt 9062383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 275 - 375
Target Start/End: Complemental strand, 32460729 - 32460629
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  |||||  |||||||||||||||||||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||||||||||    
32460729 gagttatatgtcccacatcgtataaaatagtaaaggttgaacaccttataagtaagaggactcataaacccattgccttaaggttttgggtaagagtgtg 32460630  T
375 a 375  Q
    |    
32460629 a 32460629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 275 - 413
Target Start/End: Complemental strand, 593858 - 593718
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||| ||||||  ||||| ||||||| ||||||||||||||||||||||||||||||||| |||||||  | || ||||||||||||||||| ||||||    
593858 gagttgtatgtcccacatcggataaaagagtaaaggttgaacaccttataagtaagaggactcataaaccgactgccttaaggttttgggtaatagtgtg 593759  T
375 --atgtctctcttacttgtgtggttgttctagtctcgatgt 413  Q
      || ||||||||||||||  ||||||||||| ||||||||    
593758 gtatctctctcttacttgtacggttgttctaggctcgatgt 593718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 5958752 - 5958615
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||  |||||| ||||||| ||||||||||||||||||||||| |||||| || ||||||| ||||||||||| ||||||||  ||||||||    
5958752 gagttatatgtgttacatcggataaaacagtaaaggttgaacaccttataaataagagaactcataaactcattgtcttaaagttttgggatagagtgtg 5958653  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||    |||||||| ||||||||  |||||||||||    
5958652 atgtctct----cttgtgtgattgttctaacctcgatgtgga 5958615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 290 - 416
Target Start/End: Complemental strand, 2578968 - 2578843
Alignment:
290 catcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttactt 389  Q
    |||| ||||||| |||||| |||||| ||||||||| |||||||| |||||||| ||||  |||||||||||||||||||||||| ||||||| || |||    
2578968 catcggataaaa-agtaaatgttgaataccttataaataagaggatccataaactcattaccttaaggttttgggtaagagtgtggtgtctcttttgctt 2578870  T
390 gtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||||||   |||||||||||    
2578869 gtgtggttgttctgacctcgatgtgga 2578843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 275 - 357
Target Start/End: Original strand, 16108072 - 16108154
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaagg 357  Q
    |||||||||||   ||||||||||||| |||||| |||||||||||||||||||||||||||||||||| ||||| |||||||    
16108072 gagttatatgttccacatcagataaaagagtaaatgttgaacaccttataagtaagaggacccataaacccattgccttaagg 16108154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 276 - 414
Target Start/End: Complemental strand, 2579253 - 2579119
Alignment:
276 agttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtga 375  Q
    |||||||||||  ||||| ||||||| |||||| |||||||||||||||||    |||| |||||||| |||    |||||| ||||| ||||||||||     
2579253 agttatatgtcccacatcggataaaagagtaaaagttgaacaccttataag----aggaaccataaacccataactttaaggctttggctaagagtgtgg 2579158  T
376 tgtctctcttacttgtgtggttgttctagtctcgatgtg 414  Q
    |||||||||| || ||||||||||||||| |||||||||    
2579157 tgtctctcttgctcgtgtggttgttctagcctcgatgtg 2579119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 275 - 412
Target Start/End: Complemental strand, 12085182 - 12085046
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||| | ||||||||| || |||  || |||||||| ||||||   | ||||| ||||||  ||| | ||||||||||||||||||||||||    
12085182 gagttatatgtcctgcatcagatagaa-agtggagtttgaacactttataatagaaaggactcataaaaccatggccttaaggttttgggtaagagtgtg 12085084  T
375 atgtctctcttacttgtgtggttgttctagtctcgatg 412  Q
      |||||||| ||||||||||||||||||| |||||||    
12085083 gcgtctctctcacttgtgtggttgttctagcctcgatg 12085046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 275 - 386
Target Start/End: Original strand, 8481936 - 8482046
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  |||||||||| || |||  ||||||||||| |||||| | ||| ||| ||||||| ||||| |||||| |||||||||||||||||    
8481936 gagttatatgtcc-acatcagatataaaagtggaggttgaacactttataaatgagatgactcataaactcattgccttaagattttgggtaagagtgtg 8482034  T
375 atgtctctctta 386  Q
     |||||||||||    
8482035 gtgtctctctta 8482046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 351 - 414
Target Start/End: Complemental strand, 12071764 - 12071701
Alignment:
351 cttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtg 414  Q
    ||||||||||||||||||||||||  |||||||| ||||||||||||||||||| |||||||||    
12071764 cttaaggttttgggtaagagtgtggcgtctctctcacttgtgtggttgttctagcctcgatgtg 12071701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 308 - 415
Target Start/End: Complemental strand, 12092598 - 12092491
Alignment:
308 aggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtct 407  Q
    ||||||| ||| |||||||| |||||| |||||||| ||||| |||||||||||| |||||| |||| ||||||||| ||||||| ||||| ||| | ||    
12092598 aggttgagcactttataagtgagaggatccataaactcattgccttaaggttttgagtaagactgtggtgtctctctcacttgtgaggttgctctggcct 12092499  T
408 cgatgtgg 415  Q
     |||||||    
12092498 ggatgtgg 12092491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 289 - 382
Target Start/End: Original strand, 2975575 - 2975668
Alignment:
289 acatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctct 382  Q
    |||||| ||| || |||||| ||||||||||||||||| |||| ||||||||||  | ||||||||| ||||||  ||||||||||||||||||    
2975575 acatcaaatagaaaagtaaatgttgaacaccttataagcaagatgacccataaatcctttgtcttaaagttttgaataagagtgtgatgtctct 2975668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 308 - 398
Target Start/End: Original strand, 6071174 - 6071264
Alignment:
308 aggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttg 398  Q
    ||||||||||| |||||||| ||| || |||||||| ||||| |||||| |||||| ||||||||||  ||||||||  ||||| ||||||    
6071174 aggttgaacactttataagtgagatgatccataaactcattgccttaagattttggataagagtgtggcgtctctctcgcttgtatggttg 6071264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 312 - 398
Target Start/End: Complemental strand, 30618727 - 30618643
Alignment:
312 tgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttg 398  Q
    ||||||| |||||||||||| |||| |||||| | ||||||||||||| ||||||| | |||| |||||||||||||| ||||||||    
30618727 tgaacactttataagtaagatgacc-ataaac-cgttgtcttaaggttatgggtaaaaatgtggtgtctctcttacttatgtggttg 30618643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 289 - 339
Target Start/End: Original strand, 35210501 - 35210551
Alignment:
289 acatcagataaaatagtaaaggttgaacaccttataagtaagaggacccat 339  Q
    ||||| ||||||||||||||||||||| ||||| |||||||||||||||||    
35210501 acatcggataaaatagtaaaggttgaataccttgtaagtaagaggacccat 35210551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 334 - 386
Target Start/End: Complemental strand, 11637811 - 11637759
Alignment:
334 acccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctctta 386  Q
    |||||||||| |||||||||||| |||||| |||||||||| |||||||||||    
11637811 acccataaacccattgtcttaagattttggataagagtgtggtgtctctctta 11637759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 303 - 343
Target Start/End: Complemental strand, 14789325 - 14789285
Alignment:
303 agtaaaggttgaacaccttataagtaagaggacccataaac 343  Q
    |||||||||||||||||||| ||||||||||||||||||||    
14789325 agtaaaggttgaacaccttacaagtaagaggacccataaac 14789285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 358 - 402
Target Start/End: Complemental strand, 10902496 - 10902452
Alignment:
358 ttttgggtaagagtgtgatgtctctcttacttgtgtggttgttct 402  Q
    ||||||||||||||||| ||||||||| |||||| ||||||||||    
10902496 ttttgggtaagagtgtggtgtctctctcacttgtatggttgttct 10902452  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 329 - 416
Target Start/End: Original strand, 31714732 - 31714818
Alignment:
329 agaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||||| ||| ||||| |||||||||||| |||||||||||  || | | |  |||||||||||| ||||| |||||||||||    
31714732 agaggacccattaactcattgccttaaggttttgagtaagagtgtggcgt-tttttcgcttgtgtggttgctctagcctcgatgtgga 31714818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 275 - 401
Target Start/End: Complemental strand, 17135218 - 17135092
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| |||| |  |||||| ||| || |||||||||| |||||||  ||||||| ||||||   || ||||||| ||||||||||    
17135218 gagttatatgtctcacatcggatagagaagtaaatgtttaataccttataagcaagaggattcataaactcattgttagaaagttttggataagagtgtg 17135119  T
375 atgtctctcttacttgtgtggttgttc 401  Q
    | | |||| |  |||||| ||||||||    
17135118 acggctctttcgcttgtgcggttgttc 17135092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 308 - 398
