View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk55-7 (Length: 259)

Name: R108-tnk55-7
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk55-7
R108-tnk55-7
[»] chr7 (24 HSPs)
chr7 (20-101)||(42554978-42555059)
chr7 (207-254)||(4956068-4956115)
chr7 (207-254)||(48433686-48433733)
chr7 (208-254)||(23824569-23824615)
chr7 (209-254)||(48619868-48619913)
chr7 (217-257)||(42554703-42554743)
chr7 (207-254)||(5228142-5228189)
chr7 (207-254)||(31793540-31793587)
chr7 (217-254)||(43440761-43440798)
chr7 (207-259)||(3961384-3961436)
chr7 (207-254)||(27454083-27454131)
chr7 (207-254)||(10091433-10091480)
chr7 (207-254)||(12166154-12166201)
chr7 (207-254)||(23602346-23602393)
chr7 (207-254)||(26606085-26606132)
chr7 (207-254)||(28914853-28914900)
chr7 (207-254)||(33413904-33413951)
chr7 (207-254)||(38378291-38378338)
chr7 (208-254)||(15025228-15025274)
chr7 (207-252)||(24030059-24030103)
chr7 (207-252)||(28712441-28712486)
chr7 (208-252)||(26455982-26456026)
chr7 (222-254)||(40273893-40273925)
chr7 (207-259)||(46266735-46266787)
[»] chr5 (20 HSPs)
chr5 (21-100)||(17053914-17053993)
chr5 (207-253)||(33545363-33545409)
chr5 (207-254)||(31250219-31250266)
chr5 (207-254)||(42208988-42209035)
chr5 (207-252)||(5263243-5263288)
chr5 (207-254)||(5039752-5039799)
chr5 (207-254)||(17077433-17077480)
chr5 (207-254)||(38503233-38503280)
chr5 (208-254)||(1572182-1572228)
chr5 (207-252)||(4395827-4395872)
chr5 (207-252)||(15470597-15470642)
chr5 (218-254)||(43227938-43227974)
chr5 (207-254)||(11935197-11935244)
chr5 (209-252)||(12256474-12256517)
chr5 (207-254)||(12375383-12375429)
chr5 (207-254)||(15680877-15680924)
chr5 (207-254)||(15696284-15696330)
chr5 (207-254)||(42902041-42902088)
chr5 (207-259)||(930914-930966)
chr5 (207-243)||(36037569-36037605)
[»] scaffold0001 (1 HSPs)
scaffold0001 (207-254)||(419784-419831)
[»] chr8 (16 HSPs)
chr8 (207-254)||(4259931-4259978)
chr8 (207-254)||(43413862-43413909)
chr8 (207-254)||(11052560-11052607)
chr8 (207-254)||(38289211-38289258)
chr8 (207-254)||(39104678-39104725)
chr8 (207-252)||(19733045-19733090)
chr8 (219-254)||(1032642-1032677)
chr8 (207-254)||(10162042-10162088)
chr8 (207-254)||(13906597-13906643)
chr8 (207-254)||(36587626-36587673)
chr8 (207-254)||(38064049-38064096)
chr8 (207-252)||(22652757-22652802)
chr8 (207-252)||(31153559-31153604)
chr8 (207-259)||(5904350-5904402)
chr8 (210-254)||(19957300-19957344)
chr8 (207-259)||(34037924-34037976)
[»] chr6 (17 HSPs)
chr6 (207-254)||(6228236-6228283)
chr6 (207-254)||(17217030-17217077)
chr6 (207-254)||(18903343-18903390)
chr6 (207-254)||(20415538-20415585)
chr6 (207-252)||(3200059-3200104)
chr6 (210-259)||(7954901-7954950)
chr6 (207-259)||(29321952-29322004)
chr6 (207-254)||(3974513-3974560)
chr6 (207-254)||(4854282-4854329)
chr6 (207-254)||(5641666-5641713)
chr6 (207-254)||(9763507-9763553)
chr6 (207-254)||(11552943-11552990)
chr6 (207-254)||(11611441-11611488)
chr6 (207-254)||(15716984-15717030)
chr6 (208-254)||(7164766-7164812)
chr6 (207-248)||(1128392-1128433)
chr6 (207-252)||(30422084-30422129)
[»] chr4 (26 HSPs)
chr4 (207-254)||(11491195-11491242)
chr4 (207-254)||(16556523-16556570)
chr4 (207-254)||(45355694-45355741)
chr4 (207-254)||(45369435-45369482)
chr4 (207-254)||(37574344-37574391)
chr4 (207-254)||(40406936-40406983)
chr4 (207-254)||(48404113-48404160)
chr4 (207-252)||(36993115-36993160)
chr4 (210-254)||(2931136-2931180)
chr4 (207-251)||(50815782-50815826)
chr4 (207-259)||(51974814-51974866)
chr4 (207-254)||(26885376-26885423)
chr4 (207-254)||(46283194-46283241)
chr4 (208-254)||(2832048-2832094)
chr4 (208-254)||(37889583-37889629)
chr4 (208-252)||(25234835-25234879)
chr4 (207-254)||(42154638-42154685)
chr4 (207-254)||(45847902-45847949)
chr4 (207-254)||(49811384-49811431)
chr4 (213-246)||(19688852-19688885)
chr4 (207-252)||(25104401-25104446)
chr4 (221-254)||(43084519-43084552)
chr4 (207-252)||(44251303-44251348)
chr4 (210-254)||(38690738-38690782)
chr4 (207-243)||(39719781-39719817)
chr4 (210-254)||(49607948-49607992)
[»] chr3 (28 HSPs)
chr3 (207-254)||(22602179-22602226)
chr3 (207-254)||(33528181-33528228)
chr3 (207-254)||(47864708-47864755)
chr3 (207-259)||(31435477-31435529)
chr3 (207-254)||(29645803-29645850)
chr3 (207-254)||(38668200-38668247)
chr3 (207-254)||(39739346-39739393)
chr3 (207-252)||(27817044-27817089)
chr3 (207-248)||(55426188-55426229)
chr3 (210-254)||(45431699-45431743)
chr3 (207-254)||(1102672-1102719)
chr3 (207-254)||(11483685-11483732)
chr3 (207-254)||(27394579-27394626)
chr3 (207-254)||(27471576-27471623)
chr3 (207-254)||(44062018-44062065)
chr3 (207-254)||(50381786-50381833)
chr3 (207-253)||(46247336-46247381)
chr3 (207-252)||(54457227-54457272)
chr3 (207-254)||(985895-985942)
chr3 (207-254)||(8930953-8931000)
chr3 (207-254)||(9320935-9320982)
chr3 (207-254)||(38414955-38415002)
chr3 (207-254)||(46798654-46798701)
chr3 (207-254)||(50676843-50676890)
chr3 (207-252)||(1325307-1325352)
chr3 (207-251)||(1084011-1084055)
chr3 (207-243)||(25165527-25165563)
chr3 (207-259)||(50271796-50271848)
[»] chr2 (19 HSPs)
chr2 (21-100)||(16216736-16216815)
chr2 (207-254)||(33065233-33065280)
chr2 (207-254)||(34107566-34107613)
chr2 (207-254)||(41750018-41750065)
chr2 (210-259)||(18424131-18424180)
chr2 (210-254)||(19843342-19843386)
chr2 (207-254)||(29090487-29090534)
chr2 (208-254)||(5901808-5901854)
