View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E74 (Length: 626)

Name: R108-tnk507-E74
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E74
R108-tnk507-E74
[»] chr3 (2 HSPs)
chr3 (220-468)||(31059225-31059474)
chr3 (225-362)||(31085252-31085389)


Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 220 - 468
Target Start/End: Original strand, 31059225 - 31059474
Alignment:
220 caattggaccatatgaaaccgaccagtatatgcatcagcaataaatcctcctaccagaggcattaaagttgttactcctatccaggtgtttacattttta 319  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31059225 caattggaccatatgaaatcgaccagtatatgcatcagcaataaatcctcctaccagaggcattaaagttgttactcctatccaggtgtttacattttta 31059324  T
320 gcagctgttttgagatcttcatgaatcacttcagttaggtatgtgataaggttcatggttagtccatagtggctcatcctttcactaatttcaaccactg 419  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31059325 gcagctgttttgagatcttcatgaatcacttcagtcaggtatgtgataaggttcatggttagtccatagtggctcatcctttcactaatttcaaccactg 31059424  T
420 ctcaaaatcnagt-aaacatgttacatggtaaagcattgatgaaataaaa 468  Q
    ||||||||| ||| |||||||||||||| |||||||||||||||||||||    
31059425 ctcaaaatcaagtaaaacatgttacatgttaaagcattgatgaaataaaa 31059474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 225 - 362
Target Start/End: Original strand, 31085252 - 31085389
Alignment:
225 ggaccatatgaaaccgaccagtatatgcatcagcaataaatcctcctaccagaggcattaaagttgttactcctatccaggtgtttacatttttagcagc 324  Q
    |||||||| |||| |||||| | || |||||||||| |||||| ||||  |||||||| || ||||||  ||||  |||   ||||||||| || || ||    
31085252 ggaccataggaaatcgaccaatgtaagcatcagcaagaaatccacctattagaggcatcaaggttgttgttcctgaccaatagtttacattctttgctgc 31085351  T
325 tgttttgagatcttcatgaatcacttcagttaggtatg 362  Q
     ||||| ||||||||||| ||||| | ||| |||||||    
31085352 agttttaagatcttcatgcatcaccttagtaaggtatg 31085389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201972 times since January 2019
Visitors: 1513