View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk55-4 (Length: 883)

Name: R108-tnk55-4
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk55-4
R108-tnk55-4
[»] chr2 (34 HSPs)
chr2 (1-585)||(315332-315914)
chr2 (688-883)||(314175-314370)
chr2 (774-851)||(37199576-37199653)
chr2 (775-851)||(3515450-3515526)
chr2 (774-851)||(4437955-4438032)
chr2 (776-851)||(34173692-34173767)
chr2 (727-841)||(37009583-37009703)
chr2 (774-844)||(6229861-6229931)
chr2 (774-844)||(40769346-40769416)
chr2 (775-844)||(33146062-33146131)
chr2 (796-844)||(17829078-17829126)
chr2 (774-850)||(22298227-22298303)
chr2 (727-844)||(31597252-31597375)
chr2 (774-825)||(37329746-37329797)
chr2 (774-844)||(8313683-8313753)
chr2 (774-844)||(11564445-11564515)
chr2 (762-824)||(26196254-26196316)
chr2 (774-851)||(31364491-31364566)
chr2 (796-841)||(11796170-11796215)
chr2 (772-861)||(28167550-28167639)
chr2 (774-826)||(3045575-3045627)
chr2 (774-826)||(7939372-7939424)
chr2 (796-844)||(10357119-10357167)
chr2 (796-844)||(11051586-11051634)
chr2 (727-844)||(11796734-11796856)
chr2 (472-516)||(18182513-18182557)
chr2 (772-851)||(1366387-1366466)
chr2 (776-827)||(31709111-31709162)
chr2 (774-825)||(43439775-43439826)
chr2 (774-844)||(32022997-32023067)
chr2 (727-760)||(551955-551988)
chr2 (688-729)||(3100293-3100334)
chr2 (688-729)||(20696953-20696994)
chr2 (796-844)||(44332381-44332429)
[»] chr7 (40 HSPs)
chr7 (761-860)||(3391769-3391868)
chr7 (774-844)||(11639924-11639994)
chr7 (774-844)||(40401528-40401598)
chr7 (774-841)||(33576668-33576735)
chr7 (761-827)||(16425973-16426039)
chr7 (774-824)||(48872059-48872109)
chr7 (779-844)||(31221437-31221502)
chr7 (775-851)||(2790101-2790177)
chr7 (776-844)||(32867272-32867340)
chr7 (776-827)||(12677144-12677195)
chr7 (796-851)||(16425358-16425413)
chr7 (774-844)||(20261558-20261628)
chr7 (774-845)||(36688836-36688907)
chr7 (774-844)||(38790100-38790170)
chr7 (776-841)||(1573732-1573797)
chr7 (774-827)||(22711679-22711732)
chr7 (774-851)||(23232890-23232962)
chr7 (774-826)||(5227898-5227950)
chr7 (796-860)||(25607610-25607674)
chr7 (774-826)||(32387526-32387578)
chr7 (796-844)||(32388146-32388194)
chr7 (796-844)||(32867901-32867949)
chr7 (776-827)||(34834860-34834912)
chr7 (796-844)||(34999213-34999261)
chr7 (727-844)||(38987780-38987903)
chr7 (774-826)||(42813068-42813120)
chr7 (727-824)||(46011043-46011146)
chr7 (776-827)||(12679039-12679090)
chr7 (774-861)||(27619610-27619697)
chr7 (774-825)||(28308647-28308698)
chr7 (774-861)||(29615527-29615614)
chr7 (803-861)||(2935766-2935824)
chr7 (463-516)||(6980872-6980924)
chr7 (778-851)||(10412636-10412709)
chr7 (799-844)||(14753878-14753923)
chr7 (796-841)||(27144212-27144257)
chr7 (479-516)||(33491194-33491231)
chr7 (772-825)||(36848472-36848525)
chr7 (688-729)||(37496569-37496610)
chr7 (774-851)||(45941473-45941550)
[»] chr6 (25 HSPs)
chr6 (774-851)||(4101101-4101176)
chr6 (774-851)||(4126464-4126539)
chr6 (727-844)||(32521863-32521986)
chr6 (774-844)||(21802581-21802651)
chr6 (774-827)||(21847346-21847399)
chr6 (774-850)||(12767583-12767659)
chr6 (773-850)||(12409434-12409511)
chr6 (774-846)||(2092314-2092386)
chr6 (797-844)||(7448890-7448937)
chr6 (774-825)||(31282222-31282273)
chr6 (774-824)||(15499473-15499523)
chr6 (727-862)||(32114331-32114472)
chr6 (415-471)||(1879202-1879256)
chr6 (796-844)||(12026196-12026244)
chr6 (774-825)||(6937881-6937932)
chr6 (782-844)||(22342125-22342187)
chr6 (774-844)||(10702911-10702981)
chr6 (798-844)||(11794768-11794814)
chr6 (727-760)||(187899-187932)
chr6 (783-844)||(2522696-2522757)
chr6 (796-841)||(4100545-4100590)
chr6 (778-827)||(14306836-14306885)
chr6 (796-844)||(22022273-22022321)
chr6 (479-516)||(28606581-28606618)
chr6 (727-760)||(34280144-34280177)
[»] chr4 (33 HSPs)
chr4 (774-844)||(32448917-32448987)
chr4 (774-844)||(55068871-55068941)
chr4 (772-844)||(51019679-51019751)
chr4 (774-827)||(7479323-7479376)
chr4 (774-850)||(21037320-21037396)
chr4 (774-844)||(13482211-13482281)
chr4 (774-844)||(16192292-16192362)
chr4 (778-844)||(23722032-23722098)
chr4 (774-844)||(36898076-36898146)
chr4 (774-844)||(37424424-37424493)
chr4 (775-844)||(25010035-25010104)
chr4 (774-850)||(4963919-4963995)
chr4 (796-844)||(17722778-17722826)
chr4 (460-516)||(22435443-22435498)
chr4 (796-844)||(35667282-35667330)
chr4 (780-844)||(35667364-35667428)
chr4 (780-844)||(37147767-37147831)
chr4 (796-844)||(37708803-37708851)
chr4 (774-825)||(8138369-8138420)
chr4 (778-844)||(19313373-19313439)
chr4 (472-515)||(43404606-43404649)
chr4 (774-844)||(721956-722026)
chr4 (774-844)||(754896-754966)
chr4 (774-844)||(6711260-6711330)
chr4 (778-844)||(7797594-7797660)
chr4 (800-846)||(33047232-33047278)
chr4 (774-824)||(35666000-35666050)
chr4 (688-729)||(20964466-20964507)
chr4 (774-827)||(26705079-26705132)
chr4 (799-844)||(35667758-35667803)
chr4 (776-845)||(44664733-44664802)
chr4 (774-827)||(48372460-48372513)
chr4 (774-827)||(50825262-50825315)
[»] chr8 (35 HSPs)
chr8 (774-851)||(17564691-17564768)
chr8 (774-844)||(14094127-14094197)
chr8 (774-846)||(31740126-31740197)
chr8 (727-827)||(40791093-40791199)
chr8 (774-844)||(253556-253623)
chr8 (774-844)||(662235-662302)
chr8 (774-844)||(848033-848100)
chr8 (727-824)||(34925329-34925432)
chr8 (796-851)||(8437920-8437975)
chr8 (681-728)||(10729085-10729132)
chr8 (462-516)||(3647479-3647532)
chr8 (774-844)||(8438544-8438614)
chr8 (774-824)||(11760044-11760094)
chr8 (776-846)||(17734890-17734960)
chr8 (774-844)||(44284327-44284397)
chr8 (727-826)||(44746222-44746327)
chr8 (774-851)||(14879543-14879620)
chr8 (774-850)||(32903637-32903714)
chr8 (774-827)||(37266119-37266172)
chr8 (772-821)||(37836972-37837021)
chr8 (796-844)||(11140124-11140172)
chr8 (474-514)||(18183039-18183079)
chr8 (798-862)||(31846459-31846523)
chr8 (774-825)||(8443302-8443353)
chr8 (774-821)||(13439478-13439525)
chr8 (774-861)||(36016737-36016823)
chr8 (772-823)||(40299562-40299613)
chr8 (797-844)||(40791755-40791802)
chr8 (774-824)||(11141038-11141088)
chr8 (795-841)||(13422064-13422110)
chr8 (774-824)||(30056337-30056387)
chr8 (774-844)||(34363941-34364010)
chr8 (774-844)||(37872844-37872913)
chr8 (688-729)||(14689854-14689895)
chr8 (798-851)||(25485427-25485480)
[»] chr3 (45 HSPs)
chr3 (774-846)||(33978584-33978655)
chr3 (774-844)||(40036372-40036442)
chr3 (774-851)||(49765105-49765182)
chr3 (762-850)||(11397611-11397699)
chr3 (774-844)||(1262427-1262497)
chr3 (774-844)||(11345335-11345405)
chr3 (774-844)||(18364660-18364730)
chr3 (774-844)||(54403589-54403659)
chr3 (775-844)||(3090395-3090464)
chr3 (774-827)||(17764938-17764991)
chr3 (774-827)||(19066258-19066311)
chr3 (774-851)||(40974674-40974751)
chr3 (776-844)||(54605792-54605860)
chr3 (776-851)||(16067247-16067322)
chr3 (772-827)||(23682038-23682093)
chr3 (772-827)||(24054275-24054330)
chr3 (781-851)||(1364035-1364105)
chr3 (774-844)||(22518557-22518626)
chr3 (780-862)||(44500025-44500107)
chr3 (774-824)||(53490707-53490757)
chr3 (775-844)||(13623205-13623274)
chr3 (774-827)||(27394298-27394351)
chr3 (787-844)||(41587300-41587357)
chr3 (778-826)||(291157-291205)
chr3 (772-844)||(7724597-7724669)
chr3 (472-516)||(16205720-16205764)
chr3 (796-844)||(18365279-18365327)
chr3 (775-857)||(9830291-9830373)
chr3 (688-719)||(21296681-21296712)
chr3 (796-851)||(37183101-37183156)
chr3 (796-851)||(40974059-40974114)
chr3 (798-844)||(2756607-2756653)
chr3 (774-824)||(3541060-3541110)
chr3 (774-844)||(14600407-14600477)
chr3 (688-730)||(32023272-32023314)
chr3 (688-730)||(38600977-38601019)
chr3 (681-719)||(41286951-41286989)
chr3 (796-846)||(54606422-54606472)
chr3 (688-729)||(1334947-1334988)
chr3 (727-760)||(4758049-4758082)
chr3 (774-823)||(6296721-6296770)
chr3 (727-760)||(14601555-14601588)
chr3 (775-844)||(25480557-25480626)
chr3 (781-846)||(32222073-32222138)
chr3 (727-760)||(37183674-37183707)
[»] scaffold0189 (1 HSPs)
scaffold0189 (727-827)||(11334-11440)
[»] scaffold0695 (1 HSPs)
scaffold0695 (774-844)||(2251-2321)
[»] scaffold0368 (1 HSPs)
scaffold0368 (778-844)||(11238-11304)
[»] scaffold0068 (1 HSPs)
scaffold0068 (774-844)||(59288-59358)
[»] chr1 (30 HSPs)
chr1 (774-844)||(36604754-36604824)
chr1 (778-844)||(42831182-42831248)
chr1 (727-844)||(16536399-16536522)
chr1 (774-845)||(2275115-2275186)
chr1 (774-844)||(27225703-27225773)
chr1 (774-844)||(45737332-45737402)
chr1 (774-827)||(4007597-4007650)
chr1 (774-851)||(49129652-49129729)
chr1 (774-861)||(10012428-10012515)
chr1 (774-845)||(17109332-17109402)
chr1 (774-861)||(19071722-19071808)
chr1 (774-861)||(19119612-19119698)
chr1 (727-844)||(45559688-45559811)
chr1 (774-825)||(47216103-47216154)
chr1 (772-826)||(13573544-13573598)
chr1 (774-844)||(45738027-45738097)
chr1 (727-846)||(50143410-50143535)
chr1 (774-827)||(9091081-9091134)
chr1 (774-844)||(27930792-27930866)
chr1 (774-827)||(43504435-43504488)
chr1 (776-844)||(43320556-43320624)
chr1 (774-825)||(4667519-4667570)
chr1 (796-851)||(29510477-29510532)
chr1 (778-844)||(18406557-18406623)
chr1 (774-844)||(47233087-47233157)
chr1 (688-729)||(2886065-2886106)
chr1 (774-827)||(28198100-28198153)
chr1 (776-825)||(31765380-31765429)
chr1 (774-823)||(33126830-33126879)
chr1 (802-851)||(36605405-36605454)
[»] chr5 (27 HSPs)
chr5 (772-845)||(22731034-22731107)
chr5 (778-826)||(8573329-8573377)
chr5 (761-824)||(141582-141645)
chr5 (774-844)||(27979259-27979329)
chr5 (774-827)||(14594114-14594167)
chr5 (774-827)||(20259980-20260033)
chr5 (796-844)||(35751544-35751592)
chr5 (776-844)||(36762142-36762210)
chr5 (727-823)||(19500815-19500917)
chr5 (774-844)||(20183990-20184060)
chr5 (774-850)||(1406212-1406288)
chr5 (762-827)||(5138929-5138994)
chr5 (774-827)||(12585653-12585706)
chr5 (774-851)||(17336369-17336446)
chr5 (774-850)||(13279501-13279577)
chr5 (796-844)||(19408567-19408615)
chr5 (796-844)||(21639046-21639094)
chr5 (780-844)||(36737431-36737495)
chr5 (774-845)||(31476385-31476456)
chr5 (774-844)||(31850032-31850102)
chr5 (727-827)||(42598367-42598473)
chr5 (774-844)||(3933955-3934025)
chr5 (763-821)||(36853669-36853727)
chr5 (774-827)||(20570203-20570256)
chr5 (778-827)||(36742166-36742215)
chr5 (796-841)||(36742580-36742625)
chr5 (774-827)||(38955537-38955590)
[»] scaffold0003 (4 HSPs)
scaffold0003 (761-827)||(14686-14752)
scaffold0003 (761-827)||(28832-28898)
scaffold0003 (774-851)||(421168-421245)
scaffold0003 (796-851)||(14070-14125)
[»] scaffold0361 (1 HSPs)
scaffold0361 (774-850)||(17125-17201)
[»] scaffold0006 (1 HSPs)
scaffold0006 (772-827)||(161302-161357)
[»] scaffold0043 (1 HSPs)
scaffold0043 (774-843)||(67744-67813)
[»] scaffold0051 (1 HSPs)
scaffold0051 (775-827)||(11607-11659)
[»] scaffold0034 (2 HSPs)
scaffold0034 (774-850)||(25928-26004)
scaffold0034 (686-719)||(97963-97996)
[»] scaffold0001 (1 HSPs)
scaffold0001 (774-826)||(185161-185213)
[»] scaffold0340 (1 HSPs)
scaffold0340 (778-844)||(12218-12284)
[»] scaffold0037 (1 HSPs)
scaffold0037 (778-844)||(100031-100097)
[»] scaffold0971 (1 HSPs)
scaffold0971 (774-819)||(3152-3197)
[»] scaffold0289 (1 HSPs)
scaffold0289 (775-844)||(4025-4094)
[»] scaffold0031 (1 HSPs)
scaffold0031 (459-508)||(105395-105443)


