View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E81 (Length: 667)

Name: R108-tnk507-E81
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E81
R108-tnk507-E81
[»] chr5 (2 HSPs)
chr5 (101-416)||(27977807-27978119)
chr5 (1-93)||(27977671-27977763)
[»] chr6 (1 HSPs)
chr6 (416-455)||(19815460-19815499)
[»] scaffold0015 (1 HSPs)
scaffold0015 (427-460)||(69023-69056)


Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 101 - 416
Target Start/End: Original strand, 27977807 - 27978119
Alignment:
101 ctcatgaatataataaccagcttacttttgtgannnnnnncatgtcttacgcaattaattaatactttgatttgcttccaaaacacacttctttaactcc 200  Q
    ||||||||||||||||||||||||||||| |||       |||||||||| ||||||||     | ||||||||||||||||||||||||||||||||||    
27977807 ctcatgaatataataaccagcttacttttatgatttttttcatgtcttacacaattaatac---cattgatttgcttccaaaacacacttctttaactcc 27977903  T
201 aatatactccattagcaacaaattgaaatggaccgcaatcgcnnnnnnnggtttatatattctatttaccattccaaatacataagtcaaattaattatt 300  Q
    |||||||||||||||||||||||||||||||||| |||||||       |||||||||||| ||||||||||||||||||||||| ||||||||||||||    
27977904 aatatactccattagcaacaaattgaaatggaccacaatcgctttttttggtttatatattgtatttaccattccaaatacataaatcaaattaattatt 27978003  T
301 atcaatatagaaggacctattttgacctactgcaatgtcccaactgctcttcaacattcgattaccagcattatgggagttcaagacgttgttggcaccg 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27978004 atcaatatagaaggacctattttgacctactgcaatgtcccaactgctcttcaacattcgattaccagcattatgggagttcaagacgttgttggcaccg 27978103  T
401 gtaagtacttgggtct 416  Q
    |||||||||| |||||    
27978104 gtaagtacttaggtct 27978119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 27977671 - 27977763
Alignment:
1 ctaatttcaaggttggattttcttctataattcttgaatctttaaaatccatgtatttgtgtttaatgtgttcatatattcagaaagcaaatg 93  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27977671 ctaatttcaaggttggattttcttctataattcttgcatctttaaaatccatgtatttgtgtttaatgtgttcatatattcagaaagcaaatg 27977763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 416 - 455
Target Start/End: Original strand, 19815460 - 19815499
Alignment:
416 tagcagatacaaaaataatttgactttattttataatttg 455  Q
    |||||||||| |||||||||||||||||||||||||||||    
19815460 tagcagatacgaaaataatttgactttattttataatttg 19815499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0015 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0015
Description:

Target: scaffold0015; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 427 - 460
Target Start/End: Original strand, 69023 - 69056
Alignment:
427 aaaataatttgactttattttataatttggtata 460  Q
    |||||||||||||||||||||||| |||||||||    
69023 aaaataatttgactttattttatattttggtata 69056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201505 times since January 2019
Visitors: 1513