chr2 (207-252)||(38413030-38413074)
chr2 (207-252)||(43027229-43027274)
chr2 (207-254)||(3330177-3330224)
chr2 (207-254)||(17543066-17543113)
chr2 (207-254)||(42541227-42541274)
chr2 (207-254)||(42678300-42678347)
chr2 (207-244)||(42998717-42998754)
chr2 (207-243)||(4632045-4632081)
chr2 (218-254)||(6270503-6270539)
chr2 (207-259)||(20435848-20435899)
chr2 (210-254)||(25783193-25783237)
[»] chr1 (33 HSPs)
chr1 (207-254)||(10123029-10123076)
chr1 (207-254)||(27054768-27054815)
chr1 (207-252)||(43109214-43109259)
chr1 (207-254)||(16985911-16985958)
chr1 (207-254)||(24134600-24134647)
chr1 (207-254)||(25031473-25031520)
chr1 (207-254)||(40061515-40061562)
chr1 (207-254)||(49620044-49620091)
chr1 (207-252)||(48497189-48497234)
chr1 (210-254)||(50065082-50065126)
chr1 (210-254)||(50302830-50302874)
chr1 (207-254)||(3347679-3347726)
chr1 (207-254)||(14262697-14262744)
chr1 (207-254)||(15417793-15417840)
chr1 (207-254)||(15550941-15550988)
chr1 (207-254)||(19424118-19424165)
chr1 (207-254)||(29332356-29332403)
chr1 (207-254)||(49239823-49239870)
chr1 (207-252)||(4126973-4127018)
chr1 (207-259)||(47651939-47651990)
chr1 (207-259)||(50011574-50011626)
chr1 (207-254)||(7438693-7438740)
chr1 (207-254)||(12973254-12973301)
chr1 (207-254)||(30735900-30735947)
chr1 (207-254)||(34702289-34702336)
chr1 (207-254)||(35195587-35195634)
chr1 (208-254)||(8893932-8893978)
chr1 (208-254)||(29936658-29936704)
chr1 (208-254)||(52720756-52720802)
chr1 (207-252)||(4684153-4684198)
chr1 (207-244)||(22386224-22386261)
chr1 (207-252)||(47683725-47683770)
chr1 (208-252)||(30325020-30325064)
[»] scaffold0108 (1 HSPs)
scaffold0108 (215-254)||(18330-18369)
[»] scaffold0339 (1 HSPs)
scaffold0339 (217-254)||(12648-12685)


Alignment Details
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 24)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 42555059 - 42554978
Alignment:
20 cccttaaaacccttaaatctttctcatcattttaatcgtataaaaaatgtcacttacgtcatgaggttctttaagtttaacg 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
42555059 cccttaaaacccttaaatctttctcatcattttaatcgtataaaaaatatcacttacgtcatgaggttctttaagtttaacg 42554978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 4956068 - 4956115
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
4956068 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 4956115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 48433686 - 48433733
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
48433686 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 48433733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 208 - 254
Target Start/End: Original strand, 23824569 - 23824615
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||| |||||||||||| ||||||||||||||||||||||||||    
23824569 tcaagtaacctagtggctagagaaattcaccttaaagatgaataagt 23824615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 209 - 254
Target Start/End: Complemental strand, 48619913 - 48619868
Alignment:
209 caagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||| |||||||||| ||||||||||||||||||||||||||    
48619913 caagtagcttagtggctagagaaattcaccttaaagatgaataagt 48619868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 217 - 257
Target Start/End: Complemental strand, 42554743 - 42554703
Alignment:
217 ctagtggctagggaaattcaccttaaagatgaataagtcgg 257  Q
    |||||||||||||||||||||| ||||||||||||||||||    
42554743 ctagtggctagggaaattcaccataaagatgaataagtcgg 42554703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 5228189 - 5228142
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||| |||||| |||||||||||||||| |||||||||    
5228189 gtcaagtagcctagcggctagagaaattcaccttaaaggtgaataagt 5228142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 31793587 - 31793540
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||| |||||||||||| ||||| ||||||||||||||||||||    
31793587 gtcaagtaacctagtggctagagaaatccaccttaaagatgaataagt 31793540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 217 - 254
Target Start/End: Complemental strand, 43440798 - 43440761
Alignment:
217 ctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||| ||||||||||||||||||||||||||    
43440798 ctagtggctagagaaattcaccttaaagatgaataagt 43440761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 3961384 - 3961436
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    ||||||||||||||| ||||| |||||||||||| || |||||||||| ||||    
3961384 gtcaagtagcctagtagctagagaaattcacctttaaaatgaataagtgggat 3961436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 27454131 - 27454083
Alignment:
207 gtcaagtagcctagtggctagggaaattcacc-ttaaagatgaataagt 254  Q
    ||||||||||||||||||||| |||||||||| || |||||||||||||    
27454131 gtcaagtagcctagtggctagagaaattcaccttttaagatgaataagt 27454083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 10091433 - 10091480
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||| |||| |||||||||| |||||||||||||||| |||||||||    
10091433 gtcaaatagcgtagtggctagagaaattcaccttaaaggtgaataagt 10091480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 12166201 - 12166154
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||  |||| ||||| ||||||||||||||||||||||||||    
12166201 gtcaagtagtttagtagctagagaaattcaccttaaagatgaataagt 12166154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 23602393 - 23602346
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||||||  |||||||||||||||| |||||||||    