Alignment Details
Target: chr2 (Bit Score: 444; Significance: 0; HSPs: 34)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 444; E-Value: 0
Query Start/End: Original strand, 1 - 585
Target Start/End: Complemental strand, 315914 - 315332
Alignment:
1 tgcagatgctgcttggaatgtcaatggttctgcggcatgcagtttatgattccgtagcatgcatccatggcatttacaaccaaaaatatttacttattca 100  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
315914 tgcagaagctgcttggaatgtcaatggttctgcggcatgcagtttatgattccgtagcatgcatccatggcatttacaaccaaaaatatttacttattca 315815  T
101 taacccctaactcatgctaaatttaaggaataaactgaatgggaccatacagtcataataaaacatgcatgccatgagtgtttgtccttgtgaaagggaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
315814 taacccctaactcatgctaaatttaaggaataaactgaatgggaccatacagtcataataaaacatgcatgccatgagtgtttgtccttgtgaaagggca 315715  T
201 aacatttgccttgcatatgaaggataagattaaaaggtacgtacggtgcaatgctcatgtcttgatgaaatcatacataacaaattcactattgcatttc 300  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||      
315714 aacatttgccttgcatatgaaggataagattaaaa-gtacgtacggtgcaatgctcatgtcttgatgaaatcatacataacaaattcacaattgcatt-- 315618  T
301 ccgtctagagaacacgctccaatcatttggaaacatagtgcatcgtgtcatgtcaatctaagggcagcactcgagtgatattgggggtcaatatcatgtg 400  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||  ||||||||||||||    
315617 ccgtctagagaacacgctccaatcatttggaaacatagtgcatcgtgtcatgtcaatctaagggcagcactcgggtgatattggttgtcaatatcatgtg 315518  T
401 acattggcaacaacccacaatgttataagtgactttcttctctattttttccacaaggattttttgtacaccttgtggcattgtggttggtcaatgtcat 500  Q
    ||||||||||    ||||||||||||||||| ||||||| ||||||||||||||||   ||||||||||| ||||||||||||||||||  ||||||| |    
315517 acattggcaa----ccacaatgttataagtggctttcttttctattttttccacaaattttttttgtaca-cttgtggcattgtggttgaccaatgtcgt 315423  T
501 atgacattggcacccctcttatacctcaataaattagaa--------agtttcgttccataatagaagtttgaattaccataactctcatctc 585  Q
    ||||||||| ||||||||||||| |||||||||||||||        |||||||||||||||||||||||||||||| |||||||||||||||    
315422 atgacattgacacccctcttata-ctcaataaattagaaaaaaattcagtttcgttccataatagaagtttgaatta-cataactctcatctc 315332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 180; E-Value: 1e-96
Query Start/End: Original strand, 688 - 883
Target Start/End: Complemental strand, 314370 - 314175
Alignment:
688 ttttttgcaaatgactcagttattgtgggacgaggggagtatttaattattaagggaggagtttgtaactcaacataggggaatgaagtataaattttac 787  Q
    |||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
314370 ttttttgcaaatgactcagttattatgggacggggggagtatttaattattaagggaggagtttgtaactcaacataggggaatgaagtataaattttac 314271  T
788 tttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagggaaggattgtgatttactattttggat 883  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||    
314270 tttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagaaaaggattgtgatttactattttggat 314175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 50; E-Value: 4e-19
Query Start/End: Original strand, 774 - 851
Target Start/End: Original strand, 37199576 - 37199653
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||   |||||||||||||||| ||||    
37199576 agtataaattttacttttcaagggaggggagtgtatattttaacataagaggggaggggagtgtaattcaaacatctt 37199653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 775 - 851
Target Start/End: Original strand, 3515450 - 3515526
Alignment:
775 gtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    |||||||||||||||| ||||||||||||||||| ||||||||||||||||||   || ||||||||||||| ||||    
3515450 gtataaattttacttttcaaaggaggggagtgtatattttaacataagaggggaggggggtgtaattcaaacatctt 3515526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 774 - 851
Target Start/End: Original strand, 4437955 - 4438032
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||||||| ||| | ||||||||||| ||||||||||||||||||   |||||||||||||||| ||||    
4437955 agtataaattttactttacaaggaaggggagtgtatattttaacataagaggggagaggagtgtaattcaaacatctt 4438032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 776 - 851
Target Start/End: Original strand, 34173692 - 34173767
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||||| ||| |||||||| |||| ||||||||||||||||||   |||||||||||||||| ||||    
34173692 tataaattttacttttcaagggaggggaatgtatattttaacataagaggggaggggagtgtaattcaaacatctt 34173767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 727 - 841
Target Start/End: Original strand, 37009583 - 37009703
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||| ||| |||||| ||||       ||||||||  | ||| ||||||||||||| ||| ||||||||||||| |||||||||||    
37009583 tatttaattattaagggaagaggttgtaattcaaacatcttataggggaggggagtgtaaattttacttttcaagggaggggagtgtatattttaacata 37009682  T
821 agaggggtatggagtgtaatt 841  Q
    |||||||   |||||||||||    
37009683 agaggggagaggagtgtaatt 37009703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 6229861 - 6229931
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||| ||||||| ||| ||||||||||||| |||||||||||||||||    ||||||||||||||    
6229861 agtataaatcttacttttcaagggaggggagtgtatattttaacataagagggaaggggagtgtaattcaa 6229931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 40769346 - 40769416
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||| ||||| ||||||| |||||||||||||||| |   ||||||||||||||    
40769346 agtataaattttacttttcaagggaggagagtgtatattttaacataagaggtgaggggagtgtaattcaa 40769416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 775 - 844
Target Start/End: Complemental strand, 33146131 - 33146062
Alignment:
775 gtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||| |||| ||| ||||||||||||| ||||||||||||||||||   |||||| |||||||    
33146131 gtataaattttccttttcaagggaggggagtgtatattttaacataagaggggaggggagtgcaattcaa 33146062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 796 - 844
Target Start/End: Complemental strand, 17829126 - 17829078
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||||  |||||||||||||||    
17829126 ggaggggagtgtatattttaacataagaggggagtggagtgtaattcaa 17829078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 774 - 850
Target Start/End: Original strand, 22298227 - 22298303
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttct 850  Q
    ||||||||||||| ||| ||| ||||  ||||||| ||||||||||||||||||   |||||||||||||| |||||    
22298227 agtataaattttatttttcaagggagaagagtgtatattttaacataagaggggagaggagtgtaattcaagcttct 22298303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 727 - 844
Target Start/End: Complemental strand, 31597375 - 31597252
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||||| | |||||| ||||       ||||||||  | ||| ||||||||||||| ||| |||||||||| || |||||||||||    
31597375 tatttaattattaagggagggggttgtaattcaagcatcttataggggaggggagtgtaaattttacttttcaagggaggggagtttatattttaacata 31597276  T
821 agaggggtatggagtgtaattcaa 844  Q
    |||||||    |||||||||||||    
31597275 agaggggaggtgagtgtaattcaa 31597252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 774 - 825
Target Start/End: Complemental strand, 37329797 - 37329746
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagg 825  Q
    ||||||||||||| ||| ||| ||||||||||||| ||||||||||||||||    
37329797 agtataaattttatttttcaagggaggggagtgtatattttaacataagagg 37329746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 8313753 - 8313683
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||| ||||||  |||| ||||||| |||||||| ||||||||||||||||||   ||||||||||||||    
8313753 agtatcaatttttttttcaaaaggagaggagtgtatattttaacataagaggggaggggagtgtaattcaa 8313683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 11564445 - 11564515
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||| ||||||||| ||| ||||| ||||||| |||||||||||||||||| |  | |||||||||||    
11564445 agtataagttttacttttcaagggaggagagtgtatattttaacataagaggggaagagtgtgtaattcaa 11564515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 762 - 824
Target Start/End: Complemental strand, 26196316 - 26196254
Alignment:
762 ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacataagag 824  Q
    ||||||||  ||||||||||||||| ||| ||| ||| ||||||||| |||||||||||||||    
26196316 ataggggagggaagtataaattttatttttcaatggatgggagtgtatattttaacataagag 26196254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 851
Target Start/End: Original strand, 31364491 - 31364566
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||||||| |||| |||||||||||  || ||||||||||||| |   |||||||||||||||| ||||    
31364491 agtataaattttacttttcaaatgaggggagtgt--atattaacataagaggagagaggagtgtaattcaaacatctt 31364566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 796 - 841
Target Start/End: Complemental strand, 11796215 - 11796170
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaatt 841  Q
    ||||||||||||||||||||||||||||||||   |||||||||||    
11796215 ggaggggagtgtacattttaacataagaggggaggggagtgtaatt 11796170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 772 - 861
Target Start/End: Complemental strand, 28167639 - 28167550
Alignment:
772 gaagtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagggaagg 861  Q
    |||||||||| ||||||||  || ||||| ||||||| |||||||||||||||||    |||||||||||||| | ||||  ||||||||    
28167639 gaagtataaactttactttttaagggaggagagtgtatattttaacataagagggaaggggagtgtaattcaatcatctttgagggaagg 28167550  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 774 - 826
Target Start/End: Original strand, 3045575 - 3045627
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggg 826  Q
    ||||||||||||||||| |||  ||||| |||||| |||||||||||||||||    
3045575 agtataaattttacttttcaagagagggaagtgtatattttaacataagaggg 3045627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 774 - 826
Target Start/End: Complemental strand, 7939424 - 7939372
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggg 826  Q
    ||||||||||||||||| ||| |||||  |||||| |||||||||||||||||    
7939424 agtataaattttacttttcaagggaggtaagtgtatattttaacataagaggg 7939372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Original strand, 10357119 - 10357167
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||||   ||||||||||||||    
10357119 ggaggggagtgtatattttaacataagaggggaggggagtgtaattcaa 10357167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Complemental strand, 11051634 - 11051586
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||| |||  ||||||||||||||    
11051634 ggaggggagtgtatattttaacataagagaggtggggagtgtaattcaa 11051586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 727 - 844
Target Start/End: Original strand, 11796734 - 11796856
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||||| | |||||| ||||       ||||||||  | ||||||||||||||||| ||| |||||| | |||| |||||||| ||    
11796734 tatttaattattaagggagggggttgtaattcaagcatcttataggggaggggagtataaattttacttttcaa-ggagggaaatgtatattttaactta 11796832  T
821 agaggggtatggagtgtaattcaa 844  Q
    |||||||   ||||||||||||||    
11796833 agaggggaggggagtgtaattcaa 11796856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 472 - 516
Target Start/End: Complemental strand, 18182557 - 18182513
Alignment:
472 cttgtggcattgtggttggtcaatgtcatatgacattggcacccc 516  Q
    |||||| |||||||||||| |||||||| ||||||||||||||||    
18182557 cttgtgacattgtggttggccaatgtcacatgacattggcacccc 18182513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 772 - 851
Target Start/End: Original strand, 1366387 - 1366466
Alignment:
772 gaagtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||||||||| |||  ||||| | |||| ||||||||||||||| ||    ||||||||||||||| ||||    
1366387 gaagtataaattttacttttcaagagagggaaatgtatattttaacataagagaggaggagagtgtaattcaaacatctt 1366466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 776 - 827
Target Start/End: Complemental strand, 31709162 - 31709111
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||| ||| | |||| |||||| ||||||||||||||||||    
31709162 tataaattttacttttcaaggaagggaagtgtatattttaacataagagggg 31709111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 825
Target Start/End: Original strand, 43439775 - 43439826
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagg 825  Q
    ||||||||||||| ||| ||| ||||| ||||||| ||||||||||||||||    
43439775 agtataaattttatttttcaagggaggagagtgtatattttaacataagagg 43439826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 32023067 - 32022997
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||| |||||| |||||| |||||||||| | ||||  |  |||||||||||||    
32023067 agtataaattttactttgcaagggagggaagtgtatattttaacatcaaagggaaagagagtgtaattcaa 32022997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 727 - 760
Target Start/End: Complemental strand, 551988 - 551955
Alignment:
727 tatttaattattaagggaggagtttgtaactcaa 760  Q
    ||||||||||||||||||||||||||||| ||||    
551988 tatttaattattaagggaggagtttgtaattcaa 551955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 688 - 729
Target Start/End: Complemental strand, 3100334 - 3100293
Alignment:
688 ttttttgcaaatgactcagttattgtgggacgaggggagtat 729  Q
    ||||||||||||| ||||||||||||||||||  ||||||||    
3100334 ttttttgcaaatggctcagttattgtgggacggagggagtat 3100293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 688 - 729
Target Start/End: Original strand, 20696953 - 20696994
Alignment:
688 ttttttgcaaatgactcagttattgtgggacgaggggagtat 729  Q
    |||||||||||||||||||||||| |||||||  ||||||||    
20696953 ttttttgcaaatgactcagttattatgggacggagggagtat 20696994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 796 - 844
Target Start/End: Original strand, 44332381 - 44332429
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatg-gagtgtaattcaa 844  Q
    ||||||||||||| |||||||||||||||||| ||| |||||||||||||    
44332381 ggaggggagtgtatattttaacataagagggg-atgagagtgtaattcaa 44332429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 48; Significance: 6e-18; HSPs: 40)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 48; E-Value: 6e-18
Query Start/End: Original strand, 761 - 860
Target Start/End: Complemental strand, 3391868 - 3391769
Alignment:
761 cataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagggaag 860  Q
    |||||||||  | |||||||||||||||||  || ||||||||||||| ||||||||||||||||||  || | ||||||||||||||||  ||||||||    
3391868 cataggggaggggagtataaattttactttttaagggaggggagtgtatattttaacataagaggggagtgaaatgtaattcaaacttctcttagggaag 3391769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 11639994 - 11639924
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||   ||||||||||||||    
11639994 agtataaattttacttttcaaaggaggagagtgtatattttaacataagaggggaggggagtgtaattcaa 11639924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 40401528 - 40401598
