View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E73 (Length: 565)

Name: R108-tnk507-E73
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E73
R108-tnk507-E73
[»] chr2 (6 HSPs)
chr2 (1-305)||(38580655-38580959)
chr2 (1-215)||(38605860-38606074)
chr2 (1-214)||(38561439-38561661)
chr2 (309-398)||(38581152-38581241)
chr2 (395-527)||(38579984-38580118)
chr2 (11-146)||(38622328-38622460)
[»] chr4 (1 HSPs)
chr4 (52-154)||(30195177-30195279)


Alignment Details
Target: chr2 (Bit Score: 277; Significance: 1e-155; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 277; E-Value: 1e-155
Query Start/End: Original strand, 1 - 305
Target Start/End: Original strand, 38580655 - 38580959
Alignment:
1 gtaacaaaaattcaatggatcataatcaacaaggaggtcaaccttcttcttcaaccaaagtggaaagaaagattgttgagaaaaataggagaaaccaaat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38580655 gtaacaaaaattcaatggatcataatcaacaaggaggtcaaccttcttcttcaaccaaagtggaaagaaagattgttgagaaaaataggagaaaccaaat 38580754  T
101 gaagatcctcttttctaacctcaactctattctccctagctataatccaaaggtaatttgttttgttttttaataaaccaaaggtgatctgtttaatttc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38580755 gaagatcctcttttctaacctcaactctattctccctagctataatccaaaggtaatttgttttgttttttaataaaccaaaggtgatctgtttaatttc 38580854  T
201 cattacattcatataaagatattgttaaagagtttcacatcggataaaaaataacttgaatacgtgtttataaactgggacaatcctcatttataagttg 300  Q
    |||| |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||  ||| |||||||| ||||||||||||    
38580855 catttcattcatataaatatattgttaaagagtttcacatcggataaaaaatgacttgaatacgtgtttataagttggaacaatccttatttataagttg 38580954  T
301 gtttt 305  Q
    |||||    
38580955 gtttt 38580959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 38605860 - 38606074
Alignment:
1 gtaacaaaaattcaatggatcataatcaacaaggaggtcaaccttcttcttcaaccaaagtggaaagaaagattgttgagaaaaataggagaaaccaaat 100  Q
    |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38605860 gtaacaaaaattcaatggatcaaaatcaacaaggaggtcgaccttcttcttcaaccaaagtggaaagaaagattgttgagaaaaataggagaaaccaaat 38605959  T
101 gaagatcctcttttctaacctcaactctattctccctagctataatccaaaggtaatttgttttgttttttaataaaccaaaggtgatctgtttaatttc 200  Q
    |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||   |||||| |||| |||||||||||||||||||||||    
38605960 gaagatcctcttttctaacctcaactctcttctccctagctataatccaaaggtgattttttgattttttttataagccaaaggtgatctgtttaatttc 38606059  T
201 cattacattcatata 215  Q
    ||| |||||||||||    
38606060 catcacattcatata 38606074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 139; E-Value: 2e-72
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 38561439 - 38561661
Alignment:
1 gtaacaaaaattcaatggatcataatcaacaaggaggtcaaccttcttcttcaaccaaagtggaaagaaagattgttgagaaaaataggagaaaccaaat 100  Q
    |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38561439 gtaacaaaaattcaatggatcaaaatcaacaaggaggtcgaccttcttcttcaaccaaagtggaaagaaagattgttgagaaaaataggagaaaccaaat 38561538  T
101 gaagatcctcttttctaacctcaactctattctccctagctataatccaaaggtaatttgttttgtttttt---------aataaaccaaaggtgatctg 191  Q
    |||||||||||||||||| ||||||||| |||||||||||||||||| |||||| |||| |||  ||||||          ||||||||||||  |||||    
38561539 gaagatcctcttttctaaactcaactctcttctccctagctataatcaaaaggtgatttctttgttttttttttcttttctataaaccaaagggtatctg 38561638  T
192 tttaatttccattacattcatat 214  Q
    |||||||||||| ||||||||||    
38561639 tttaatttccatcacattcatat 38561661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 309 - 398
Target Start/End: Original strand, 38581152 - 38581241
Alignment:
309 ttcatgtgaggtataaattgacattgagttttcttttagagatttgcaactacaatgttatttcatacattgacatctaaaatcacaatt 398  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||    
38581152 ttcatgtgaggtataaattgacattgagttttcttttagagatttgtaactataatgttatttcatacattgacatctaaaatcacaatt 38581241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 395 - 527
Target Start/End: Original strand, 38579984 - 38580118
Alignment:
395 aattcatctttttaagttgaataaatagggngnctagagntcgaactccagtttttatatataacaatacatgatgtctctgtc-actgaactataccag 493  Q
    |||||||||||||||| ||||||| || || | ||||||  |||||| |||||||||||||||||||||||||||||||||||| |||||||||||| ||    
38579984 aattcatctttttaagatgaataagtaaggtgtctagagtccgaacttcagtttttatatataacaatacatgatgtctctgtcaactgaactatactag 38580083  T
494 taagaatacncgat-anaagagcttatccttttaa 527  Q
    |||| |||| |||| | |||||||||| |||||||    
38580084 taaggatactcgataataagagcttattcttttaa 38580118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 11 - 146
Target Start/End: Complemental strand, 38622460 - 38622328
Alignment:
11 ttcaatggatcataatcaacaaggaggtcaaccttcttcttcaaccaaagtggaaagaaagattgttgagaaaaataggagaaaccaaatgaagatcctc 110  Q
    ||||||||| ||| ||||||||| | |||||||||||||   ||||||||| ||||||||| | |||||||||||||||||||| || ||||||||||||    
38622460 ttcaatggaccatgatcaacaagaatgtcaaccttcttc---aaccaaagtcgaaagaaaggtcgttgagaaaaataggagaaatcagatgaagatcctc 38622364  T
111 ttttctaacctcaactctattctccctagctataat 146  Q
    | ||| || || |||||| |||| ||||||||||||    
38622363 tattccaaacttaactctcttcttcctagctataat 38622328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 39; Significance: 0.0000000000009; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000009
Query Start/End: Original strand, 52 - 154
Target Start/End: Original strand, 30195177 - 30195279
Alignment:
52 caaccaaagtggaaagaaagattgttgagaaaaataggagaaaccaaatgaagatcctcttttctaacctcaactctattctccctagctataatccaaa 151  Q
    |||||||||| ||||||| | | ||||| ||||| || ||||| || |||||||||||||  || || ||||||||| ||||||||| ||||||||| ||    
30195177 caaccaaagttgaaagaaggctcgttgaaaaaaacagaagaaatcagatgaagatcctctactccaaactcaactctcttctccctaactataatcccaa 30195276  T
152 ggt 154  Q
    |||    
30195277 ggt 30195279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 310083 times since January 2019
Visitors: 444