23602393 gtcaagtagtctagtggctaaagaaattcaccttaaaggtgaataagt 23602346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 26606085 - 26606132
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||| || |||||| |||||||||||||||| |||||||||    
26606085 gtcaagtagccaagcggctagagaaattcaccttaaaggtgaataagt 26606132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 28914853 - 28914900
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| |||||||||||| ||  |||||||||    
28914853 gtcaagtagcctagtggctagagaaattcacctttaaagtgaataagt 28914900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 33413951 - 33413904
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||| ||||||| ||||||| |||||||||||| |||||||||||||    
33413951 gtcaaatagcctaatggctagagaaattcacctttaagatgaataagt 33413904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 38378338 - 38378291
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||| |||||| ||| ||||||||||||||| ||||||||||    
38378338 gtcaagtagcttagtgggtagagaaattcaccttaaaaatgaataagt 38378291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 254
Target Start/End: Complemental strand, 15025274 - 15025228
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||| || ||| |||||||||||||||| |||||||||    
15025274 tcaagtagcctagcgggtagagaaattcaccttaaaggtgaataagt 15025228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 24030103 - 24030059
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||| |||| |||||| ||||||||||||||||||||||||    
24030103 gtcaagtagtctag-ggctagagaaattcaccttaaagatgaataa 24030059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 28712486 - 28712441
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    |||||||||| ||||| |||| ||||||||| ||||||||||||||    
28712486 gtcaagtagcttagtgactagagaaattcactttaaagatgaataa 28712441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 208 - 252
Target Start/End: Original strand, 26455982 - 26456026
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    |||||||| ||||||||||| |||||||||||| ||| |||||||    
26455982 tcaagtagtctagtggctagagaaattcacctttaaggtgaataa 26456026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 222 - 254
Target Start/End: Complemental strand, 40273925 - 40273893
Alignment:
222 ggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||| ||||||||||||||||||||||||||    
40273925 ggctagagaaattcaccttaaagatgaataagt 40273893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 259
Target Start/End: Complemental strand, 46266787 - 46266735
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    ||||||||| ||||||| |||  ||||||||||| ||||||||||||| ||||    
46266787 gtcaagtagtctagtggttagataaattcacctttaagatgaataagtgggat 46266735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 48; Significance: 2e-18; HSPs: 20)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 21 - 100
Target Start/End: Complemental strand, 17053993 - 17053914
Alignment:
21 ccttaaaacccttaaatctttctcatcattttaatcgtataaaaaatgtcacttacgtcatgaggttctttaagtttaac 100  Q
    |||||||||||||||||||||   |||||||| ||||||||||||| |||||| |||||||| | |||||||||||||||    
17053993 ccttaaaacccttaaatcttttggatcattttgatcgtataaaaaaggtcactaacgtcatgggattctttaagtttaac 17053914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 207 - 253
Target Start/End: Original strand, 33545363 - 33545409
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataag 253  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||    
33545363 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataag 33545409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 31250266 - 31250219
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||| |||||||||||||| ||||||||||||||||||||||||||    
31250266 gtcaagcagcctagtggctagagaaattcaccttaaagatgaataagt 31250219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 42209035 - 42208988
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||||| |||| ||||||||||||||||||||||||||    
42209035 gtcaagtagcctagtgactagagaaattcaccttaaagatgaataagt 42208988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 5263288 - 5263243
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||||||||||||||| |||||||| |||||||||||||||    
5263288 gtcaagtagcctagtggctagagaaattcagcttaaagatgaataa 5263243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 5039799 - 5039752
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||||||| |||||| |||||||||||||||||||    
5039799 gtcaagtagtctagtggctagagaaatttaccttaaagatgaataagt 5039752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 17077480 - 17077433
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||||||||||  ||||||||||| |||||||||||||    
17077480 gtcaagtagcctagtggctagataaattcacctttaagatgaataagt 17077433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 38503233 - 38503280
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||| ||||||| ||||||||||||||||||||||||||    
38503233 gtcaagtagtctattggctagagaaattcaccttaaagatgaataagt 38503280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 208 - 254
Target Start/End: Complemental strand, 1572228 - 1572182
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||| ||||||||||| |||||||||||| |||||||||||||    
1572228 tcaagtagtctagtggctagagaaattcacctttaagatgaataagt 1572182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 4395827 - 4395872
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||| ||||||| ||||||| ||||||||||||||||||||||||    