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||| ||| ||||||||| ||||||||||||||||||   ||||||||||||||    
40401528 agtataaattttacttttcaagggaagggagtgtatattttaacataagaggggaggggagtgtaattcaa 40401598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 774 - 841
Target Start/End: Original strand, 33576668 - 33576735
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaatt 841  Q
    ||||||||||||||||| |||| |||||||||||| ||||||||||||||| ||  || |||||||||    
33576668 agtataaattttacttttcaaaagaggggagtgtatattttaacataagagaggagtgaagtgtaatt 33576735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 761 - 827
Target Start/End: Original strand, 16425973 - 16426039
Alignment:
761 cataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    |||||||||  | ||||||||| ||||||| ||| ||||||||||||| ||||||||||||||||||    
16425973 cataggggaggggagtataaatattacttttcaagggaggggagtgtatattttaacataagagggg 16426039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 774 - 824
Target Start/End: Complemental strand, 48872109 - 48872059
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagag 824  Q
    ||||||||||||||||| ||| ||||||||||||| |||||||||||||||    
48872109 agtataaattttacttttcaagggaggggagtgtatattttaacataagag 48872059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 779 - 844
Target Start/End: Original strand, 31221437 - 31221502
Alignment:
779 aaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||| ||| ||||||||||||| |||||||||||||| |||   ||||||||||||||    
31221437 aaattttacttttcaagggaggggagtgtatattttaacataagaagggaggggagtgtaattcaa 31221502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 775 - 851
Target Start/End: Complemental strand, 2790177 - 2790101
Alignment:
775 gtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    |||||||||||| ||| ||| |||||||| |||| |||||||| |||||||||   |||||||||||||||| ||||    
2790177 gtataaattttatttttcaagggaggggaatgtatattttaacttaagaggggaggggagtgtaattcaaacatctt 2790101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 776 - 844
Target Start/End: Complemental strand, 32867340 - 32867272
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||| ||| |||||||| |||||||| ||||||||||||||||||   ||| ||||||||||    
32867340 tataaattttatttttcaaaggagaggagtgtatattttaacataagaggggaggggaatgtaattcaa 32867272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 776 - 827
Target Start/End: Complemental strand, 12677195 - 12677144
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||| ||  ||||||||||||| ||||||||||||||||||    
12677195 tataaattttacttttcatgggaggggagtgtatattttaacataagagggg 12677144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 796 - 851
Target Start/End: Complemental strand, 16425413 - 16425358
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    |||||| |||||| ||||||||||||||||||   |||||||||||||||||||||    
16425413 ggagggaagtgtatattttaacataagaggggagaggagtgtaattcaaacttctt 16425358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 20261558 - 20261628
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatg-gagtgtaattcaa 844  Q
    ||||| || |||||||| ||| ||||||||||||| |||||||||||||||||| ||| |||||||||||||    
20261558 agtatcaaatttacttttcaagggaggggagtgtatattttaacataagagggg-atgagagtgtaattcaa 20261628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 774 - 845
Target Start/End: Original strand, 36688836 - 36688907
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaa 845  Q
    ||||||| ||||||||| ||| |||||  |||||| ||||||||||||||||||   |||||||||||||||    
36688836 agtataacttttacttttcaagggaggaaagtgtatattttaacataagaggggaggggagtgtaattcaaa 36688907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 38790170 - 38790100
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||| || |||||||| ||||||||  ||||||| ||||||||||||||||||   ||||||||||||||    
38790170 agtatcaactttacttttcaaaggagatgagtgtatattttaacataagaggggaggggagtgtaattcaa 38790100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 776 - 841
Target Start/End: Original strand, 1573732 - 1573797
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaatt 841  Q
    |||||| |||||||| ||| ||||| ||||||| ||||||||||||||||||   |||||||||||    
1573732 tataaagtttactttgcaagggaggtgagtgtatattttaacataagaggggaggggagtgtaatt 1573797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 827
Target Start/End: Complemental strand, 22711732 - 22711679
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||||| |||  ||| |||||||| ||||||||||||||||||    
22711732 agtataaattttacttttcaagagagtggagtgtatattttaacataagagggg 22711679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 851
Target Start/End: Complemental strand, 23232962 - 23232890
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||||||| ||| | |||||| |||| ||||||||| |||||     ||||||||||||||||||||||    
23232962 agtataaattttacttttcaaggaaggggaatgtatattttaacacaagag-----tggagtgtaattcaaacttctt 23232890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 774 - 826
Target Start/End: Complemental strand, 5227950 - 5227898
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggg 826  Q
    |||||||||||||||||  || |||||||| |||| |||||||||||||||||    
5227950 agtataaattttactttttaagggaggggaatgtatattttaacataagaggg 5227898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 860
Target Start/End: Original strand, 25607610 - 25607674
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagggaag 860  Q
    ||||||||||||| |||||||| |||||||||   |||||||||||||||| ||||  |||||||    
25607610 ggaggggagtgtatattttaacttaagaggggaggggagtgtaattcaaacatctttaagggaag 25607674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 774 - 826
Target Start/End: Complemental strand, 32387578 - 32387526
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggg 826  Q
    ||||||||||||||||| ||| ||| || |||||| |||||||||||||||||    
32387578 agtataaattttacttttcaagggatggaagtgtatattttaacataagaggg 32387526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Original strand, 32388146 - 32388194
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||| |||||| ||||||||||||||||||  |||||||||||||||    
32388146 ggagggaagtgtatattttaacataagaggggagtggagtgtaattcaa 32388194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Original strand, 32867901 - 32867949
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||||   ||||||||||||||    
32867901 ggaggggagtgtatattttaacataagaggggagaggagtgtaattcaa 32867949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 776 - 827
Target Start/End: Complemental strand, 34834912 - 34834860
Alignment:
776 tataaattttactttccaaaggaggggagtgtaca-ttttaacataagagggg 827  Q
    ||||||||||||||| ||||||||| ||||||| | |||||||||||||||||    
34834912 tataaattttacttttcaaaggaggagagtgtatatttttaacataagagggg 34834860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Complemental strand, 34999261 - 34999213
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||||   ||||||||||||||    
34999261 ggaggggagtgtatattttaacataagaggggaggggagtgtaattcaa 34999213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 727 - 844
Target Start/End: Complemental strand, 38987903 - 38987780
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||||| | |||||| ||||       ||||||||  | ||| ||||||||||||| |||  ||| |||||||| |||||||||||    
38987903 tatttaattattaagggagggggttgtaattcaaacatcttataggggaggggagtgtaaattttacttttcaagagagtggagtgtatattttaacata 38987804  T
821 agaggggtatggagtgtaattcaa 844  Q
    |||||||   ||||| ||||||||    
38987803 agaggggaggggagtttaattcaa 38987780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 774 - 826
Target Start/End: Complemental strand, 42813120 - 42813068
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggg 826  Q
    ||||||||||||||||| ||| ||||| | ||||| |||||||||||||||||    
42813120 agtataaattttacttttcaacggaggagtgtgtatattttaacataagaggg 42813068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 727 - 824
Target Start/End: Original strand, 46011043 - 46011146
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||||| | |||||| ||||       ||||||||  | |||||||||||| |||| ||| ||||||||||| | |||||||||||    
46011043 tatttaattattaagggagggggttgtaattcaaacatcttataggggaggggagtataaattttccttttcaagggaggggagtgcatattttaacata 46011142  T
821 agag 824  Q
    ||||    
46011143 agag 46011146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 776 - 827
Target Start/End: Complemental strand, 12679090 - 12679039
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||| ||  |||||||| |||| ||||||||||||||||||    
12679090 tataaattttacttttcatgggaggggaatgtatattttaacataagagggg 12679039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 861
Target Start/End: Original strand, 27619610 - 27619697
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagggaagg 861  Q
    ||||| || ||||||||  || |||| |||||||| ||||||||||||||||||   |||||||||||||| | ||||  ||||||||    
27619610 agtatcaaatttactttttaagggagaggagtgtatattttaacataagaggggaggggagtgtaattcaagcatctttgagggaagg 27619697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 825
Target Start/End: Original strand, 28308647 - 28308698
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagg 825  Q
    |||||| |||||| ||| ||| ||||||||||||| ||||||||||||||||    
28308647 agtatacattttaattttcaagggaggggagtgtatattttaacataagagg 28308698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 861
Target Start/End: Complemental strand, 29615614 - 29615527
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagggaagg 861  Q
    ||||| |||||||||||  || |||||||| |||| ||||||||||||||||||    ||||||||||||| | ||||  ||||||||    
29615614 agtattaattttactttttaagggaggggaatgtatattttaacataagaggggaggagagtgtaattcaagcatctttgagggaagg 29615527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 803 - 861
Target Start/End: Original strand, 2935766 - 2935824
Alignment:
803 agtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagggaagg 861  Q
    |||||| |||||||||||||||||| | |||||||||||||| | ||||  ||||||||    
2935766 agtgtatattttaacataagaggggaagggagtgtaattcaagcatctttgagggaagg 2935824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 463 - 516
Target Start/End: Complemental strand, 6980924 - 6980872
Alignment:
463 tttgtacaccttgtggcattgtggttggtcaatgtcatatgacattggcacccc 516  Q
    ||||||||| ||||| |||||||||||| ||||| ||| |||||||||||||||    
6980924 tttgtacac-ttgtgacattgtggttggccaatgacatgtgacattggcacccc 6980872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 778 - 851
Target Start/End: Original strand, 10412636 - 10412709
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    |||||||||||||  || |||| ||| |||| ||||||||||||||||||   | | |||||||||||||||||    
10412636 taaattttactttttaagggagaggaatgtatattttaacataagaggggagagaattgtaattcaaacttctt 10412709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 799 - 844
Target Start/End: Original strand, 14753878 - 14753923
Alignment:
799 ggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||| |||||||||||||||| |  |||||||||||||||    
14753878 ggggagtgtatattttaacataagaggagagtggagtgtaattcaa 14753923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 796 - 841
Target Start/End: Complemental strand, 27144257 - 27144212
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaatt 841  Q
    ||||||||||||| ||||||||||||||||||   |||||||||||    
27144257 ggaggggagtgtatattttaacataagaggggaggggagtgtaatt 27144212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 479 - 516
Target Start/End: Complemental strand, 33491231 - 33491194
Alignment:
479 cattgtggttggtcaatgtcatatgacattggcacccc 516  Q
    |||||||||||| |||||||| ||||||||||||||||    
33491231 cattgtggttggccaatgtcacatgacattggcacccc 33491194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 772 - 825
Target Start/End: Original strand, 36848472 - 36848525
Alignment:
772 gaagtataaattttactttccaaaggaggggagtgtacattttaacataagagg 825  Q
    |||||||||||||||||||  || |||||  |||||| ||||||||||||||||    
36848472 gaagtataaattttacttttaaagggaggaaagtgtatattttaacataagagg 36848525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 688 - 729
Target Start/End: Original strand, 37496569 - 37496610
Alignment:
688 ttttttgcaaatgactcagttattgtgggacgaggggagtat 729  Q
    |||||||||||||||||||||||| |||||||  ||||||||    
37496569 ttttttgcaaatgactcagttattatgggacggagggagtat 37496610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 774 - 851
Target Start/End: Complemental strand, 45941550 - 45941473
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    |||||| |||||||||| |||||||| ||| | || ||||||||||||||| ||   | |||||||||||||| ||||    
45941550 agtatacattttactttacaaaggagaggaatatatattttaacataagagaggcgggaagtgtaattcaaacatctt 45941473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 47; Significance: 2e-17; HSPs: 25)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 774 - 851
Target Start/End: Original strand, 4101101 - 4101176
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||||||| ||||||||| ||||||| |||||||||||||||||| ||  |||||||||||||| ||||    
4101101 agtataaattttacttttcaaaggaggagagtgtatattttaacataagagggggat--agtgtaattcaaacatctt 4101176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 774 - 851
Target Start/End: Original strand, 4126464 - 4126539
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||||||| ||||||||| ||||||| |||||||||||||||||| ||  |||||||||||||| ||||    
4126464 agtataaattttacttttcaaaggaggagagtgtatattttaacataagagggggat--agtgtaattcaaacatctt 4126539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 727 - 844
Target Start/End: Complemental strand, 32521986 - 32521863
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||||| | |||||| ||||       ||||||||| | ||||||||||||||||| |||||||   || |||| |||||||||||    
32521986 tatttaattattaagggagggggttgtaattcaagtatcttataggggaagggagtataaattttacttttcaaaggaaatgaatgtatattttaacata 32521887  T
821 agaggggtatggagtgtaattcaa 844  Q
    ||||||| | ||||||||||||||    
32521886 agaggggaaaggagtgtaattcaa 32521863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 21802581 - 21802651
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||    |||||||||||||    
21802581 agtataaattttacttttcaagggaggggagtgtatattttaacataagaggggaggagagtgtaattcaa 21802651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 774 - 827
Target Start/End: Original strand, 21847346 - 21847399
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||||| |||||||||| |||||| ||||||||||||||||||    