Target Start/End: Complemental strand, 34661725 - 34661635
Alignment:
308 aggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttg 398  Q
    ||||||| ||| ||||||||||||| ||||||| | | ||||||||||||||||  || | |||||| || || ||| |||||| ||||||    
34661725 aggttgatcactttataagtaagagaacccatacatatattgtcttaaggttttacgttaaagtgtggtggctgtctcacttgtatggttg 34661635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 334 - 374
Target Start/End: Complemental strand, 22605345 - 22605305
Alignment:
334 acccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||| ||||| ||||||||||||||||||| ||||    
22605345 acccataaacccattgccttaaggttttgggtaagaatgtg 22605305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 112; Significance: 3e-56; HSPs: 70)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 112; E-Value: 3e-56
Query Start/End: Original strand, 258 - 392
Target Start/End: Complemental strand, 32594880 - 32594748
Alignment:
258 ttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaagg 357  Q
    ||||||||||||||||||  ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
32594880 ttggtttgcaagtgtgag--ttatatgtcctacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaactcattgtcttaagg 32594783  T
358 ttttgggtaagagtgtgatgtctctcttacttgtg 392  Q
    ||||||||||||||||| |||||||||||||||||    
32594782 ttttgggtaagagtgtggtgtctctcttacttgtg 32594748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 104; E-Value: 2e-51
Query Start/End: Original strand, 255 - 416
Target Start/End: Complemental strand, 44290992 - 44290832
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctta 354  Q
    |||||||||||||||||||||  |||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||    
44290992 gtgttggtttgcaagtgtgag--ttatatgtcccacatcggataaaatagtaaaggttgaacaccttataagtaagaggacccataaacccattgcctta 44290895  T
355 aggttttgggt-aagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||||| ||||||||| ||| |||||| |||||| ||||||||||| |||||||||||    
44290894 aggttttgggtaaagagtgtggtgtatctcttgcttgtgcggttgttctagcctcgatgtgga 44290832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 251 - 416
Target Start/End: Original strand, 41759470 - 41759633
Alignment:
251 atttgtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgt 350  Q
    |||| ||||||||||||||||||||  |||||||||| ||||| |||||||||||||| |||||||||||||||||||||| || |||||||  |||||     
41759470 atttttgttggtttgcaagtgtgag--ttatatgtcacacatcggataaaatagtaaaagttgaacaccttataagtaagatgatccataaatccattgc 41759567  T
351 cttaaggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||||||||||||||||| |||||||||| ||| |||||||||||||| || ||||||||    
41759568 cttaaggttttgggtaagagtgtggtgtctctcttgcttatgtggttgttctagccttgatgtgga 41759633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 255 - 416
Target Start/End: Complemental strand, 44290625 - 44290466
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctta 354  Q
    |||||||||||||||||||||  |||||||||  ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| ||||    
44290625 gtgttggtttgcaagtgtgag--ttatatgtcccacatcggataaaatagtaaaggttgaacatcttataagtaagaggacccataaacccattgcctta 44290528  T
355 aggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    ||||||||||||||||| || ||||| |||| |||||  ||||||||||| |||||||||||    
44290527 aggttttgggtaagagtatggtgtctttcttgcttgtacggttgttctagcctcgatgtgga 44290466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 255 - 416
Target Start/End: Complemental strand, 48588655 - 48588496
Alignment:
255 gtgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtctta 354  Q
    |||||||||||||||||||||  || ||||||  ||||| ||||||||||||||||||||||||||||||||||||| ||||| ||||  ||||| ||||    
48588655 gtgttggtttgcaagtgtgag--ttctatgtccgacatcggataaaatagtaaaggttgaacaccttataagtaagaagacccgtaaattcattgcctta 48588558  T
355 aggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||||||||||| | ||||||||||||||||| ||||||||||| |||||||||||    
48588557 aggttttgggtaagagtgcggtgtctctcttacttgtgcggttgttctagcctcgatgtgga 48588496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 93; E-Value: 6e-45
Query Start/End: Original strand, 276 - 416
Target Start/End: Complemental strand, 3537747 - 3537607
Alignment:
276 agttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtga 375  Q