4395827 gtcaaatagcctattggctagagaaattcaccttaaagatgaataa 4395872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 15470597 - 15470642
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    |||||||||  |||||||||| ||||||||||||||||||||||||    
15470597 gtcaagtagtttagtggctagagaaattcaccttaaagatgaataa 15470642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 218 - 254
Target Start/End: Complemental strand, 43227974 - 43227938
Alignment:
218 tagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||| ||||||||||||||||||||||||||    
43227974 tagtggctagagaaattcaccttaaagatgaataagt 43227938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 11935244 - 11935197
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||||| |||| |||||| |||||||||| ||||||||    
11935244 gtcaagtagcctagtgactagagaaatttaccttaaagacgaataagt 11935197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 209 - 252
Target Start/End: Original strand, 12256474 - 12256517
Alignment:
209 caagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    |||||||||||| |||||| |||||||||||||||| |||||||    
12256474 caagtagcctagcggctagagaaattcaccttaaaggtgaataa 12256517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 12375383 - 12375429
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||| ||||||||||||||| ||||||||||||||| ||||||||||    
12375383 gtcaaatagcctagtggctagagaaattcaccttaaa-atgaataagt 12375429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 15680877 - 15680924
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||| || ||| |||||||||||||||| |||||||||    
15680877 gtcaagtagcctagcggttagagaaattcaccttaaaggtgaataagt 15680924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 15696330 - 15696284
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||| ||||||||||||||| ||||||||||||||| ||||||||||    
15696330 gtcaaatagcctagtggctagagaaattcaccttaaa-atgaataagt 15696284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 42902041 - 42902088
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||  |||||||||| |||||| |||||||||||||||||||    
42902041 gtcaagtagtttagtggctagagaaatttaccttaaagatgaataagt 42902088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 930914 - 930966
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    |||||||||  ||||| |||| |||||||||||| ||||||||||||| ||||    
930914 gtcaagtagtttagtgactagagaaattcacctttaagatgaataagtgggat 930966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 243
Target Start/End: Original strand, 36037569 - 36037605
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaa 243  Q
    ||||| ||||||||||||||| |||||||||||||||    
36037569 gtcaaatagcctagtggctagagaaattcaccttaaa 36037605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0001 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0001
Description:

Target: scaffold0001; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 419831 - 419784
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
419831 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 419784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 44; Significance: 4e-16; HSPs: 16)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 4259978 - 4259931
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
4259978 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 4259931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 43413862 - 43413909
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
43413862 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 43413909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 11052560 - 11052607
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||| |||||||||||| ||||||||||||||||||||||||||    
11052560 gtcaagtaacctagtggctagagaaattcaccttaaagatgaataagt 11052607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 38289211 - 38289258
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||| |||||||||| ||||||||||||||||||||||||||    
38289211 gtcaagtagcttagtggctagagaaattcaccttaaagatgaataagt 38289258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 39104725 - 39104678
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||||||| ||||| ||||||||||||||||||||    
39104725 gtcaagtagtctagtggctagagaaatccaccttaaagatgaataagt 39104678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 19733045 - 19733090
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    |||||||||| |||||| ||| ||||||||||||||||||||||||    
19733045 gtcaagtagcttagtggttagagaaattcaccttaaagatgaataa 19733090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 219 - 254
Target Start/End: Complemental strand, 1032677 - 1032642
Alignment:
219 agtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||||||||||||||||||||||    
1032677 agtggctagagaaattcaccttaaagatgaataagt 1032642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 10162088 - 10162042
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||| |||||||||||| ||||||||||||||| ||||||||||    
10162088 gtcaagtaacctagtggctagagaaattcaccttaaa-atgaataagt 10162042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 13906597 - 13906643
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||| ||||||||||||||| ||||||||||||||| ||||||||||    
13906597 gtcaaatagcctagtggctagagaaattcaccttaaa-atgaataagt 13906643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 36587626 - 36587673
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||| | |||||||| ||||||||| |||||||    