21847346 agtataaattttactttgcaaaggagggaagtgtatattttaacataagagggg 21847399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 774 - 850
Target Start/End: Original strand, 12767583 - 12767659
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttct 850  Q
    ||||||||||||| ||| ||| |||||| |||||| ||||||||||||||||||   |||||||||||||| |||||    
12767583 agtataaattttatttttcaagggagggaagtgtatattttaacataagaggggaggggagtgtaattcaagcttct 12767659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 773 - 850
Target Start/End: Complemental strand, 12409511 - 12409434
Alignment:
773 aagtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttct 850  Q
    |||||||||||||||||| ||| ||||| ||||||| ||||||||||| ||||||   ||||||| |||||| |||||    
12409511 aagtataaattttacttttcaatggaggagagtgtatattttaacataggaggggaggggagtgtgattcaagcttct 12409434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 774 - 846
Target Start/End: Original strand, 2092314 - 2092386
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaac 846  Q
    ||||||||||||||||| ||| ||| || |||||| ||||||| ||||||||||   ||||||||||||||||    
2092314 agtataaattttacttttcaagggatggaagtgtatattttaatataagaggggaggggagtgtaattcaaac 2092386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 797 - 844
Target Start/End: Original strand, 7448890 - 7448937
Alignment:
797 gaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||| |||||||||||||||||| | ||||||||||||||    
7448890 gaggggagtgtatattttaacataagaggggaaaggagtgtaattcaa 7448937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 774 - 825
Target Start/End: Original strand, 31282222 - 31282273
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagg 825  Q
    ||||||||||||||||| ||| ||||||| ||||| ||||||||||||||||    
31282222 agtataaattttacttttcaagggaggggggtgtatattttaacataagagg 31282273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 824
Target Start/End: Original strand, 15499473 - 15499523
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagag 824  Q
    ||||||||| ||||||| ||| ||||||||||||| |||||||||||||||    
15499473 agtataaatcttacttttcaagggaggggagtgtatattttaacataagag 15499523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 727 - 862
Target Start/End: Original strand, 32114331 - 32114472
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||||| | |||||| ||||       ||| ||||| | |||||| |||||||||| ||| |||| |||||||| |||||||||||    
32114331 tatttaattattaagggagggggttgtaattcaagcatcttataagggaagggagtatacattttacttttcaagggagaggagtgtatattttaacata 32114430  T
821 agaggggtatggagtgtaattcaaacttcttctagggaagga 862  Q
    ||||| |   | |||||||||||| | ||||  |||||||||    
32114431 agaggagagagaagtgtaattcaagcatctttgagggaagga 32114472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 415 - 471
Target Start/End: Original strand, 1879202 - 1879256
Alignment:
415 ccacaatgttataagtgactttcttctctattttttccacaaggattttttgtacac 471  Q
    ||||||||| |||||||||||||||||||||||||  ||||||  ||||||||||||    
1879202 ccacaatgtcataagtgactttcttctctattttt--cacaagatttttttgtacac 1879256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Original strand, 12026196 - 12026244
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||||   ||||||||||||||    
12026196 ggaggggagtgtatattttaacataagaggggaggggagtgtaattcaa 12026244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 825
Target Start/End: Original strand, 6937881 - 6937932
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagg 825  Q
    ||||||||||||||||| ||| |||| |||||||| |||||||| |||||||    
6937881 agtataaattttacttttcaagggagtggagtgtatattttaacttaagagg 6937932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 782 - 844
Target Start/End: Complemental strand, 22342187 - 22342125
Alignment:
782 ttttactttccaaaggaggggagtgtacattttaacataagagggg-tatggagtgtaattcaa 844  Q
    ||||||||| ||| |||||| |||||| |||||||||||||||||| ||| |||||||||||||    
22342187 ttttacttttcaagggagggaagtgtatattttaacataagaggggatat-gagtgtaattcaa 22342125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 10702911 - 10702981
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||| | ||| ||| |||||| |||||| ||||||||||||||||||   | ||||||||||||    
10702911 agtataaatttaatttttcaagggagggaagtgtatattttaacataagaggggagagaagtgtaattcaa 10702981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 798 - 844
Target Start/End: Original strand, 11794768 - 11794814
Alignment:
798 aggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||| ||||||||||||||||||   ||||||||||||||    
11794768 aggggagtgtaaattttaacataagaggggatgggagtgtaattcaa 11794814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 727 - 760
Target Start/End: Complemental strand, 187932 - 187899
Alignment:
727 tatttaattattaagggaggagtttgtaactcaa 760  Q
    ||||||||||||||||||||||||||||| ||||    
187932 tatttaattattaagggaggagtttgtaattcaa 187899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 783 - 844
Target Start/End: Complemental strand, 2522757 - 2522696
Alignment:
783 tttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||| ||| ||||||||||||| ||||||| ||||||||||    |||||||||||||    
2522757 tttacttttcaagggaggggagtgtatattttaatataagaggggaggagagtgtaattcaa 2522696  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 796 - 841
Target Start/End: Complemental strand, 4100590 - 4100545
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaatt 841  Q
    ||||||||||||| ||||||||||||||||||   |||||||||||    
4100590 ggaggggagtgtatattttaacataagaggggaggggagtgtaatt 4100545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 778 - 827
Target Start/End: Complemental strand, 14306885 - 14306836
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||| ||| | |||| |||||| ||||||||||||||||||    
14306885 taaattttacttttcaaggaagggaagtgtatattttaacataagagggg 14306836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 796 - 844
Target Start/End: Original strand, 22022273 - 22022321
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatg-gagtgtaattcaa 844  Q
    ||||||||||||| |||||||||||||||||| ||| |||||||||||||    
22022273 ggaggggagtgtatattttaacataagagggg-atgagagtgtaattcaa 22022321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 479 - 516
Target Start/End: Original strand, 28606581 - 28606618
Alignment:
479 cattgtggttggtcaatgtcatatgacattggcacccc 516  Q
    |||||||||||| |||||||| ||||||||||||||||    
28606581 cattgtggttggccaatgtcacatgacattggcacccc 28606618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 727 - 760
Target Start/End: Complemental strand, 34280177 - 34280144
Alignment:
727 tatttaattattaagggaggagtttgtaactcaa 760  Q
    ||||||||||||||||||||||||||||| ||||    
34280177 tatttaattattaagggaggagtttgtaattcaa 34280144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 47; Significance: 2e-17; HSPs: 33)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 32448917 - 32448987
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||| ||||||||| |||||||||| |||||| ||||||||||||||||||  |||||||||||||||    
32448917 agtataacttttacttttcaaaggagggaagtgtatattttaacataagaggggagtggagtgtaattcaa 32448987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 55068941 - 55068871
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||   ||||||||||||||    
55068941 agtataaattttactttacaagggaggggagtgtatattttaacataagaggggaggggagtgtaattcaa 55068871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 772 - 844
Target Start/End: Complemental strand, 51019751 - 51019679
Alignment:
772 gaagtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||||| ||| |||||| |||||| ||||||||||||||||||    |||||||||||||    
51019751 gaagtataaattttacttttcaagggagggaagtgtatattttaacataagaggggaggagagtgtaattcaa 51019679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 774 - 827
Target Start/End: Original strand, 7479323 - 7479376
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||||| ||| |||||| |||||| ||||||||||||||||||    
7479323 agtataaattttacttttcaagggagggaagtgtatattttaacataagagggg 7479376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 774 - 850
Target Start/End: Complemental strand, 21037396 - 21037320
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttct 850  Q
    ||||||||||||||||| ||| |||||  |||||| ||||||||||||||| ||   |||||||||||||| |||||    
21037396 agtataaattttacttttcaagggaggaaagtgtatattttaacataagagaggaggggagtgtaattcaagcttct 21037320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 13482281 - 13482211
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||| || |||||||| ||| ||||||||||||| ||||||||||||||||||    |||||||||||||    
13482281 agtatcaactttacttttcaagggaggggagtgtatattttaacataagaggggaggagagtgtaattcaa 13482211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 16192292 - 16192362
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||||| || |||  |||||||||||| ||||||||||||||| ||   ||||||||||||||    
16192292 agtataaattttacattgcaagtgaggggagtgtatattttaacataagagaggaggggagtgtaattcaa 16192362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 778 - 844
Target Start/End: Original strand, 23722032 - 23722098
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||| ||| ||| |||||| |||||| ||||||||||||||||||   ||||||||||||||    
23722032 taaattttatttttcaagggagggtagtgtatattttaacataagaggggaggggagtgtaattcaa 23722098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 36898076 - 36898146
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||| |||| ||| ||||||||||||| |||||||||||| ||| |   ||||||||||||||    
36898076 agtataaatttttcttttcaagggaggggagtgtatattttaacataaaaggagaggggagtgtaattcaa 36898146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 37424424 - 37424493
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||||||||| || ||||| ||||||| ||||||||||||||||||   ||| ||||||||||    
37424424 agtataaattttactttc-aagggaggtgagtgtatattttaacataagaggggaggggaatgtaattcaa 37424493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 775 - 844
Target Start/End: Original strand, 25010035 - 25010104
Alignment:
775 gtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||||||| ||| |||  |||||||| ||||||||||||||||||    |||||||||||||    
25010035 gtataaattttacttttcaagggaatggagtgtatattttaacataagaggggaggagagtgtaattcaa 25010104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 774 - 850
Target Start/End: Complemental strand, 4963995 - 4963919
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttct 850  Q
    |||||||||||||||||  |||||||| | ||||| |||||||||||| | ||| |  ||||||||| |||||||||    
4963995 agtataaattttactttttaaaggaggagggtgtaaattttaacataaaacgggaagagagtgtaatccaaacttct 4963919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Complemental strand, 17722826 - 17722778
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||||   ||||||||||||||    
17722826 ggaggggagtgtatattttaacataagaggggaggggagtgtaattcaa 17722778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 460 - 516
Target Start/End: Original strand, 22435443 - 22435498
Alignment:
460 ttttttgtacaccttgtggcattgtggttggtcaatgtcatatgacattggcacccc 516  Q
    |||||||||||| ||||| ||||||||||||||||||||  || |||||||||||||    
22435443 ttttttgtacac-ttgtgacattgtggttggtcaatgtcgcataacattggcacccc 22435498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Original strand, 35667282 - 35667330
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||||   ||||||||||||||    
35667282 ggaggggagtgtatattttaacataagaggggaggggagtgtaattcaa 35667330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 780 - 844
Target Start/End: Original strand, 35667364 - 35667428
Alignment:
780 aattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||| ||| |||||| |||||| ||||||||||||||||||   | ||||||||||||    
35667364 aattttacttttcaagggagggaagtgtatattttaacataagaggggagggaagtgtaattcaa 35667428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 780 - 844
Target Start/End: Complemental strand, 37147831 - 37147767
Alignment:
780 aattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||| ||| ||| |||||| |||||| ||||||||||||||||||   ||||||||||||||    
37147831 aattttaattttcaagggagggaagtgtatattttaacataagaggggagaggagtgtaattcaa 37147767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Complemental strand, 37708851 - 37708803
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||||   ||||||||||||||    
37708851 ggaggggagtgtatattttaacataagaggggagaggagtgtaattcaa 37708803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 825
Target Start/End: Complemental strand, 8138420 - 8138369
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagg 825  Q
    ||||||||||||| ||| ||| |||||| |||||| ||||||||||||||||    
8138420 agtataaattttatttttcaagggagggaagtgtatattttaacataagagg 8138369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 778 - 844
Target Start/End: Complemental strand, 19313439 - 19313373
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagaggggtatg-gagtgtaattcaa 844  Q
    ||||||||| |||  || ||||||||||||| |||||||||||||||||| ||| |||||||||||||    
19313439 taaattttattttttaagggaggggagtgtatattttaacataagagggg-atgagagtgtaattcaa 19313373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 472 - 515
Target Start/End: Original strand, 43404606 - 43404649
Alignment:
472 cttgtggcattgtggttggtcaatgtcatatgacattggcaccc 515  Q
    |||||| ||||||||||| ||||||||| |||||||||||||||    
43404606 cttgtgacattgtggttgatcaatgtcagatgacattggcaccc 43404649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 721956 - 722026
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||| || |||||||| ||| ||||  ||||||| ||||||||||||||||||   ||||||||||||||    
721956 agtatcaactttacttttcaagggagatgagtgtatattttaacataagaggggagaggagtgtaattcaa 722026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 754966 - 754896
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||| || |||||||| ||| ||||  ||||||| ||||||||||||||||||   ||||||||||||||    
754966 agtatcaactttacttttcaagggagatgagtgtatattttaacataagaggggagaggagtgtaattcaa 754896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 6711330 - 6711260
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||| ||||||  ||||| ||||||||| ||||||||   | ||||||||||||    
6711330 agtataaattttacttttcaagggagggaggtgtatattttaacacaagaggggagggaagtgtaattcaa 6711260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 778 - 844
Target Start/End: Original strand, 7797594 - 7797660
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||| |||||| |||||| |||||||||||||| |||   ||| ||||||||||    
