View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E66 (Length: 637)

Name: R108-tnk507-E66
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E66
R108-tnk507-E66
[»] scaffold0855 (1 HSPs)
scaffold0855 (1-454)||(1218-1671)
[»] scaffold0847 (1 HSPs)
scaffold0847 (1-454)||(1383-1836)
[»] chr8 (1 HSPs)
chr8 (27-134)||(9618948-9619053)
[»] chr3 (1 HSPs)
chr3 (456-493)||(53881498-53881535)
[»] chr4 (1 HSPs)
chr4 (27-111)||(4962393-4962476)
[»] chr2 (1 HSPs)
chr2 (371-423)||(7905710-7905762)


Alignment Details
Target: scaffold0855 (Bit Score: 395; Significance: 0; HSPs: 1)
Name: scaffold0855
Description:

Target: scaffold0855; HSP #1
Raw Score: 395; E-Value: 0
Query Start/End: Original strand, 1 - 454
Target Start/End: Original strand, 1218 - 1671
Alignment:
1 attatatggttcaagaagtttatagtgaagatcctttaattaacctaatcaaagagaaatttgctagacataaaagagaaaaataaataacatggaaatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||    
1218 attatatggttcaagaagtttatagtgaagatcctttaattaacctaatcaaagagaaatttgctggacataaa-gagaaaaataaataacatggaaatt 1316  T
101 aaaataaccatgatgatgttgcttctcaattcttcttcttcttcctctttgtatataagcgtgtgctgcttgttacccacaaaagtcttaatatttttgg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
1317 aaaataaccatgatgatgttgcttctcaattcttcttcttcttcctctttgtatataagcgtgtgctgcttgttacccacaaaagtcttaatttttttgg 1416  T
201 ggtcagccaataaagccaaataacccaaataattttatgcgcaatcgatagtttcagaaaatggatgtgcacgatctaaatcttcttctatgcatcctgt 300  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
1417 ggtcagccaataaagccaaataacccaaataatttcatgcgcaatcgataatttcagaaaatggatgtgcacgatctaaatcttcttctatgcatcctgt 1516  T
301 atgaggcagtagctgaacaattccaatttcttcacagctgcttgacgtgtaactcatagcacgtatcgtgcaacaactagtagctgaaccatctactttt 400  Q
    |||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||  |||||||||    
1517 atgaggtagtagctgaacacttccaatttcttcacagctgcttgacgtgcaactcatagcacgtatcgtgcaacaactagtagctgaactttctactttt 1616  T
401 cgtctttccttgtctcatttctctctaccg-aatggtcatggtgactatacccca 454  Q
    |||||||||||||||||||| ||||||||| |||| |||||||||||||||||||    
1617 cgtctttccttgtctcatttttctctaccgaaatgttcatggtgactatacccca 1671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0847 (Bit Score: 395; Significance: 0; HSPs: 1)
Name: scaffold0847
Description:

Target: scaffold0847; HSP #1
Raw Score: 395; E-Value: 0
Query Start/End: Original strand, 1 - 454
Target Start/End: Original strand, 1383 - 1836
Alignment:
1 attatatggttcaagaagtttatagtgaagatcctttaattaacctaatcaaagagaaatttgctagacataaaagagaaaaataaataacatggaaatt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||    
1383 attatatggttcaagaagtttatagtgaagatcctttaattaacctaatcaaagagaaatttgctggacataaa-gagaaaaataaataacatggaaatt 1481  T
101 aaaataaccatgatgatgttgcttctcaattcttcttcttcttcctctttgtatataagcgtgtgctgcttgttacccacaaaagtcttaatatttttgg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
1482 aaaataaccatgatgatgttgcttctcaattcttcttcttcttcctctttgtatataagcgtgtgctgcttgttacccacaaaagtcttaatttttttgg 1581  T
201 ggtcagccaataaagccaaataacccaaataattttatgcgcaatcgatagtttcagaaaatggatgtgcacgatctaaatcttcttctatgcatcctgt 300  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
1582 ggtcagccaataaagccaaataacccaaataatttcatgcgcaatcgataatttcagaaaatggatgtgcacgatctaaatcttcttctatgcatcctgt 1681  T
301 atgaggcagtagctgaacaattccaatttcttcacagctgcttgacgtgtaactcatagcacgtatcgtgcaacaactagtagctgaaccatctactttt 400  Q
    |||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||  |||||||||    
1682 atgaggtagtagctgaacacttccaatttcttcacagctgcttgacgtgcaactcatagcacgtatcgtgcaacaactagtagctgaactttctactttt 1781  T
401 cgtctttccttgtctcatttctctctaccg-aatggtcatggtgactatacccca 454  Q
    |||||||||||||||||||| ||||||||| |||| |||||||||||||||||||    
1782 cgtctttccttgtctcatttttctctaccgaaatgttcatggtgactatacccca 1836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 27 - 134
Target Start/End: Original strand, 9618948 - 9619053
Alignment:
27 gaagatcctttaattaacctaatcaaagagaaatttgctagacataaaagagaaaaataaataacatggaaattaaaataaccatgatgatgttgcttct 126  Q
    ||||||||| ||  ||||||||||||| |||||||  ||||| ||| | ||||||| ||||||||||||||| ||||||||||| |||| ||||||| ||    
9618948 gaagatcctctacgtaacctaatcaaatagaaattaactagaaataga-gagaaaa-taaataacatggaaagtaaaataaccacgatggtgttgctcct 9619045  T
127 caattctt 134  Q
    | ||||||    
9619046 cgattctt 9619053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 34; Significance: 0.0000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 456 - 493
Target Start/End: Complemental strand, 53881535 - 53881498
Alignment:
456 aattgagatagtaagggcctctatgggaaaatatccca 493  Q
    |||||||||||||||||||||||| |||||||||||||    
53881535 aattgagatagtaagggcctctattggaaaatatccca 53881498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 4962393 - 4962476
Alignment:
27 gaagatcctttaattaacctaatcaaagagaaatttgctagacataaaagagaaaaataaataacatggaaattaaaataaccat 111  Q
    ||||||| | || ||||||||||||| ||||| || | |||||||  | ||||| ||||||||||||| ||| ||||||||||||    
4962393 gaagatcatctacttaacctaatcaaggagaatttagttagacatgga-gagaagaataaataacatgaaaagtaaaataaccat 4962476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 371 - 423
Target Start/End: Complemental strand, 7905762 - 7905710
Alignment:
371 caacaactagtagctgaaccatctacttttcgtctttccttgtctcatttctc 423  Q
    ||||||||||||| |||||| || ||||||| |  ||||||||||||||||||    
7905762 caacaactagtagttgaaccttcaacttttcttaattccttgtctcatttctc 7905710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 203350 times since January 2019
Visitors: 1517