36587626 gtcaagtagcctagtggctcgagaaattcatcttaaagataaataagt 36587673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 38064096 - 38064049
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| | ||||| ||| ||||||||||||||||||||||||||    
38064096 gtcaagtagtccagtggttagagaaattcaccttaaagatgaataagt 38064049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 22652802 - 22652757
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    |||||||||| |||||||||| |||||||||||| || ||||||||    
22652802 gtcaagtagcttagtggctagagaaattcacctttaacatgaataa 22652757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 31153604 - 31153559
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||| ||||| ||||| ||||| ||||||||||||||||||    
31153604 gtcaagtagtctagtagctagagaaatccaccttaaagatgaataa 31153559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 5904350 - 5904402
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    ||||| |||| |||| ||||| |||||||| ||||||||||||||||| ||||    
5904350 gtcaaatagcttagtagctagagaaattcatcttaaagatgaataagtgggat 5904402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 210 - 254
Target Start/End: Original strand, 19957300 - 19957344
Alignment:
210 aagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||  ||||| |||||||||||||||| |||||||||    
19957300 aagtagcctagctgctagagaaattcaccttaaaggtgaataagt 19957344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 34037924 - 34037976
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    ||||||||| ||||||| |||  |||||||| |||||||||||||||| ||||    
34037924 gtcaagtagtctagtggttagaaaaattcactttaaagatgaataagtgggat 34037976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 44; Significance: 4e-16; HSPs: 17)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 6228236 - 6228283
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
6228236 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 6228283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 17217077 - 17217030
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
17217077 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 17217030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 18903343 - 18903390
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
18903343 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 18903390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 20415538 - 20415585
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||| |||||||||||||| ||||||||||||||||||||||||||    
20415538 gtcaagcagcctagtggctagagaaattcaccttaaagatgaataagt 20415585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 3200059 - 3200104
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||||||| ||||||| ||||||||||||||||||||||||    
3200059 gtcaagtagcctattggctagagaaattcaccttaaagatgaataa 3200104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 210 - 259
Target Start/End: Original strand, 7954901 - 7954950
Alignment:
210 aagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    |||||||||||||||||| |||||||| ||||||||||||||||| ||||    
7954901 aagtagcctagtggctagagaaattcatcttaaagatgaataagtgggat 7954950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 29321952 - 29322004
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    ||||||||| ||||||||||| |||||||||||||||||| ||||||| ||||    
29321952 gtcaagtagtctagtggctagagaaattcaccttaaagataaataagtgggat 29322004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 3974560 - 3974513
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||| ||||||||| | ||| ||||||||||||||||||||||||||    
3974560 gtcaaatagcctagtagttagagaaattcaccttaaagatgaataagt 3974513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 4854282 - 4854329
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||| ||| |||||| |||||||||||||||||||    
4854282 gtcaagtaggctagtggttagagaaatttaccttaaagatgaataagt 4854329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 5641666 - 5641713
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| |||| |||||| |||||||||||||||| |||||||||    
5641666 gtcaagtagtctagcggctagagaaattcaccttaaaggtgaataagt 5641713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 9763553 - 9763507
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||| |||||||||| |||||||||||||||| |||||||||    
9763553 gtcaagtagcatagtggctagagaaattcaccttaaag-tgaataagt 9763507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 11552990 - 11552943
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| |||||||||||  ||||| |||||||||||||||||||    
11552990 gtcaagtagactagtggctagaaaaatttaccttaaagatgaataagt 11552943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 11611488 - 11611441
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||| | ||||| ||||||||| ||||||||||||||||    
11611488 gtcaagtagcctaattgctagagaaattcacattaaagatgaataagt 11611441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 15716984 - 15717030
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||| ||||||||||||||| ||||||||||||||| ||||||||||    
15716984 gtcaaatagcctagtggctagagaaattcaccttaaa-atgaataagt 15717030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 254
Target Start/End: Complemental strand, 7164812 - 7164766
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||| |||| |||||| |||||||||||||||| |||||||||    
7164812 tcaagtagtctagcggctagagaaattcaccttaaaggtgaataagt 7164766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 248