7797594 taaattttacttttcaagggagggaagtgtatattttaacataagaagggaggggaatgtaattcaa 7797660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 800 - 846
Target Start/End: Original strand, 33047232 - 33047278
Alignment:
800 gggagtgtacattttaacataagaggggtatggagtgtaattcaaac 846  Q
    ||||||||| ||||||||||||||||||   ||||||||||||||||    
33047232 gggagtgtatattttaacataagaggggaggggagtgtaattcaaac 33047278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 824
Target Start/End: Complemental strand, 35666050 - 35666000
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagag 824  Q
    ||||||||||||||||| ||| |||||  |||||| |||||||||||||||    
35666050 agtataaattttacttttcaagggaggtaagtgtatattttaacataagag 35666000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 688 - 729
Target Start/End: Original strand, 20964466 - 20964507
Alignment:
688 ttttttgcaaatgactcagttattgtgggacgaggggagtat 729  Q
    |||||||||||||||||||||||| |||||||  ||||||||    
20964466 ttttttgcaaatgactcagttattatgggacggagggagtat 20964507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 774 - 827
Target Start/End: Complemental strand, 26705132 - 26705079
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||| ||||||| ||| ||| ||||||| ||||| ||||||||||||||||||    
26705132 agtattaattttatttttcaatggaggggtgtgtatattttaacataagagggg 26705079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 799 - 844
Target Start/End: Original strand, 35667758 - 35667803
Alignment:
799 ggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||| ||||||||||||||||||   ||||||||||||||    
35667758 ggggagtgtatattttaacataagaggggaggggagtgtaattcaa 35667803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 776 - 845
Target Start/End: Complemental strand, 44664802 - 44664733
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaa 845  Q
    ||||||||||| ||| ||| ||||| || |||| ||||||||||||||||||   | |||||||||||||    
44664802 tataaattttatttttcaagggaggagaatgtatattttaacataagaggggagagaagtgtaattcaaa 44664733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 774 - 827
Target Start/End: Complemental strand, 48372513 - 48372460
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||| |||| |||| ||| |||||||||| || ||||||||||||||||||    
48372513 agtataagtttttcttttcaagggaggggagtatatattttaacataagagggg 48372460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 774 - 827
Target Start/End: Original strand, 50825262 - 50825315
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||||| |||||||   ||| ||| ||||||||||||||||||    
50825262 agtataaattttacttttcaaaggaatagagggtatattttaacataagagggg 50825315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 46; Significance: 9e-17; HSPs: 35)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 9e-17
Query Start/End: Original strand, 774 - 851
Target Start/End: Complemental strand, 17564768 - 17564691
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||   | |||||||||||||| ||||    
17564768 agtataaattttacttttcaagggaggggagtgtatattttaacataagaggggagggaagtgtaattcaaacatctt 17564691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 14094127 - 14094197
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||| |||| ||| ||||||||||||| ||||||||||||||||||   ||||||||||||||    
14094127 agtataaatttttcttttcaagggaggggagtgtaaattttaacataagaggggaggggagtgtaattcaa 14094197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 774 - 846
Target Start/End: Original strand, 31740126 - 31740197
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaac 846  Q
    ||||||||||||||||| ||| ||||||||||||| ||||||| |||||||||| |  |||||||||||||||    
31740126 agtataaattttacttttcaagggaggggagtgtatattttaatataagagggg-agagagtgtaattcaaac 31740197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 727 - 827
Target Start/End: Complemental strand, 40791199 - 40791093
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||||| | |||||| ||||       ||| ||||| | ||||||||||||||||| ||| |||||| |||||| |||||||||||    
40791199 tatttaattattaagggagggggttgtaattcaaacatcttataagggaagggagtataaattttacttttcaagggagggtagtgtatattttaacata 40791100  T
821 agagggg 827  Q
    |||||||    
40791099 agagggg 40791093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 253623 - 253556
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||| ||||||| ||| |||| |||||||| ||||||||||||||||||   ||||||||||||||    
253623 agtataaatcttacttttcaagggagaggagtgtatattttaacataagagggg---ggagtgtaattcaa 253556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 662235 - 662302
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||| ||||||| ||| |||| |||||||| ||||||||||||||||||   ||||||||||||||    
662235 agtataaatcttacttttcaagggagaggagtgtatattttaacataagagggg---ggagtgtaattcaa 662302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 848033 - 848100
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||| ||||||| ||| |||| |||||||| ||||||||||||||||||   ||||||||||||||    
848033 agtataaatcttacttttcaagggagaggagtgtatattttaacataagagggg---ggagtgtaattcaa 848100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 727 - 824
Target Start/End: Original strand, 34925329 - 34925432
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||||||| |||||| ||||       ||| |||||   |||||| |||||||||| ||| ||||||||||||| |||||||||||    
34925329 tatttaattattaagggaggaggttgtaattcaagcatcttataagggaagagagtatacattttacttttcaagggaggggagtgtatattttaacata 34925428  T
821 agag 824  Q
    ||||    
34925429 agag 34925432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 796 - 851
Target Start/End: Complemental strand, 8437975 - 8437920
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||| ||||||||||||||| ||  ||||||||||||||||| ||||    
8437975 ggaggggagtgtatattttaacataagagaggagtggagtgtaattcaaacatctt 8437920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 681 - 728
Target Start/End: Original strand, 10729085 - 10729132
Alignment:
681 gacaatattttttgcaaatgactcagttattgtgggacgaggggagta 728  Q
    ||||||||||||||||||||||||||||||| |||||||  |||||||    
10729085 gacaatattttttgcaaatgactcagttattatgggacggagggagta 10729132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 462 - 516
Target Start/End: Original strand, 3647479 - 3647532
Alignment:
462 ttttgtacaccttgtggcattgtggttggtcaatgtcatatgacattggcacccc 516  Q
    |||||||||| ||||| |||||||||||| |||||||| ||||||||||||||||    
3647479 ttttgtacac-ttgtgtcattgtggttggccaatgtcacatgacattggcacccc 3647532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 8438544 - 8438614
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||| |||  |||||||||||| ||||||||||||||| |   |||||||||||||||    
8438544 agtataaattttatttttcaatagaggggagtgtatattttaacataagagagaagtggagtgtaattcaa 8438614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 824
Target Start/End: Original strand, 11760044 - 11760094
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagag 824  Q
    ||||||||||||||||| ||||||||  ||||||| |||||||||||||||    
11760044 agtataaattttacttttcaaaggagaagagtgtatattttaacataagag 11760094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 776 - 846
Target Start/End: Original strand, 17734890 - 17734960
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaac 846  Q
    ||||||||||||||| ||| ||||| || |||| |||||||||||||||||    ||||||||||||||||    
17734890 tataaattttacttttcaagggaggtgaatgtatattttaacataagagggaagaggagtgtaattcaaac 17734960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 44284327 - 44284397
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||| ||| |||||  |||||| ||||||||||||||||||   ||||||||||||||    
44284327 agtataaattttatttttcaagggaggaaagtgtatattttaacataagaggggaggggagtgtaattcaa 44284397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 727 - 826
Target Start/End: Complemental strand, 44746327 - 44746222
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||||| | |||||| ||||       ||||||||  ||||||| ||||||| ||| ||| |||||||| |||| |||||||||||    
44746327 tatttaattattaagggagggggttgtaattcaaacatcttataggggagggaagtattaattttatttttcaagggaggggaatgtatattttaacata 44746228  T
821 agaggg 826  Q
    ||||||    
44746227 agaggg 44746222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 851
Target Start/End: Complemental strand, 14879620 - 14879543
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||||||| ||| ||| || | |||| ||||||||||||||||||    ||||||||||||||| ||||    
14879620 agtataaattttacttttcaagggacggaaatgtatattttaacataagaggggaggagagtgtaattcaaacatctt 14879543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 850
Target Start/End: Complemental strand, 32903714 - 32903637
Alignment:
774 agtataaattttactttccaaagg-aggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttct 850  Q
    |||||||||||||||||  || || ||  ||||||| |||||||||||||| |||  |||||||||||||||||||||    
32903714 agtataaattttactttttaaggggagatgagtgtatattttaacataagaagggagtggagtgtaattcaaacttct 32903637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 827
Target Start/End: Original strand, 37266119 - 37266172
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||| ||||||| ||| |||| |||||||| ||||||||||||||||||    
37266119 agtataaatcttacttttcaagggagtggagtgtatattttaacataagagggg 37266172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 772 - 821
Target Start/End: Complemental strand, 37837021 - 37836972
Alignment:
772 gaagtataaattttactttccaaaggaggggagtgtacattttaacataa 821  Q
    ||||||||||||||||||| ||| |||||||| |||| ||||||||||||    
37837021 gaagtataaattttacttttcaagggaggggaatgtatattttaacataa 37836972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Complemental strand, 11140172 - 11140124
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||||   ||||||||||||||    
11140172 ggaggggagtgtatattttaacataagaggggaggggagtgtaattcaa 11140124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 474 - 514
Target Start/End: Complemental strand, 18183079 - 18183039
Alignment:
474 tgtggcattgtggttggtcaatgtcatatgacattggcacc 514  Q
    |||| |||||||||||||||||||||| |||||||||||||    
18183079 tgtgacattgtggttggtcaatgtcatgtgacattggcacc 18183039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 798 - 862
Target Start/End: Complemental strand, 31846523 - 31846459
Alignment:
798 aggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagggaagga 862  Q
    ||||||||||| ||||||||||||||||||   | |||||||||||| | |||| ||||||||||    
31846523 aggggagtgtatattttaacataagaggggagggaagtgtaattcaatcatcttttagggaagga 31846459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 825
Target Start/End: Original strand, 8443302 - 8443353
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagg 825  Q
    ||||||||||||||||| ||| ||| || |||||| ||||||||||||||||    
8443302 agtataaattttacttttcaagggaaggaagtgtatattttaacataagagg 8443353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 821
Target Start/End: Complemental strand, 13439525 - 13439478
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataa 821  Q
    ||||||||||||| ||| ||| ||||||||||||| ||||||||||||    
13439525 agtataaattttaattttcaagggaggggagtgtatattttaacataa 13439478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 861
Target Start/End: Original strand, 36016737 - 36016823
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagggaagg 861  Q
    ||||||||||||||||| ||| |||||| |||||| ||||||||||||||| ||   ||| |||||||||| | ||||  ||||||||    
36016737 agtataaattttacttttcaagggaggg-agtgtatattttaacataagagaggaggggattgtaattcaagcatctttgagggaagg 36016823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 772 - 823
Target Start/End: Original strand, 40299562 - 40299613
Alignment:
772 gaagtataaattttactttccaaaggaggggagtgtacattttaacataaga 823  Q
    |||||||||||||||||||  || |||||| |||||| ||||||||||||||    
40299562 gaagtataaattttactttttaagggagggaagtgtatattttaacataaga 40299613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 797 - 844
Target Start/End: Original strand, 40791755 - 40791802
Alignment:
797 gaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||| ||||||||||||||||||   ||||||||||||||    
40791755 gaggggagtgtatattttaacataagaggggagaggagtgtaattcaa 40791802  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 824
Target Start/End: Original strand, 11141038 - 11141088
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagag 824  Q
    ||||||||||||| ||| ||  ||||||||||||| |||||||||||||||    
11141038 agtataaattttatttttcatgggaggggagtgtatattttaacataagag 11141088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 795 - 841
Target Start/End: Original strand, 13422064 - 13422110
Alignment:
795 aggaggggagtgtacattttaacataagaggggtatggagtgtaatt 841  Q
    |||||||||||||| ||||||||||||||||||   |||||||||||    
13422064 aggaggggagtgtatattttaacataagaggggaggggagtgtaatt 13422110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 824
Target Start/End: Complemental strand, 30056387 - 30056337
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagag 824  Q
    ||||||||||||||||| ||| ||||| | ||||| |||||||||||||||    
30056387 agtataaattttacttttcaagggaggagtgtgtatattttaacataagag 30056337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 34364010 - 34363941
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||| |||||| | |||| |||||||||||| |||||   ||||||||||||||    
34364010 agtataaattttacttttcaagggagggaaatgtatattttaacataa-aggggaggggagtgtaattcaa 34363941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 37872844 - 37872913
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||| ||||||||| ||| | |||||| |||| |||||||||||||||||| | |||| |||||||||    
37872844 agtataacttttacttttcaaggaaggggaatgtatattttaacataagagggg-agggagggtaattcaa 37872913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 688 - 729
Target Start/End: Complemental strand, 14689895 - 14689854
Alignment:
688 ttttttgcaaatgactcagttattgtgggacgaggggagtat 729  Q
    |||||||||||||||||||||||| |||||||  ||||||||    
14689895 ttttttgcaaatgactcagttattatgggacggagggagtat 14689854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 798 - 851
Target Start/End: Original strand, 25485427 - 25485480
Alignment:
798 aggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||| |||||||| |||||||||   |||||||||||||||| ||||    
25485427 aggggagtgtatattttaacttaagaggggaggggagtgtaattcaaacatctt 25485480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 45; Significance: 4e-16; HSPs: 45)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 45; E-Value: 4e-16
Query Start/End: Original strand, 774 - 846
Target Start/End: Complemental strand, 33978655 - 33978584