    |||||||||||  ||||| ||||||||||||||||||||||||||||| |||||||||||| |||||| ||||| ||||||||||||||||||||||||     
3537747 agttatatgtcccacatcggataaaatagtaaaggttgaacaccttatgagtaagaggacctataaacccattggcttaaggttttgggtaagagtgtgg 3537648  T
376 tgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     ||||||||| |||||| ||||||||||| |||||||||||    
3537647 cgtctctcttgcttgtgcggttgttctagcctcgatgtgga 3537607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 93; E-Value: 6e-45
Query Start/End: Original strand, 275 - 415
Target Start/End: Original strand, 41157384 - 41157524
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||||||||||| |||||| |||||||||||||||||||||||||||||||||| ||||| ||| |||||||| |||||||||||    
41157384 gagttatatgtcccacatcagataaaagagtaaaagttgaacaccttataagtaagaggacccataaacccattgcctttaggttttgagtaagagtgtg 41157483  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgg 415  Q
     ||||| |||| |||||||||||||||||| ||||||||||    
41157484 gtgtctgtcttgcttgtgtggttgttctagcctcgatgtgg 41157524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 295 - 415
Target Start/End: Original strand, 41157020 - 41157140
Alignment:
295 gataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttacttgtgtg 394  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||| |||||  ||||||||||||||||||||||| ||||||| || ||||||||    
41157020 gataaaagagtaaaggttgaacaccttataagtaagaggacccataaactcattgctttaaggttttgggtaagagtgtggtgtctctattgcttgtgtg 41157119  T
395 gttgttctagtctcgatgtgg 415  Q
    |||||||||| ||||||||||    
41157120 gttgttctagcctcgatgtgg 41157140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 256 - 416
Target Start/End: Original strand, 3550712 - 3550867
Alignment:
256 tgttggtttgcaagtgtgagagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaa 355  Q
    |||||||| |||||||||||  |||||||||  ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||| |||||    
3550712 tgttggttggcaagtgtgag--ttatatgtcccacatcagataaaatagtaaaggttgaacaccttataagtaagaggactcataaacccattgccttaa 3550809  T
356 ggttttgggtaagagtgtgatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     |||||||||||||||||| |||||||||| |   |  ||||||||||| |||||||||||    
3550810 agttttgggtaagagtgtggtgtctctcttgc---tacggttgttctagcctcgatgtgga 3550867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 88; E-Value: 5e-42
Query Start/End: Original strand, 275 - 418
Target Start/End: Original strand, 34364516 - 34364659
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| |||||||||||||||||||||||||||||||||||||||| || ||||| ||| | ||||||||||||||||||||||||    
34364516 gagttatatgtctcacatcggataaaatagtaaaggttgaacaccttataagtaagaggatccgtaaacccatagccttaaggttttgggtaagagtgtg 34364615  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtggatg 418  Q
    ||||||||||  ||| || ||||| ||||| |||||||||||||    
34364616 atgtctctctcgcttatgcggttgctctagcctcgatgtggatg 34364659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 275 - 417
Target Start/End: Original strand, 40082416 - 40082557
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||  ||||||  ||||| ||||||||||||||||||||||||    
40082416 gagttatatgtcctacatcggataaaatagtaaaggttgaacaccttataagtaagagga-tcataaattcattgccttaaggttttgggtaagagtgtg 40082514  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtggat 417  Q
     | |||||||| |||||| | ||||||||| ||||||||||||    
40082515 gtatctctcttgcttgtgcgtttgttctagcctcgatgtggat 40082557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 41142381 - 41142523
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggt-aagagtgt 373  Q
    ||||||||||||  ||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||| ||||| ||||||||||| ||| ||||||||    
41142381 gagttatatgtcccacatcggataaaacagtaaaggttgaacaccttataagtaaaaggacccataaacccattgccttaaggtttttggtaaagagtgt 41142480  T
374 gatgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
    |  ||||||||| |||||||||||||||||| |||||||||||    
41142481 ggcgtctctcttgcttgtgtggttgttctagcctcgatgtgga 41142523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 275 - 416
Target Start/End: Complemental strand, 26661671 - 26661530
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||  ||||| | ||||| ||||||||||||||||||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||||    