Target Start/End: Original strand, 1128392 - 1128433
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatga 248  Q
    ||||||||| |||||| |||| ||||||||||||||||||||    
1128392 gtcaagtagtctagtgactagagaaattcaccttaaagatga 1128433  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 30422084 - 30422129
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    |||||||||||||||||| || ||||||||||||||| || |||||    
30422084 gtcaagtagcctagtggccagagaaattcaccttaaaaataaataa 30422129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 26)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 11491195 - 11491242
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
11491195 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 11491242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 16556570 - 16556523
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
16556570 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 16556523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 45355694 - 45355741
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
45355694 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 45355741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 45369435 - 45369482
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
45369435 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 45369482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 37574391 - 37574344
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| |||||||||||||||| |||||||||    
37574391 gtcaagtagcctagtggctagagaaattcaccttaaaggtgaataagt 37574344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 40406936 - 40406983
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||| |||||||||||||| ||||||||||||||||||||||||||    
40406936 gtcaagcagcctagtggctagagaaattcaccttaaagatgaataagt 40406983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 48404113 - 48404160
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||  ||||||||||||||||||||||||||    
48404113 gtcaagtagcctagtggctaaagaaattcaccttaaagatgaataagt 48404160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 36993160 - 36993115
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    |||| |||||||||||||||| ||||||||||||||||||||||||    
36993160 gtcaggtagcctagtggctagagaaattcaccttaaagatgaataa 36993115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 210 - 254
Target Start/End: Complemental strand, 2931180 - 2931136
Alignment:
210 aagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||| ||||||||||| ||||||||||||||||||||||||||    
2931180 aagtagtctagtggctagagaaattcaccttaaagatgaataagt 2931136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 251
Target Start/End: Complemental strand, 50815826 - 50815782
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaata 251  Q
    ||||||||||||||||||||| |||||||||||| ||||||||||    
50815826 gtcaagtagcctagtggctagagaaattcacctttaagatgaata 50815782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 259
Target Start/End: Complemental strand, 51974866 - 51974814
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    |||||||||||||||||||||  ||||||||||||||||| ||||||| ||||    
51974866 gtcaagtagcctagtggctagataaattcaccttaaagataaataagtgggat 51974814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 26885376 - 26885423
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||| |||||||||||| |||||||    
26885376 gtcaagtagcctagtggctagagaaatccaccttaaagataaataagt 26885423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 46283241 - 46283194
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| |||||| |||| ||||||||||||||||||||||||||    
46283241 gtcaagtagtctagtgactagagaaattcaccttaaagatgaataagt 46283194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 208 - 254
Target Start/End: Original strand, 2832048 - 2832094
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||| |||||||||||| | ||||||||||||||||||||||||    
2832048 tcaagtaacctagtggctagaggaattcaccttaaagatgaataagt 2832094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 208 - 254
Target Start/End: Original strand, 37889583 - 37889629
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||||||||| |||||||||||||||  |||||||||    
37889583 tcaagtagcctagtggctagagaaattcaccttaaaagtgaataagt 37889629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 208 - 252
Target Start/End: Original strand, 25234835 - 25234879
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    |||||||| ||||||| ||| ||||||||||||||||||||||||    
25234835 tcaagtagtctagtggttagagaaattcaccttaaagatgaataa 25234879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 42154685 - 42154638
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||| || |||||| |||||||||||||||||||| |||||    
42154685 gtcaagtagcccagcggctagagaaattcaccttaaagatgattaagt 42154638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 45847902 - 45847949
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||| ||||||| |||||  ||||||||||||||||||||||||||    
45847902 gtcaagcagcctaggggctaaagaaattcaccttaaagatgaataagt 45847949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 49811384 - 49811431
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||| |||||| |||||||| ||||||| |||||||||    
49811384 gtcaagtagcctagcggctagagaaattcatcttaaaggtgaataagt 49811431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 213 - 246
Target Start/End: Original strand, 19688852 - 19688885