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaac 846  Q
    ||||||||||||||||| |||||||||||| | || |||||||||||||||||  ||||||||||||||||||    
33978655 agtataaattttacttttcaaaggagggga-tatatattttaacataagagggaaatggagtgtaattcaaac 33978584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 40036372 - 40036442
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||   ||| ||||||||||    
40036372 agtataaattttactttgcaagggaggggagtgtatattttaacataagaggggaggggaatgtaattcaa 40036442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 774 - 851
Target Start/End: Original strand, 49765105 - 49765182
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    |||||||||||||| || ||| |||||||| |||| ||||||||||||||||||   |||||||||||||||| ||||    
49765105 agtataaattttacctttcaagggaggggaatgtatattttaacataagaggggaggggagtgtaattcaaacatctt 49765182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 762 - 850
Target Start/End: Complemental strand, 11397699 - 11397611
Alignment:
762 ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttct 850  Q
    |||||||| || ||||||||||||||||| ||| ||| | ||||||| ||||||||||||||||||   | |||||||||||| |||||    
11397699 ataggggagtggagtataaattttacttttcaagggatgagagtgtatattttaacataagaggggagggaagtgtaattcaagcttct 11397611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 1262497 - 1262427
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| |||  |||| ||||||| ||||||||||||||||||   ||||||||||||||    
1262497 agtataaattttacttttcaagagaggagagtgtatattttaacataagaggggaggggagtgtaattcaa 1262427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 11345335 - 11345405
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||| |||| |||| ||| ||||||||||||| ||||||||||||||||||   ||||||||||||||    
11345335 agtataagttttcctttacaagggaggggagtgtatattttaacataagaggggaggggagtgtaattcaa 11345405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 18364730 - 18364660
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||| ||||||| ||| ||| ||||||||||||| ||||||||||||||||||   ||||||||||||||    
18364730 agtattaattttatttttcaagggaggggagtgtatattttaacataagaggggaggggagtgtaattcaa 18364660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 54403659 - 54403589
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||| ||||||||| ||| |||||| |||||| ||||||||||||||||||   ||||||||||||||    
54403659 agtataacttttacttttcaagggagggaagtgtatattttaacataagaggggaggggagtgtaattcaa 54403589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 775 - 844
Target Start/End: Original strand, 3090395 - 3090464
Alignment:
775 gtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||| |||| ||| ||||||||||||| ||||||||||||||||||   |||||| |||||||    
3090395 gtataaattttccttttcaagggaggggagtgtatattttaacataagaggggaggggagtgcaattcaa 3090464  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 774 - 827
Target Start/End: Original strand, 17764938 - 17764991
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||| ||||||| ||| ||||||||||||| ||||||||||||||||||    
17764938 agtataaatcttacttttcaagggaggggagtgtatattttaacataagagggg 17764991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 774 - 827
Target Start/End: Original strand, 19066258 - 19066311
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||| ||||||| ||| ||||||||||||| ||||||||||||||||||    
19066258 agtataaatcttacttttcaagggaggggagtgtatattttaacataagagggg 19066311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 774 - 851
Target Start/End: Original strand, 40974674 - 40974751
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    |||||||||||||| || |||  |||||||||||| ||||||||||||||||||   | |||||||||||||| ||||    
40974674 agtataaattttacattgcaagtgaggggagtgtatattttaacataagaggggacggaagtgtaattcaaacatctt 40974751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 776 - 844
Target Start/End: Complemental strand, 54605860 - 54605792
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||  || ||| ||||||||||||| ||||||||||||||||||   ||||||||||||||    
54605860 tataaattttaactttcaagggaggggagtgtatattttaacataagaggggaggggagtgtaattcaa 54605792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 776 - 851
Target Start/End: Complemental strand, 16067322 - 16067247
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    |||||||||||||||  |||||| |||| |||| ||||||||||||||||||    ||||||||||||||| ||||    
16067322 tataaattttactttttaaaggacgggaatgtatattttaacataagaggggaggagagtgtaattcaaacatctt 16067247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 772 - 827
Target Start/End: Complemental strand, 23682093 - 23682038
Alignment:
772 gaagtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||| ||||||| ||| ||| ||||||||||||| ||||||||||||||||||    
23682093 gaagtattaattttatttttcaagggaggggagtgtatattttaacataagagggg 23682038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 772 - 827
Target Start/End: Complemental strand, 24054330 - 24054275
Alignment:
772 gaagtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||| ||||||| ||| ||| ||||||||||||| ||||||||||||||||||    
24054330 gaagtattaattttatttttcaagggaggggagtgtatattttaacataagagggg 24054275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 781 - 851
Target Start/End: Original strand, 1364035 - 1364105
Alignment:
781 attttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||| |  ||||||||||||| |||||||||||||||| |   |||||||||||||||| ||||    
1364035 attttactttcaaggggaggggagtgtatattttaacataagaggagatgggagtgtaattcaaacatctt 1364105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 22518557 - 22518626
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||||||| | ||||||||| |||||| ||||||||||||||||||   | ||||||||||||    
22518557 agtataaattttacttac-aaaggagggaagtgtatattttaacataagaggggagagaagtgtaattcaa 22518626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 780 - 862
Target Start/End: Original strand, 44500025 - 44500107
Alignment:
780 aattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagggaagga 862  Q
    ||||||||||| |||  ||||| |||||| ||||||||||||||||||   |||||||||||||| | ||||  |||||||||    
44500025 aattttacttttcaagagagggaagtgtatattttaacataagaggggaggggagtgtaattcaagcatctttgagggaagga 44500107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 824
Target Start/End: Original strand, 53490707 - 53490757
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagag 824  Q
    ||||||||| ||||||| ||| ||||||||||||| |||||||||||||||    
53490707 agtataaatcttacttttcaagggaggggagtgtatattttaacataagag 53490757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 775 - 844
Target Start/End: Complemental strand, 13623274 - 13623205
Alignment:
775 gtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||| ||| ||| |||||| |||||| ||||||||||||||||||   | ||||||||||||    
13623274 gtataaattttaattttcaagggagggaagtgtatattttaacataagaggggagggaagtgtaattcaa 13623205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 827
Target Start/End: Complemental strand, 27394351 - 27394298
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    |||||||||||||||||  || |||||||| |||| ||||||||||||||||||    
27394351 agtataaattttactttttaagggaggggaatgtatattttaacataagagggg 27394298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 787 - 844
Target Start/End: Original strand, 41587300 - 41587357
Alignment:
787 ctttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||| ||| ||||||||||||| ||||||||||||||||||   ||||||||||||||    
41587300 cttttcaagggaggggagtgtatattttaacataagaggggagaggagtgtaattcaa 41587357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 778 - 826
Target Start/End: Complemental strand, 291205 - 291157
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagaggg 826  Q
    |||||||| |||| ||| ||||||||||||| |||||||||||||||||    
291205 taaatttttcttttcaagggaggggagtgtatattttaacataagaggg 291157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 772 - 844
Target Start/End: Complemental strand, 7724669 - 7724597
Alignment:
772 gaagtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||| ||| ||| |||||  ||| |  |||||||||||||||||| ||||||| ||||||||    
7724669 gaagtataaattttatttttcaagggaggaaagtatttattttaacataagaggggaatggagtataattcaa 7724597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 472 - 516
Target Start/End: Complemental strand, 16205764 - 16205720
Alignment:
472 cttgtggcattgtggttggtcaatgtcatatgacattggcacccc 516  Q
    |||||| ||||||||||| ||||||||| ||||||||||||||||    
16205764 cttgtgacattgtggttgatcaatgtcacatgacattggcacccc 16205720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Original strand, 18365279 - 18365327
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||||   ||||||||||||||    
18365279 ggaggggagtgtatattttaacataagaggggaggggagtgtaattcaa 18365327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 775 - 857
Target Start/End: Complemental strand, 9830373 - 9830291
Alignment:
775 gtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatg-gagtgtaattcaaacttcttctaggg 857  Q
    |||||| ||||| ||| ||| ||||||||||||| |||||||| ||||||||| |||  |||||||||||| |||||| |||||    
9830373 gtataacttttatttttcaagggaggggagtgtatattttaacttaagagggg-atgaaagtgtaattcaagcttcttttaggg 9830291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 688 - 719
Target Start/End: Original strand, 21296681 - 21296712
Alignment:
688 ttttttgcaaatgactcagttattgtgggacg 719  Q
    ||||||||||||||||||||||||||||||||    
21296681 ttttttgcaaatgactcagttattgtgggacg 21296712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 796 - 851
Target Start/End: Complemental strand, 37183156 - 37183101
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||| |||||||| |||||||||   |||||||||||||||| ||||    
37183156 ggaggggagtgtatattttaacttaagaggggaggggagtgtaattcaaacatctt 37183101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 796 - 851
Target Start/End: Complemental strand, 40974114 - 40974059
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    |||||||| |||| ||||||||||||||||||   |||||||||||||||| ||||    
40974114 ggaggggattgtatattttaacataagaggggaggggagtgtaattcaaacatctt 40974059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 798 - 844
Target Start/End: Original strand, 2756607 - 2756653
Alignment:
798 aggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||| ||||||||||||||||||   ||||||||||||||    
2756607 aggggagtgtatattttaacataagaggggaggggagtgtaattcaa 2756653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 824
Target Start/End: Original strand, 3541060 - 3541110
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagag 824  Q
    ||||||||||||||||| ||  |||||||| |||| |||||||||||||||    
3541060 agtataaattttacttttcatgggaggggaatgtatattttaacataagag 3541110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 14600477 - 14600407
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||| || |||||||| |||||||| | |||||| ||||||||||||| ||||   ||||||||||||||    
14600477 agtatcaaatttacttttcaaaggagtgaagtgtatattttaacataagtggggaggggagtgtaattcaa 14600407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 688 - 730
Target Start/End: Original strand, 32023272 - 32023314
Alignment:
688 ttttttgcaaatgactcagttattgtgggacgaggggagtatt 730  Q
    |||||||||| ||||||||||||| |||||||| |||||||||    
32023272 ttttttgcaattgactcagttattatgggacgaagggagtatt 32023314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 688 - 730
Target Start/End: Original strand, 38600977 - 38601019
Alignment:
688 ttttttgcaaatgactcagttattgtgggacgaggggagtatt 730  Q
    |||||||||||||||||||||||| |||||||  |||||||||    
38600977 ttttttgcaaatgactcagttattatgggacggagggagtatt 38601019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 681 - 719
Target Start/End: Complemental strand, 41286989 - 41286951
Alignment:
681 gacaatattttttgcaaatgactcagttattgtgggacg 719  Q
    ||||||||||||||||||||||||| ||||| |||||||    
41286989 gacaatattttttgcaaatgactcatttattatgggacg 41286951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 796 - 846
Target Start/End: Original strand, 54606422 - 54606472
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaac 846  Q
    ||||||||||||| |||||||||||||||| |   ||||||||||||||||    
54606422 ggaggggagtgtatattttaacataagaggagaggggagtgtaattcaaac 54606472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 688 - 729
Target Start/End: Original strand, 1334947 - 1334988
Alignment:
688 ttttttgcaaatgactcagttattgtgggacgaggggagtat 729  Q
    |||||||||||||||||||||||| |||||||  ||||||||    
1334947 ttttttgcaaatgactcagttattatgggacggagggagtat 1334988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 727 - 760
Target Start/End: Original strand, 4758049 - 4758082
Alignment:
727 tatttaattattaagggaggagtttgtaactcaa 760  Q
    ||||||||||||||||||||||||||||| ||||    
4758049 tatttaattattaagggaggagtttgtaattcaa 4758082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 774 - 823
Target Start/End: Original strand, 6296721 - 6296770
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataaga 823  Q
    |||||||||||||||||  || |||| |||||||| ||||||||||||||    
6296721 agtataaattttacttttgaagggagaggagtgtagattttaacataaga 6296770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 727 - 760
Target Start/End: Complemental strand, 14601588 - 14601555
Alignment:
727 tatttaattattaagggaggagtttgtaactcaa 760  Q
    ||||||||||||||||||||||||||||| ||||    
14601588 tatttaattattaagggaggagtttgtaattcaa 14601555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 775 - 844
Target Start/End: Complemental strand, 25480626 - 25480557
Alignment:
775 gtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||||||| ||| |||||  |||||| |||||||||||||| |||   ||||| ||||||||    
25480626 gtataaattttactttacaagggaggaaagtgtatattttaacataagatgggaggggagtataattcaa 25480557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 781 - 846
Target Start/End: Original strand, 32222073 - 32222138
Alignment:
781 attttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaac 846  Q
    |||||||||| ||| | |||  |||||| |||||||||||||| ||| | ||||||||||||||||    
32222073 attttacttttcaaggaaggtaagtgtatattttaacataagaagggaagggagtgtaattcaaac 32222138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 727 - 760
Target Start/End: Original strand, 37183674 - 37183707
Alignment:
727 tatttaattattaagggaggagtttgtaactcaa 760  Q
    ||||||||||||||||||||||||||||| ||||    
37183674 tatttaattattaagggaggagtttgtaattcaa 37183707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0189 (Bit Score: 44; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0189
Description:

Target: scaffold0189; HSP #1
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 727 - 827
Target Start/End: Complemental strand, 11440 - 11334
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||||| | |||||| ||||       ||||||||| | ||| ||||||||||||| ||| ||||||||||||| |||||||||||    
11440 tatttaattattaagggagggggttgtaattcaagcatcttataggggaagggagtgtaaattttacttttcaagggaggggagtgtatattttaacata 11341  T
821 agagggg 827  Q
    |||||||    
11340 agagggg 11334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0695 (Bit Score: 43; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0695
Description:

Target: scaffold0695; HSP #1
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 2321 - 2251
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||| |||| ||| ||||||||||||| ||||||||||||||||||   ||||||||||||||    
2321 agtataaatttttcttttcaagggaggggagtgtaaattttaacataagaggggaggggagtgtaattcaa 2251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0368 (Bit Score: 43; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0368
Description:

Target: scaffold0368; HSP #1
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 778 - 844
Target Start/End: Original strand, 11238 - 11304
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||| ||||||||||||||| ||   ||||||||||||||    
11238 taaattttacttttcaaaggaggggagtgtatattttaacataagagcggaggggagtgtaattcaa 11304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068 (Bit Score: 43; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0068
Description:

Target: scaffold0068; HSP #1
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 59358 - 59288
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||| ||||||||||||| ||||||||||||||||||    |||||||||||||    
59358 agtataaattttacttttcaagggaggggagtgtatattttaacataagaggggaggagagtgtaattcaa 59288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 43; Significance: 0.000000000000006; HSPs: 30)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 36604824 - 36604754
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| |||||||||| |||||| |||||||||||||||||    ||||||||||||||    
36604824 agtataaattttacttttcaaaggagggaagtgtatattttaacataagagggaagaggagtgtaattcaa 36604754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000006
Query Start/End: Original strand, 778 - 844
Target Start/End: Original strand, 42831182 - 42831248
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||| ||||||||||||||| ||   ||||||||||||||    
42831182 taaattttacttttcaaaggaggggagtgtatattttaacataagagcggaggggagtgtaattcaa 42831248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 727 - 844
Target Start/End: Complemental strand, 16536522 - 16536399
Alignment:
727 tatttaattattaagggaggagtttgtaactcaa------cataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    ||||||||||||||||||| |||||| || ||||      |||| ||||  | ||||| || |||||||| ||| ||||||||||||| |||||||||||    
16536522 tatttaattattaagggagaagtttgaaattcaagcatctcataagggaggggagtatcaaatttacttttcaagggaggggagtgtatattttaacata 16536423  T
821 agaggggtatggagtgtaattcaa 844  Q
    |||||||   ||||||||||||||    
16536422 agaggggaggggagtgtaattcaa 16536399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 774 - 845
Target Start/End: Complemental strand, 2275186 - 2275115
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaa 845  Q
    ||||||||| |||||||  || |||| |||||||| |||||||||||||||||| ||||| |||||||||||    
2275186 agtataaatcttactttttaagggagaggagtgtatattttaacataagaggggaatggaatgtaattcaaa 2275115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 27225773 - 27225703
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||| |||||| |||||| ||||||||||||||||||    |||||||||||||    
27225773 agtataaattttacttttcaagggagggaagtgtatattttaacataagaggggaggagagtgtaattcaa 27225703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 45737402 - 45737332
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||| ||| ||||| ||||||| ||||||||||||||||||   ||||||||||||||    
45737402 agtataaattttatttttcaagggaggagagtgtatattttaacataagaggggaggggagtgtaattcaa 45737332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 774 - 827
Target Start/End: Complemental strand, 4007650 - 4007597
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||||| |||||||| || ||||| ||||||||||||||||||    
4007650 agtataaattttacttttcaaaggagaggggtgtatattttaacataagagggg 4007597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 774 - 851
Target Start/End: Original strand, 49129652 - 49129729
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||| ||| ||| ||||  || |||| ||||||||||||||||||   |||||||||||||||||||||    
49129652 agtataaattttatttttcaagggagaagattgtatattttaacataagaggggaggggagtgtaattcaaacttctt 49129729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 774 - 861
Target Start/End: Original strand, 10012428 - 10012515
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatgg-agtgtaattcaaacttcttctagggaagg 861  Q
    ||||||||||||||| | ||| |||||| |||||| |||||||||||||||||| |||| || ||||||||| |||||  |||||||||    
10012428 agtataaattttactgttcaagggagggaagtgtatattttaacataagagggg-atggaagggtaattcaagcttctcttagggaagg 10012515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 774 - 845
Target Start/End: Complemental strand, 17109402 - 17109332
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaa 845  Q
    ||||| ||||||||||| ||| ||||||||||||| ||||||||||||||| |  | |||||||||||||||    
17109402 agtatcaattttacttttcaagggaggggagtgtatattttaacataagagagaga-ggagtgtaattcaaa 17109332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 774 - 861
Target Start/End: Complemental strand, 19071808 - 19071722
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagggaagg 861  Q
    ||||||||||||||||| ||  |||||| |||||| ||||||||||||||||||    ||||||||||||||| ||||  ||||||||    
19071808 agtataaattttacttttcacgggaggg-agtgtatattttaacataagaggggaggagagtgtaattcaaacatctttgagggaagg 19071722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 774 - 861
Target Start/End: Complemental strand, 19119698 - 19119612
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttcttctagggaagg 861  Q
    ||||||||||||||||| ||  |||||| |||||| ||||||||||||||||||    ||||||||||||||| ||||  ||||||||    
19119698 agtataaattttacttttcacgggaggg-agtgtatattttaacataagaggggaggagagtgtaattcaaacatctttgagggaagg 19119612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 727 - 844
Target Start/End: Original strand, 45559688 - 45559811
Alignment:
727 tatttaattattaagggaggagtttgtaactcaa----catag--gggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    ||||||||||||||||||||  ||||||| ||||    |||||  ||||  | ||||||||||||||||| ||| | |||||| |||| |||||||||||    
45559688 tatttaattattaagggagggatttgtaattcaagcatcatagaagggagaggagtataaattttacttttcaaggaaggggattgtatattttaacata 45559787  T
821 agaggggtatggagtgtaattcaa 844  Q
    ||||| |   ||||||||||||||    
45559788 agaggagatgggagtgtaattcaa 45559811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 774 - 825
Target Start/End: Complemental strand, 47216154 - 47216103
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagg 825  Q
    ||||||||||||||||| ||||| ||| ||||||| ||||||||||||||||    
47216154 agtataaattttactttacaaagaaggcgagtgtatattttaacataagagg 47216103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 772 - 826
Target Start/End: Complemental strand, 13573598 - 13573544
Alignment:
772 gaagtataaattttactttccaaaggaggggagtgtacattttaacataagaggg 826  Q
    ||||||||||||||||||| ||| ||||||| ||||| || ||||||||||||||    
13573598 gaagtataaattttacttttcaatggaggggcgtgtatatcttaacataagaggg 13573544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 45738097 - 45738027
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||||||||  || |||||| |||||| ||||||||||||||||||    |||||||||||||    
45738097 agtataaattttactttttaagggagggaagtgtatattttaacataagaggggaggagagtgtaattcaa 45738027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 727 - 846
Target Start/End: Complemental strand, 50143535 - 50143410
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||||| |||||||| ||||       ||||||||  | | ||| |||| || ||| ||| |||||||| |||| |||||||||||    
50143535 tatttaattattaagggaggggtttgtaattcaagcatcttataggggaggggattattaattatatttttcaagggaggggaatgtatattttaacata 50143436  T
821 agaggggtatggagtgtaattcaaac 846  Q
    |||||||   ||||||||||||||||    
50143435 agaggggaggggagtgtaattcaaac 50143410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 827
Target Start/End: Complemental strand, 9091134 - 9091081
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||||   |||||||||||||||| |||||||||||| |||||    
9091134 agtataaattttacttcttaaaggaggggagtgtatattttaacataaaagggg 9091081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 27930866 - 27930792
Alignment:
774 agtataaattttactttccaaaggaggggagtg----tacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||| |||||||||||    || ||||||||||||||||||   ||||||||||||||    
27930866 agtataaattttactttacaagggaggggagtgtatatatattttaacataagaggggaggggagtgtaattcaa 27930792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 827
Target Start/End: Original strand, 43504435 - 43504488
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    |||||||||||| ||||  ||||||| |||||||| ||||||||||||||||||    
43504435 agtataaatttttctttttaaaggagaggagtgtatattttaacataagagggg 43504488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 776 - 844
Target Start/End: Original strand, 43320556 - 43320624
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||| ||| |||||| ||| || |||||||||||| |||||   ||||||||||||||    
43320556 tataaattttacttttcaagggagggaagtctatattttaacataaaaggggaggggagtgtaattcaa 43320624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 825
Target Start/End: Original strand, 4667519 - 4667570
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagg 825  Q
    ||||||||||||||||| ||| ||||  ||||||| ||||||||||||||||    
4667519 agtataaattttacttttcaagggagaagagtgtatattttaacataagagg 4667570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 796 - 851
Target Start/End: Original strand, 29510477 - 29510532
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||| |||||||||||||||||    |||||||||||||||| ||||    
29510477 ggaggggagtgtatattttaacataagagggaaggggagtgtaattcaaacatctt 29510532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 778 - 844
Target Start/End: Complemental strand, 18406623 - 18406557
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||| ||| ||| |||||| |||||| ||||||||||||||| ||   ||||||||||||||    
18406623 taaattttatttttcaagggagggtagtgtatattttaacataagagaggaggggagtgtaattcaa 18406557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 47233157 - 47233087
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||| |||| ||| | |||||| |||| |||||||||||||| |||   ||||||||||||||    
47233157 agtataaattttgcttttcaaggaaggggaatgtatattttaacataagaagggaggggagtgtaattcaa 47233087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 688 - 729
Target Start/End: Complemental strand, 2886106 - 2886065
Alignment:
688 ttttttgcaaatgactcagttattgtgggacgaggggagtat 729  Q
    |||||||||||||||||||||||| |||||||  ||||||||    
2886106 ttttttgcaaatgactcagttattatgggacggagggagtat 2886065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 774 - 827
Target Start/End: Original strand, 28198100 - 28198153
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||| ||| ||| ||||| ||||||| |||| |||||||||||||    
28198100 agtataaattttatttttcaagggaggagagtgtatatttaaacataagagggg 28198153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 776 - 825
Target Start/End: Complemental strand, 31765429 - 31765380
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagagg 825  Q
    ||||||||||| ||| ||| ||||||||||||| |||| |||||||||||    
31765429 tataaattttatttttcaagggaggggagtgtatatttgaacataagagg 31765380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 774 - 823
Target Start/End: Original strand, 33126830 - 33126879
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataaga 823  Q
    ||||||||||||||||| ||| |||||  |||||| ||||||||||||||    
33126830 agtataaattttacttttcaagggaggaaagtgtatattttaacataaga 33126879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 802 - 851
Target Start/End: Original strand, 36605405 - 36605454
Alignment:
802 gagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||| ||||||||||||||||||   |||||||||||||||| ||||    
36605405 gagtgtatattttaacataagaggggaggggagtgtaattcaaacatctt 36605454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 27)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 772 - 845
Target Start/End: Original strand, 22731034 - 22731107
Alignment:
772 gaagtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaa 845  Q
    ||||||| ||||||||||| |||| |||||||||||| |||||||||||||| |||   |||||||||||||||    
22731034 gaagtatcaattttacttttcaaaagaggggagtgtatattttaacataagaagggaggggagtgtaattcaaa 22731107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000009
Query Start/End: Original strand, 778 - 826
Target Start/End: Original strand, 8573329 - 8573377
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagaggg 826  Q
    ||||||||||||| ||||||||||||||||| |||||||||||||||||    
8573329 taaattttacttttcaaaggaggggagtgtatattttaacataagaggg 8573377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 761 - 824
Target Start/End: Original strand, 141582 - 141645
Alignment:
761 cataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacataagag 824  Q
    |||||||||  | ||||||||||||||||| |||||||||||| |||| |||||||||||||||    
141582 cataggggaggggagtataaattttacttttcaaaggaggggattgtatattttaacataagag 141645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 27979329 - 27979259
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||| ||||||||||| ||| |||||||| |||| ||||||||||||||||||   ||||||||||||||    
27979329 agtattaattttacttttcaagggaggggaatgtatattttaacataagaggggaggggagtgtaattcaa 27979259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 774 - 827
Target Start/End: Complemental strand, 14594167 - 14594114
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||||| ||| |||||| |||||| ||||||||||||||||||    
14594167 agtataaattttacttttcaagggagggaagtgtatattttaacataagagggg 14594114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 774 - 827
Target Start/End: Original strand, 20259980 - 20260033
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||||| ||| |||| |||||||| ||||||||||||||||||    
20259980 agtataaattttacttttcaagggagaggagtgtatattttaacataagagggg 20260033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 796 - 844
Target Start/End: Complemental strand, 35751592 - 35751544
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| |||||||||||||||||| | ||||||||||||||    
35751592 ggaggggagtgtatattttaacataagaggggaagggagtgtaattcaa 35751544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 776 - 844
Target Start/End: Complemental strand, 36762210 - 36762142
Alignment:
776 tataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||| ||| |||||| |||||| ||||||| ||||||||||   ||||||||||||||    
36762210 tataaattttacttttcaagggagggaagtgtatattttaaaataagaggggaggggagtgtaattcaa 36762142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 727 - 823
Target Start/End: Complemental strand, 19500917 - 19500815
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    ||||||||| |||||||||||| |||||| ||||       ||||||||  | ||||||||||||||||| ||| |||| |||||||| |||||||||||    
19500917 tatttaattgttaagggaggaggttgtaattcaaatatcttataggggaggggagtataaattttactttgcaagggagaggagtgtatattttaacata 19500818  T
821 aga 823  Q
    |||    
19500817 aga 19500815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 20183990 - 20184060
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||| ||| |||||| |||||| ||| ||||||||||||||   ||||||||||||||    
20183990 agtataaattttagttttcaagggagggaagtgtatattgtaacataagaggggaggggagtgtaattcaa 20184060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 850
Target Start/End: Original strand, 1406212 - 1406288
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatg-gagtgtaattcaaacttct 850  Q
    ||||||||||||| ||| ||| ||||| ||||||| |||||||||||||||| | ||| ||||||||||||| |||||    
1406212 agtataaattttatttttcaatggaggagagtgtatattttaacataagaggag-atgagagtgtaattcaagcttct 1406288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 762 - 827
Target Start/End: Original strand, 5138929 - 5138994
Alignment:
762 ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    |||||||| || ||||||||||||| ||| | | ||||| ||||||| ||||||||||||||||||    
5138929 ataggggagtggagtataaattttatttttcgagggaggagagtgtatattttaacataagagggg 5138994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 827
Target Start/End: Complemental strand, 12585706 - 12585653
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||||| ||| |||||  |||||| ||||||||||||||||||    
12585706 agtataaattttacttttcaagggaggaaagtgtatattttaacataagagggg 12585653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 851
Target Start/End: Complemental strand, 17336446 - 17336369
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||||||||||| ||| ||| |||||   ||||| |||||||| ||||||||| | || ||||||||||||||||||    
17336446 agtataaattttatttttcaagggaggaaggtgtatattttaacttaagaggggaagggtgtgtaattcaaacttctt 17336369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 774 - 850
Target Start/End: Complemental strand, 13279577 - 13279501
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttct 850  Q
    ||||||||||||||||| ||| ||||| || |||| ||||||||||||||| ||   | |||||||||||| |||||    
13279577 agtataaattttacttttcaagggaggagaatgtagattttaacataagagaggagggaagtgtaattcaagcttct 13279501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Complemental strand, 19408615 - 19408567
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| ||||||||||||||||||   ||||||||||||||    
19408615 ggaggggagtgtatattttaacataagaggggaggggagtgtaattcaa 19408567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 796 - 844
Target Start/End: Complemental strand, 21639094 - 21639046
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||| ||||||| ||||||||||||||||||  |||||||||||||||    
21639094 ggaggagagtgtatattttaacataagaggggagtggagtgtaattcaa 21639046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 780 - 844
Target Start/End: Original strand, 36737431 - 36737495
Alignment:
780 aattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||| ||| ||| |||||| |||||| ||||||||||||||||||   ||||||||||||||    
36737431 aattttatttttcaagggagggaagtgtatattttaacataagaggggaggggagtgtaattcaa 36737495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 845
Target Start/End: Complemental strand, 31476456 - 31476385
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaa 845  Q
    ||||||||||||||||| ||  ||||| || |||| ||||||||||||||||||   ||||| |||||||||    
31476456 agtataaattttacttttcatgggaggagaatgtatattttaacataagaggggaggggagtctaattcaaa 31476385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 774 - 844
Target Start/End: Complemental strand, 31850102 - 31850032
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatg-gagtgtaattcaa 844  Q
    ||||||||||||| ||| |||||||||  |||||| ||||||||||||||| || ||| |||||||||||||    
31850102 agtataaattttatttttcaaaggaggaaagtgtatattttaacataagagagg-atgagagtgtaattcaa 31850032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 727 - 827
Target Start/End: Complemental strand, 42598473 - 42598367
Alignment:
727 tatttaattattaagggaggagtttgtaactcaac------ataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacata 820  Q
    |||||||||||||||||||||  |||||| ||||       ||||||||   ||||||||||||| |||| |||| ||||||| | || |||||||||||    
42598473 tatttaattattaagggaggaagttgtaattcaaacatcttataggggatgaaagtataaatttttcttttcaaatgaggggaatatatattttaacata 42598374  T
821 agagggg 827  Q
    |||||||    
42598373 agagggg 42598367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 774 - 844
Target Start/End: Original strand, 3933955 - 3934025
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||||||| ||| | |||| | |||| ||||||||||||||||||   | ||||||||||||    
3933955 agtataaattttacttttcaaggaagggaaatgtatattttaacataagaggggagggaagtgtaattcaa 3934025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 763 - 821
Target Start/End: Complemental strand, 36853727 - 36853669
Alignment:
763 taggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacataa 821  Q
    |||||||  |||||||||| |||| ||| ||| ||||||||||||| ||||||||||||    
36853727 taggggagggaagtataaagtttaattttcaagggaggggagtgtatattttaacataa 36853669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 774 - 827
Target Start/End: Complemental strand, 20570256 - 20570203
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||| ||||||| ||| ||| |||||||| |||| ||||||||||||||||||    
20570256 agtattaattttatttttcaagggaggggaatgtatattttaacataagagggg 20570203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 778 - 827
Target Start/End: Complemental strand, 36742215 - 36742166
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||| ||| ||| |||||| |||||| ||||||||||||||||||    
36742215 taaattttatttttcaagggagggtagtgtatattttaacataagagggg 36742166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 796 - 841
Target Start/End: Original strand, 36742580 - 36742625
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaatt 841  Q
    ||||||||||||| ||||||||||||||||||   |||||||||||    
36742580 ggaggggagtgtatattttaacataagaggggaggggagtgtaatt 36742625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 774 - 827
Target Start/End: Original strand, 38955537 - 38955590
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||||||||||| ||| |||| ||| |||| |||||||||||| |||||    
38955537 agtataaattttacttttcaagggagaggaatgtatattttaacataaaagggg 38955590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 39; Significance: 0.000000000001; HSPs: 4)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 761 - 827
Target Start/End: Original strand, 14686 - 14752
Alignment:
761 cataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    |||||||||  | ||||||||| ||||||| ||| ||||||||||||| ||||||||||||||||||    
14686 cataggggaggggagtataaatattacttttcaagggaggggagtgtatattttaacataagagggg 14752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 761 - 827
Target Start/End: Original strand, 28832 - 28898
Alignment:
761 cataggggaatgaagtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    |||||||||  | ||||||||| ||||||| ||| ||||||||||||| ||||||||||||||||||    
28832 cataggggaggggagtataaatattacttttcaagggaggggagtgtatattttaacataagagggg 28898  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #3
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 774 - 851
Target Start/End: Complemental strand, 421245 - 421168
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    ||||| || |||||||| | | ||||||||||||| ||||||||||||||||||   |||||||||||||||| ||||    
421245 agtatcaactttacttttctagggaggggagtgtatattttaacataagaggggaggggagtgtaattcaaacatctt 421168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #4
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 796 - 851
Target Start/End: Complemental strand, 14125 - 14070
Alignment:
796 ggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttctt 851  Q
    |||||| |||||| ||||||||||||||||||   |||||||||||||||||||||    
14125 ggagggaagtgtatattttaacataagaggggagaggagtgtaattcaaacttctt 14070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0361 (Bit Score: 38; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0361
Description:

