View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk507-E89 (Length: 202)

Name: R108-tnk507-E89
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk507-E89
R108-tnk507-E89
[»] chr3 (2 HSPs)
chr3 (1-147)||(11493037-11493183)
chr3 (141-202)||(11492980-11493041)


Alignment Details
Target: chr3 (Bit Score: 143; Significance: 2e-75; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 143; E-Value: 2e-75
Query Start/End: Original strand, 1 - 147
Target Start/End: Original strand, 11493037 - 11493183
Alignment:
1 gttactacggtttttcggaaggtacacaaataggatacatgcatcgctaatgaagtaaagttaatggccacgtttcctttgagtttgggaaaatatttca 100  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
11493037 gttactacggtttttcggatggtacacaaataggatacatgcatcgctaatgaagtaaagttaatggccacgtttcctttgagtttgggaaaatatttca 11493136  T
101 gggagggaaatatattgaatgaagaacaactaattcgaaagaattca 147  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
11493137 gggagggaaatatattgaatgaagaacaactaattcgaaagaattca 11493183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 141 - 202
Target Start/End: Original strand, 11492980 - 11493041
Alignment:
141 gaattcatatataggattagaggcaaataaaacagtctacattctatattactagaagttac 202  Q
    |||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||    
11492980 gaattcatatataggagtagaggcaaataaaacagtctacattctaaattactagaagttac 11493041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126367 times since January 2019
Visitors: 1390