Alignment:
213 tagcctagtggctagggaaattcaccttaaagat 246  Q
    ||||||||||||||| ||||||||||||||||||    
19688852 tagcctagtggctagagaaattcaccttaaagat 19688885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 25104446 - 25104401
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||| ||||||||  | ||||||||||||||||||||||||    
25104446 gtcaagtagtctagtggccggagaaattcaccttaaagatgaataa 25104401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 221 - 254
Target Start/End: Complemental strand, 43084552 - 43084519
Alignment:
221 tggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||| ||||||||||||||||||||||||||    
43084552 tggctagagaaattcaccttaaagatgaataagt 43084519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 44251303 - 44251348
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||| |||||||| ||||||  |||||||||||||||||||||||    
44251303 gtcaaatagcctagcggctagaaaaattcaccttaaagatgaataa 44251348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 210 - 254
Target Start/End: Complemental strand, 38690782 - 38690738
Alignment:
210 aagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||| |||||| ||||||||||||||||  ||||||||    
38690782 aagtagcctagcggctagagaaattcaccttaaaggagaataagt 38690738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 243
Target Start/End: Original strand, 39719781 - 39719817
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaa 243  Q
    ||||| ||||||||||||||| |||||||||||||||    
39719781 gtcaaatagcctagtggctagagaaattcaccttaaa 39719817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 210 - 254
Target Start/End: Complemental strand, 49607992 - 49607948
Alignment:
210 aagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||| ||||||||||| |||||||||||||||| | |||||||    
49607992 aagtagtctagtggctagagaaattcaccttaaaggtaaataagt 49607948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 44; Significance: 4e-16; HSPs: 28)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 22602179 - 22602226
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
22602179 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 22602226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 33528181 - 33528228
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
33528181 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 33528228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 47864755 - 47864708
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
47864755 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 47864708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 207 - 259
Target Start/End: Original strand, 31435477 - 31435529
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    ||||||||| ||||||||||| |||||||||||||||||||||||||| ||||    
31435477 gtcaagtagtctagtggctagagaaattcaccttaaagatgaataagtgggat 31435529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 29645803 - 29645850
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||||||| ||||||||||||||||||||||||||    
29645803 gtcaagtagtctagtggctagagaaattcaccttaaagatgaataagt 29645850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 38668247 - 38668200
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||||||| ||||||||||||||||||||||||||    
38668247 gtcaagtagtctagtggctagagaaattcaccttaaagatgaataagt 38668200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 39739393 - 39739346
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||||||| ||||||||||||||||||||||||||    
39739393 gtcaagtagtctagtggctagagaaattcaccttaaagatgaataagt 39739346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 27817044 - 27817089
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||||||||||||||| |||||||| |||||||||||||||    
27817044 gtcaagtagcctagtggctagagaaattcaacttaaagatgaataa 27817089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 207 - 248
Target Start/End: Complemental strand, 55426229 - 55426188
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatga 248  Q
    ||||||||||||||||||||| ||||||||||||||||||||    
55426229 gtcaagtagcctagtggctagagaaattcaccttaaagatga 55426188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 210 - 254
Target Start/End: Complemental strand, 45431743 - 45431699
Alignment:
210 aagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||| ||||||||||||||||||||||| |||||||||    
45431743 aagtagcctagcggctagggaaattcaccttaaaggtgaataagt 45431699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 1102672 - 1102719
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||| |||||| |||||||||||||||| |||||||||    
1102672 gtcaagtagcctagcggctagagaaattcaccttaaaggtgaataagt 1102719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 11483732 - 11483685
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||| ||||| ||||||||||||||||||||||||||    
11483732 gtcaagtagtctagttgctagagaaattcaccttaaagatgaataagt 11483685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 27394626 - 27394579
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||| |||||| |||||||||||||||| |||||||||    
27394626 gtcaagtagcctagcggctagagaaattcaccttaaaggtgaataagt 27394579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 27471623 - 27471576
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||||||| |||||| |||||||||||||||||||    
27471623 gtcaagtagtctagtggctagagaaatttaccttaaagatgaataagt 27471576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 44062018 - 44062065