Target: scaffold0361; HSP #1
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 774 - 850
Target Start/End: Original strand, 17125 - 17201
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatg-gagtgtaattcaaacttct 850  Q
    ||||||||||||| |||  || ||||||||||||| |||||||||||||||||| ||| ||||||||||||| |||||    
17125 agtataaattttattttttaagggaggggagtgtatattttaacataagagggg-atgtgagtgtaattcaagcttct 17201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 36; Significance: 0.00000000008; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 36; E-Value: 0.00000000008
Query Start/End: Original strand, 772 - 827
Target Start/End: Complemental strand, 161357 - 161302
Alignment:
772 gaagtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    ||||||||| ||||||||  ||| ||||||||||||| ||||||||||||||||||    
161357 gaagtataagttttacttctcaatggaggggagtgtatattttaacataagagggg 161302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0043 (Bit Score: 34; Significance: 0.000000001; HSPs: 1)
Name: scaffold0043
Description:

Target: scaffold0043; HSP #1
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 774 - 843
Target Start/End: Complemental strand, 67813 - 67744
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattca 843  Q
    ||||||||||||||||| ||||||||   |||||| |||||| |||||||||||   |||||||||||||    
67813 agtataaattttacttttcaaaggagaaaagtgtatattttatcataagaggggaggggagtgtaattca 67744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0051 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0051
Description:

Target: scaffold0051; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 775 - 827
Target Start/End: Original strand, 11607 - 11659
Alignment:
775 gtataaattttactttccaaaggaggggagtgtacattttaacataagagggg 827  Q
    |||||||||||||||| |||  |||||||||||| | ||||||||||||||||    
11607 gtataaattttacttttcaagagaggggagtgtataatttaacataagagggg 11659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0034 (Bit Score: 33; Significance: 0.000000005; HSPs: 2)
Name: scaffold0034
Description:

Target: scaffold0034; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 774 - 850
Target Start/End: Complemental strand, 26004 - 25928
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaaacttct 850  Q
    |||||||||||||||||  || | ||||||||||| |||||||||||||| | |  | ||||||||||||| |||||    
26004 agtataaattttactttttaaggcaggggagtgtatattttaacataagatgagagtagagtgtaattcaagcttct 25928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0034; HSP #2
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 686 - 719
Target Start/End: Complemental strand, 97996 - 97963
Alignment:
686 tattttttgcaaatgactcagttattgtgggacg 719  Q
    |||||||||||||||||||||||||| |||||||    
97996 tattttttgcaaatgactcagttattatgggacg 97963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 33; Significance: 0.000000005; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 33; E-Value: 0.000000005
Query Start/End: Original strand, 774 - 826
Target Start/End: Original strand, 185161 - 185213
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacataagaggg 826  Q
    ||||||||||||||||| ||| | ||| ||||||| |||||||||||||||||    
185161 agtataaattttacttttcaaggaaggagagtgtatattttaacataagaggg 185213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0340 (Bit Score: 31; Significance: 0.00000008; HSPs: 1)
Name: scaffold0340
Description:

Target: scaffold0340; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 778 - 844
Target Start/End: Complemental strand, 12284 - 12218
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||| ||| |||||||||| |||| | ||||||||||||||||||   ||| ||||||||||    
12284 taaattttatttttcaaaggagggtagtgcatattttaacataagaggggagaggaatgtaattcaa 12218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0037 (Bit Score: 31; Significance: 0.00000008; HSPs: 1)
Name: scaffold0037
Description:

Target: scaffold0037; HSP #1
Raw Score: 31; E-Value: 0.00000008
Query Start/End: Original strand, 778 - 844
Target Start/End: Complemental strand, 100097 - 100031
Alignment:
778 taaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    ||||||||||||| |||  |||| ||||||| ||||||||||||||||||   | ||||||||||||    
100097 taaattttacttttcaagagaggagagtgtatattttaacataagaggggagagaagtgtaattcaa 100031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0971 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0971
Description:

Target: scaffold0971; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 774 - 819
Target Start/End: Complemental strand, 3197 - 3152
Alignment:
774 agtataaattttactttccaaaggaggggagtgtacattttaacat 819  Q
    ||||| ||||||||||| ||| ||||||||||||| ||||||||||    
3197 agtatcaattttacttttcaagggaggggagtgtatattttaacat 3152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0289 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0289
Description:

Target: scaffold0289; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 775 - 844
Target Start/End: Original strand, 4025 - 4094
Alignment:
775 gtataaattttactttccaaaggaggggagtgtacattttaacataagaggggtatggagtgtaattcaa 844  Q
    |||||||||||| ||| ||| ||| || |||||| |||||||||||||| |||   ||||||||||||||    
4025 gtataaattttaattttcaagggacggaagtgtatattttaacataagatgggaggggagtgtaattcaa 4094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0031 (Bit Score: 30; Significance: 0.0000003; HSPs: 1)
Name: scaffold0031
Description:

Target: scaffold0031; HSP #1
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 459 - 508
Target Start/End: Complemental strand, 105443 - 105395
Alignment:
459 attttttgtacaccttgtggcattgtggttggtcaatgtcatatgacatt 508  Q
    ||||||||||||| ||||| ||||||| ||||||||||||| ||||||||    
105443 attttttgtacac-ttgtgacattgtgattggtcaatgtcacatgacatt 105395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110591 times since January 2019
Visitors: 1335