View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk55-2 (Length: 624)

Name: R108-tnk55-2
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk55-2
R108-tnk55-2
[»] chr4 (2 HSPs)
chr4 (1-624)||(21001482-21002100)
chr4 (122-503)||(20991625-20992012)


Alignment Details
Target: chr4 (Bit Score: 565; Significance: 0; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 565; E-Value: 0
Query Start/End: Original strand, 1 - 624
Target Start/End: Original strand, 21001482 - 21002100
Alignment:
1 gtcccttgtgcaccgtagaattgcccttacaaaaggagaaaaaataatattcggaataataagataatatggatatggtttgaatgatacatcatacatg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
21001482 gtcccttgtgcaccgtagaattgcccttacaaaaggagaaaaaataatatccggaataataagataatatggatatggtttgaatgatacatcatacatg 21001581  T
101 tgatgtttggacaaactattatatataaggaaatttagaaatcaattgcaaagaggtaatttgagatactctaacatgtgttacgataaaatattgttgt 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
21001582 tgatgtttggacaaactattatatataaggaaatttagaaatcaattgtaaagaggtaatttgagatactctaacatgtgttacgataaaatattgttgt 21001681  T
201 gttgcaattttttaatttattcttacagtcctccttaaagcaaagctcattaagctataaaaagaaaggaatgtatatgggattcaaccaaacatgattg 300  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| |||||||||||||||||||    
21001682 gttgcaattttttaatttattcttacagtcctccttaaagcaaagctcattaagctataaaaagaaa--aatgtatatgg-attcaaccaaacatgattg 21001778  T
301 gaaagtcaacttccgactaaaagagggcaaacaggctatttgcgataaatgtatattaagggtgatcggaattcatgttcgtctggtaaaagaaaagaat 400  Q
     |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
21001779 -aaagtcaact-ccgactaaaagagggcaaacaggctatttgcgataaatgtatattaagggtgatcggaattcatgctcgtctggtaaaagaaaagaat 21001876  T
401 catatagattagaacattgtgatattagagtttaagattttggagaaactcgacagtggaactttgacaaagacagataatataggatggtactataatg 500  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
21001877 catatagattagaacattgtgatattagagtttaagattttggagaaactcgacagtggaattttgacaaagacagataatataggatggtactataatg 21001976  T
501 atactatgttgaaattatagtctttagtcctttccttttgatgtaaagggatgaaattaatactcagaatcagaataatataattgatttgctgtgagtg 600  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21001977 atactatgttgaaattatagtctttagtcctttcctttcgatgtaaagggatgaaattaatactcagaatcagaataatataattgatttgctgtgagtg 21002076  T
601 acacgttggatgtcaggttgagat 624  Q
    ||| ||||||||||||||||||||    
21002077 acatgttggatgtcaggttgagat 21002100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 71; E-Value: 8e-32
Query Start/End: Original strand, 122 - 503
Target Start/End: Original strand, 20991625 - 20992012
Alignment:
122 tatataaggaaatttagaaatcaattgcaaagaggtaatttgagatactctaacatgtgttacgataaaatattgttgtgttgcaat--tttttaattta 219  Q
    ||||||||||||| ||||||||||  | || |||||||||| |||||||||||||||   || |||| |||||||||| ||||  ||  || ||||||||    
20991625 tatataaggaaatatagaaatcaaccgtaa-gaggtaatttaagatactctaacatgctatatgatagaatattgttgcgttgagatacttcttaattta 20991723  T
220 ttcttacagtcctccttaaagcaaagctcattaagctataaaaa-gaaaggaatgtatatgggattcaaccaaacatgattggaaagtcaacttccgact 318  Q
    ||| ||||||||||||||| | |||||||| ||||||||||||| ||||  ||||||||||| | || |  ||||||||||| |||||||| ||  ||||    
20991724 ttcgtacagtcctccttaatgtaaagctcactaagctataaaaaagaaa--aatgtatatgg-actccataaaacatgattg-aaagtcaagttg-gact 20991818  T
319 aaaa--gagggcaaaca--ggct-------atttgcgataaatgtatattaagggtgatcggaattcatgttcgtctggtaaaagaaaagaatcatatag 407  Q
    ||||  | ||||| ||   ||||       ||| | ||||||| |||||||| |||||||||||||||||   |||| |||||||||||||||| |||||    
20991819 aaaattgtgggcagaccatggcttcactgtattcgggataaatctatattaaaggtgatcggaattcatgcaggtcttgtaaaagaaaagaatcgtatag 20991918  T
408 attagaacattgtgatattagagtttaagattttggagaaactcgacagtggaactttgacaaagacagataatataggatggtactataatgata 503  Q
    || || ||| ||||  || | ||||| |||||||  ||||||||  |||||||| | |||||  |||||||||||||||||||||||||| |||||    
20991919 ataagcacactgtg--atgatagtttcagattttttagaaactcagcagtggaattgtgacatggacagataatataggatggtactatactgata 20992012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 204693 times since January 2019
Visitors: 1518