View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk52-1 (Length: 150)

Name: R108-tnk52-1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk52-1
R108-tnk52-1
[»] chr2 (1 HSPs)
chr2 (24-150)||(41739965-41740092)


Alignment Details
Target: chr2 (Bit Score: 112; Significance: 6e-57; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 112; E-Value: 6e-57
Query Start/End: Original strand, 24 - 150
Target Start/End: Complemental strand, 41740092 - 41739965
Alignment:
24 ggagattcatggacttcttattgttgtcaatttagaggg-ttgtcgatttttgttatctgctgaataattgatatttctagtatggttagttgctgctac 122  Q
    |||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
41740092 ggagattcatagacttcttattgttgtcaatttagaggggttgtcgatttttgttatctgctgaataattgatatttctagtatggttagttgctgctaa 41739993  T
123 tttcaataatcatatgcctgtttaggat 150  Q
    ||||||||||||||||||||||||||||    
41739992 tttcaataatcatatgcctgtttaggat 41739965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108006 times since January 2019
Visitors: 1329