View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk55-10 (Length: 832)

Name: R108-tnk55-10
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk55-10
R108-tnk55-10
[»] chr8 (7 HSPs)
chr8 (1-412)||(13630139-13630548)
chr8 (1-412)||(13730551-13730960)
chr8 (510-832)||(13630646-13630969)
chr8 (510-832)||(13731058-13731381)
chr8 (48-197)||(13748418-13748567)
chr8 (689-813)||(13749570-13749694)
chr8 (48-106)||(13647993-13648051)
[»] chr3 (2 HSPs)
chr3 (48-205)||(9276514-9276671)
chr3 (688-790)||(9277125-9277227)


Alignment Details
Target: chr8 (Bit Score: 380; Significance: 0; HSPs: 7)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 1 - 412
Target Start/End: Original strand, 13630139 - 13630548
Alignment:
1 gcgcaaagaggaacaatggcgaatatctaactttgttacattttccaatgtgtttaggtcccgtggaacttgctgctgctggagtttccattgctttgtt 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13630139 gcgcaaagagaaacaatggcgaatatctaactttgttacattttccaatgtgtttaggtcccgtggaacttgctgctgctggagtttccattgctttgtt 13630238  T
101 caaccaagcttcaaagatcaccatatttcctcttgttagtattacaacttcctttgtagctgaggaagatactatcaaaaggatgaatatcaaagcagct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13630239 caaccaagcttcaaagatcaccatatttcctcttgttagtattacaacttcctttgtagctgaggaagatactatcaaaaggatgaatatcaaagcagct 13630338  T
201 gaaaatgataagagtaaattaactgaagtaacacctgagagtgatgtggttcaagacatagagaaagggacacccaaagagagtattaagactcaaaaag 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||    
13630339 gaaaatgataagagtaaattaactgaagtaacacctgagagtgatgtggttcaagacatagagaaagggacacccaaagagagtaataaggctcaaaaag 13630438  T
301 aatctgtggtaggacacaatgaaacaaatgggtacacttgggaacaatgataagactaatggagttgggtatactttctctctcccctatctctttccat 400  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||    
13630439 aatctgtggtaggacacaatgaaacaaat-ggtacacttgggaacaatgataagactaatggagtt-ggtatactttctctctcccctgtctctttccat 13630536  T
401 ctatatatatta 412  Q
    ||||||||||||    
13630537 ctatatatatta 13630548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 1 - 412
Target Start/End: Original strand, 13730551 - 13730960
Alignment:
1 gcgcaaagaggaacaatggcgaatatctaactttgttacattttccaatgtgtttaggtcccgtggaacttgctgctgctggagtttccattgctttgtt 100  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13730551 gcgcaaagagaaacaatggcgaatatctaactttgttacattttccaatgtgtttaggtcccgtggaacttgctgctgctggagtttccattgctttgtt 13730650  T
101 caaccaagcttcaaagatcaccatatttcctcttgttagtattacaacttcctttgtagctgaggaagatactatcaaaaggatgaatatcaaagcagct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13730651 caaccaagcttcaaagatcaccatatttcctcttgttagtattacaacttcctttgtagctgaggaagatactatcaaaaggatgaatatcaaagcagct 13730750  T
201 gaaaatgataagagtaaattaactgaagtaacacctgagagtgatgtggttcaagacatagagaaagggacacccaaagagagtattaagactcaaaaag 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||    
13730751 gaaaatgataagagtaaattaactgaagtaacacctgagagtgatgtggttcaagacatagagaaagggacacccaaagagagtaataaggctcaaaaag 13730850  T
301 aatctgtggtaggacacaatgaaacaaatgggtacacttgggaacaatgataagactaatggagttgggtatactttctctctcccctatctctttccat 400  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||    
13730851 aatctgtggtaggacacaatgaaacaaat-ggtacacttgggaacaatgataagactaatggagtt-ggtatactttctctctcccctgtctctttccat 13730948  T
401 ctatatatatta 412  Q
    ||||||||||||    
13730949 ctatatatatta 13730960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 510 - 832
Target Start/End: Original strand, 13630646 - 13630969
Alignment:
510 ccgcaatcatgtttagtacgtcttagaattctcctttgcaaaattttaannnnnnnnn-gtcactagtttttgttgattatttaactattattctagcag 608  Q
    ||||||||||||||||||| ||||| |||||||||||||||||||||||          |||||||||||||||||||||||| ||||||||||||||||    
13630646 ccgcaatcatgtttagtacatcttaaaattctcctttgcaaaattttaattttgtttttgtcactagtttttgttgattattttactattattctagcag 13630745  T
609 tgatgaataatgaacaagaaccccatttactatcctcagattctaggagcagtaagattaaggagatagttgtgaagaagaagaagagacacattgcttc 708  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13630746 tgatgaataatgaacaagaaccccatttactatcctcagattctaggagcagtaagattaaggagatagttgtgaagaagaagaagagacacattgcttc 13630845  T
709 agcatcaacagcactactctttggctcaattcttggtctcctacaagcttcagtccttatatttggagctaaacctctattatatgtgatgggtgtaaaa 808  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13630846 tgcatcaacagcactactctttggctcaattcttggtctcctacaagcttcagtccttatatttggagctaaacctctattatatgtgatgggtgtaaaa 13630945  T