26661671 gagttatatgtcccacatcgggtaaaagagtaaaggttgaacaccttataagtgagaggacccataaactcattgccttaaggttttgggtaagagtgtg 26661572  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     |||||||||  ||||||||||||||| || |||||| ||||    
26661571 gtgtctctctcgcttgtgtggttgttcaagcctcgatatgga 26661530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 276 - 416
Target Start/End: Complemental strand, 3875479 - 3875339
Alignment:
276 agttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtga 375  Q
    |||||||||||| ||||| ||||||| ||||||||||| ||||||||||||||||||||| ||||||| ||||| ||||||||||| ||||||| ||||     
3875479 agttatatgtcacacatcggataaaaaagtaaaggttgtacaccttataagtaagaggactcataaacccattgccttaaggttttaggtaagaatgtgg 3875380  T
376 tgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     |||||||| ||| ||||||||||||||| |||||||||||    
3875379 agtctctctcactagtgtggttgttctagcctcgatgtgga 3875339  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 289 - 416
Target Start/End: Complemental strand, 31767296 - 31767169
Alignment:
289 acatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtgatgtctctcttact 388  Q
    ||||| ||||||| ||||||||||||||||||||||||||||||||||||| |||  | || ||||||||||||||||||||||||| |||| |||| ||    
31767296 acatcggataaaacagtaaaggttgaacaccttataagtaagaggacccattaacctaatgccttaaggttttgggtaagagtgtgacgtctatcttgct 31767197  T
389 tgtgtggttgttctagtctcgatgtgga 416  Q
    |||||||||||||||| |||||||||||    
31767196 tgtgtggttgttctagactcgatgtgga 31767169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 275 - 418
Target Start/End: Original strand, 34364934 - 34365077
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    ||||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||||||||||||||    
34364934 gagttatatgtcacacatcggataaaataataaaggttgaacaccttataagtaagaggacccataaacccatagccttaaggttttgggtaagagtgtg 34365033  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtggatg 418  Q
     |||||||||  ||| ||  |||| ||||  |||||||||||||    
34365034 gtgtctctctcgcttatgcagttgctctaacctcgatgtggatg 34365077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 275 - 414
Target Start/End: Original strand, 9955916 - 9956057
Alignment:
275 gagttatatgtcatacatcagataaaata-gtaaaggttgaacaccttataagtaagaggacccat-aaacacattgtcttaaggttttgggtaagagtg 372  Q
    ||||||||||||  ||||||||||||| | ||||||||||||||| |||||||||||||||||||| ||||  |||| ||||||||||||||||||||||    
9955916 gagttatatgtcccacatcagataaaaaaagtaaaggttgaacacattataagtaagaggacccattaaaccaattgccttaaggttttgggtaagagtg 9956015  T
373 tgatgtctctcttacttgtgtggttgttctagtctcgatgtg 414  Q
    ||||||||||||| |||||| ||||| ||||| |||||||||    
9956016 tgatgtctctcttgcttgtgcggttgctctagcctcgatgtg 9956057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 275 - 416
Target Start/End: Original strand, 14318876 - 14319017
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg 374  Q
    |||||||||||   || || ||||||||||||||||||||||||||||||||||||| ||||||||||   |||| ||||||||||||||||||||||||    
14318876 gagttatatgttccacgtcggataaaatagtaaaggttgaacaccttataagtaagaagacccataaatctattgccttaaggttttgggtaagagtgtg 14318975  T
375 atgtctctcttacttgtgtggttgttctagtctcgatgtgga 416  Q
     ||||||||||| ||||| ||||||||||| ||| |||||||    
14318976 gtgtctctcttatttgtgcggttgttctagcctcaatgtgga 14319017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 275 - 415
Target Start/End: Original strand, 37556120 - 37556260
Alignment:
275 gagttatatgtcatacatcagataaaa-tagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgt 373  Q
    ||||||||||||  ||||| ||||||| |||||||||||||||| |||||||||||||||||| |||||| ||| | |||||||||||||||||||||||    
37556120 gagttatatgtcccacatcggataaaaatagtaaaggttgaacatcttataagtaagaggacc-ataaacccatagccttaaggttttgggtaagagtgt 37556218  T
374 gatgtctctcttacttgtgtggttgttctagtctcgatgtgg 415  Q
    | |||||||||| ||||||||||||||| || ||||||||||    
37556219 ggtgtctctcttgcttgtgtggttgttcaagcctcgatgtgg 37556260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 81; E-Value: 8e-38
Query Start/End: Original strand, 275 - 403
Target Start/End: Original strand, 29798208 - 29798336
Alignment:
275 gagttatatgtcatacatcagataaaatagtaaaggttgaacaccttataagtaagaggacccataaacacattgtcttaaggttttgggtaagagtgtg