View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk55-3 (Length: 373)

Name: R108-tnk55-3
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk55-3
R108-tnk55-3
[»] chr4 (2 HSPs)
chr4 (1-369)||(1596948-1597320)
chr4 (3-99)||(555278-555373)
[»] chr2 (2 HSPs)
chr2 (4-102)||(41225631-41225728)
chr2 (213-257)||(41225927-41225971)


Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 1 - 369
Target Start/End: Complemental strand, 1597320 - 1596948
Alignment:
1 cataacacattgtcctcttcattcatttcccaaatcaagcatgattatcaagcaaaacaggatacaccggatacttccaaagatcactcagcataaaaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||    
1597320 cataacacattgtcctcttcattcatttcccaaatcaagcatgattatcaagcaaaacaggatacaccg-atacttccaaagatcaatcagcataaaaaa 1597222  T
101 cataaaatagtattaaatgaatttcctaattgcttcaatttcatacattctatatcagaaaacattttcatttgtgatgaaacaaaacgcaattagagct 200  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
1597221 cataaaatagtattaaatgaatttcttaattgcttcaatttcatacattctatatcagaaaacattttcatttgtgatgaaacaaaacgcaattagaact 1597122  T
201 catataaattatatttccatttgcaattctcttaattaccatcatatagattaaagc-----nnnnnnnnnnnnctatcatgcataacaatcaatatata 295  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||                 ||||||||||||||||||||||||||    
1597121 catataaattatatttccatttgcaattctcttaattaccatcatatagattaaagcaacaaaaaaaaaaaaaactatcatgcataacaatcaatatata 1597022  T
296 gtagcagaaggaacatagttagtagcttaaaccgatctaaacatgaaattagaactcacaggggttttggtttc 369  Q
    ||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| | ||||| ||||    
1597021 gtagctgaaggaacatagttagtagcttaaactgatctaaacatgaaattagaactcacagtgtttttgttttc 1596948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 3 - 99
Target Start/End: Complemental strand, 555373 - 555278
Alignment:
3 taacacattgtcctcttcattcatttcccaaatcaagcatgattatcaagcaaaacaggatacaccggatacttccaaagatcactcagcataaaaa 99  Q
    |||||||||||||| |||||| |||||| ||||||||||| ||| || |||||||||||||||| | ||||||| |||| | ||||||| |||||||    
555373 taacacattgtccttttcattaatttccaaaatcaagcataattctcgagcaaaacaggataca-ctgatactttcaaataccactcagaataaaaa 555278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 51; Significance: 4e-20; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 4 - 102
Target Start/End: Original strand, 41225631 - 41225728
Alignment:
4 aacacattgtcctcttcattcatttcccaaatcaagcatgattatcaagcaaaacaggatacaccggatacttccaaagatcactcagcataaaaaaca 102  Q
    |||||| ||||||||||||||||||| ||| |||||||| ||| |  ||||||| ||||||||||  |||||||||||||||||||| |||||||||||    
41225631 aacacactgtcctcttcattcatttctcaagtcaagcataattctagagcaaaaaaggatacacc-aatacttccaaagatcactcaccataaaaaaca 41225728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 213 - 257
Target Start/End: Original strand, 41225927 - 41225971
Alignment:
213 atttccatttgcaattctcttaattaccatcatatagattaaagc 257  Q
    |||||||||||||||||||||||||||||||||||| ||||||||    
41225927 atttccatttgcaattctcttaattaccatcatataaattaaagc 41225971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110450 times since January 2019
Visitors: 1335