809 catgtaagattatttatgttagat 832  Q
    ||||||||||||||||||||||||    
13630946 catgtaagattatttatgttagat 13630969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 510 - 832
Target Start/End: Original strand, 13731058 - 13731381
Alignment:
510 ccgcaatcatgtttagtacgtcttagaattctcctttgcaaaattttaannnnnnnnn-gtcactagtttttgttgattatttaactattattctagcag 608  Q
    ||||||||||||||||||| ||||| |||||||||||||||||||||||          |||||||||||||||||||||||| ||||||||||||||||    
13731058 ccgcaatcatgtttagtacatcttaaaattctcctttgcaaaattttaattttgtttttgtcactagtttttgttgattattttactattattctagcag 13731157  T
609 tgatgaataatgaacaagaaccccatttactatcctcagattctaggagcagtaagattaaggagatagttgtgaagaagaagaagagacacattgcttc 708  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13731158 tgatgaataatgaacaagaaccccatttactatcctcagattctaggagcagtaagattaaggagatagttgtgaagaagaagaagagacacattgcttc 13731257  T
709 agcatcaacagcactactctttggctcaattcttggtctcctacaagcttcagtccttatatttggagctaaacctctattatatgtgatgggtgtaaaa 808  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13731258 tgcatcaacagcactactctttggctcaattcttggtctcctacaagcttcagtccttatatttggagctaaacctctattatatgtgatgggtgtaaaa 13731357  T
809 catgtaagattatttatgttagat 832  Q
    ||||||||||||||||||||||||    
13731358 catgtaagattatttatgttagat 13731381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 110; E-Value: 5e-55
Query Start/End: Original strand, 48 - 197
Target Start/End: Original strand, 13748418 - 13748567
Alignment:
48 atgtgtttaggtcccgtggaacttgctgctgctggagtttccattgctttgttcaaccaagcttcaaagatcaccatatttcctcttgttagtattacaa 147  Q
    ||||| ||||| || |||||||||||||| || |||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||    
13748418 atgtggttaggaccggtggaacttgctgcagcaggagtttccattgctttgttcaaccaagcttcaaggattaccatatttcctcttgttagtattacaa 13748517  T
148 cttcctttgtagctgaggaagatactatcaaaaggatgaatatcaaagca 197  Q
    ||||||||||||||||||||||||||||  |||| |||||||||||||||    
13748518 cttcctttgtagctgaggaagatactattgaaagaatgaatatcaaagca 13748567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 689 - 813
Target Start/End: Original strand, 13749570 - 13749694
Alignment:
689 aagaagagacacattgcttcagcatcaacagcactactctttggctcaattcttggtctcctacaagcttcagtccttatatttggagctaaacctctat 788  Q
    ||||||||||||||||||||||||||||||||||| || || ||| |||| ||||| ||  | ||| || || | ||||||||||||||||||| |||||    
13749570 aagaagagacacattgcttcagcatcaacagcactccttttcggcacaatgcttggcctaattcaaactacaatacttatatttggagctaaacttctat 13749669  T
789 tatatgtgatgggtgtaaaacatgt 813  Q
    ||  ||  |||||| ||||||||||    
13749670 tagctgccatgggtataaaacatgt 13749694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 48 - 106
Target Start/End: Original strand, 13647993 - 13648051
Alignment:
48 atgtgtttaggtcccgtggaacttgctgctgctggagtttccattgctttgttcaacca 106  Q
    ||||| ||||| || |||||||||||||| || ||||||||||||||||||||||||||    
13647993 atgtggttaggaccggtggaacttgctgcagcaggagtttccattgctttgttcaacca 13648051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 74; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 74; E-Value: 2e-33
Query Start/End: Original strand, 48 - 205
Target Start/End: Original strand, 9276514 - 9276671
Alignment:
48 atgtgtttaggtcccgtggaacttgctgctgctggagtttccattgctttgttcaaccaagcttcaaagatcaccatatttcctcttgttagtattacaa 147  Q
    ||||||||||| || || |||||||| || || ||||||||||||||| |||||||||||||||||| ||| ||||| |||||| | || ||||||||||    
9276514 atgtgtttagggccggttgaacttgcggcagcaggagtttccattgctgtgttcaaccaagcttcaaggattaccatttttcctttggtcagtattacaa 9276613  T
148 cttcctttgtagctgaggaagatactatcaaaaggatgaatatcaaagcagctgaaaa 205  Q
    |||||||||||||||| |||||||||||  | || || |||| ||||||||| |||||    
9276614 cttcctttgtagctgaagaagatactatggatagaatcaataccaaagcagcagaaaa 9276671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 9e-20
Query Start/End: Original strand, 688 - 790
Target Start/End: Original strand, 9277125 - 9277227
Alignment:
688 gaagaagagacacattgcttcagcatcaacagcactactctttggctcaattcttggtctcctacaagcttcagtccttatatttggagctaaacctcta 787  Q
    ||||||||| |||||||||||||||||||||||| |||| |||||| || ||||||| ||  | |||||| ||  ||||||||||| |||||||||||||    
9277125 gaagaagaggcacattgcttcagcatcaacagcattactttttggcacagttcttggccttattcaagctgcaacccttatatttgcagctaaacctcta 9277224  T
788 tta 790  Q
    |||    
9277225 tta 9277227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110519 times since January 2019
Visitors: 1335