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||||||| || |||||||||||||||||||||||    
44062018 gtcaagtagtctagtggctagagacattcaccttaaagatgaataagt 44062065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 50381833 - 50381786
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||| |||||| ||||||| ||||||||||||||||||||||||||    
50381833 gtcaagcagcctaatggctagagaaattcaccttaaagatgaataagt 50381786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 207 - 253
Target Start/End: Complemental strand, 46247381 - 46247336
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataag 253  Q
    |||||||||||||||||| || |||||||||||||||||||||||||    
46247381 gtcaagtagcctagtggc-agagaaattcaccttaaagatgaataag 46247336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 54457272 - 54457227
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    |||||||||||||| |||||| |||||||||||||||| |||||||    
54457272 gtcaagtagcctagcggctagagaaattcaccttaaaggtgaataa 54457227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 985895 - 985942
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||  ||||||||||| |||||||||||| |||||||||||||    
985895 gtcaagtaatctagtggctagagaaattcacctttaagatgaataagt 985942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 8930953 - 8931000
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||| |||||| ||||||||| |||||| |||||||||    
8930953 gtcaagtagcctagcggctagagaaattcactttaaaggtgaataagt 8931000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 9320935 - 9320982
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||| ||| |||||||| ||| |||||||||||||    
9320935 gtcaagtagcctagtggttagagaaattcatctttaagatgaataagt 9320982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 38415002 - 38414955
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||| ||| || |||||||||||||||| |||||||||    
38415002 gtcaagtagcctagcggccagagaaattcaccttaaaggtgaataagt 38414955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 46798701 - 46798654
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||| ||| |||||  |||||||||||||||||||    
46798701 gtcaagtagcctagtggttagagaaatctaccttaaagatgaataagt 46798654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 50676843 - 50676890
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||| ||| |||||||||||||||| |||||||||    
50676843 gtcaagtagtctagtggttagagaaattcaccttaaaggtgaataagt 50676890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 1325307 - 1325352
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||| ||||||||||  |||||||| |||||||||||||||    
1325307 gtcaagtagtctagtggctaaagaaattcatcttaaagatgaataa 1325352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 251
Target Start/End: Original strand, 1084011 - 1084055
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaata 251  Q
    |||||||||||||||||||   ||||||||| |||||||||||||    
1084011 gtcaagtagcctagtggctgacgaaattcactttaaagatgaata 1084055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 243
Target Start/End: Complemental strand, 25165563 - 25165527
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaa 243  Q
    |||||| |||||||||||||| |||||||||||||||    
25165563 gtcaagcagcctagtggctagagaaattcaccttaaa 25165527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 259
Target Start/End: Complemental strand, 50271848 - 50271796
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    ||||||||| |||| || ||| |||||||||||||||| ||||||||| ||||    
50271848 gtcaagtagtctagcggttagagaaattcaccttaaaggtgaataagtgggat 50271796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 19)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 21 - 100
Target Start/End: Complemental strand, 16216815 - 16216736
Alignment:
21 ccttaaaacccttaaatctttctcatcattttaatcgtataaaaaatgtcacttacgtcatgaggttctttaagtttaac 100  Q
    |||||||||||||||||||||   |||||||| || |||||||||| ||||||||||||||| | || ||||||||||||    
16216815 ccttaaaacccttaaatcttttggatcattttgatagtataaaaaacgtcacttacgtcatgggattatttaagtttaac 16216736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 33065233 - 33065280
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
33065233 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 33065280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 34107613 - 34107566
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
34107613 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 34107566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 41750065 - 41750018
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
41750065 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 41750018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 210 - 259
Target Start/End: Original strand, 18424131 - 18424180
Alignment:
210 aagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    |||||||||||||||||| |||||||||||||||||||||||||| ||||    
18424131 aagtagcctagtggctagagaaattcaccttaaagatgaataagtgggat 18424180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 210 - 254
Target Start/End: Original strand, 19843342 - 19843386
Alignment:
210 aagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||| ||||| ||||||||||||||||||||||||||    
19843342 aagtagcctagtagctagagaaattcaccttaaagatgaataagt 19843386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 29090534 - 29090487
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||| |||| | ||||||||||||||||||||||||||    
29090534 gtcaagtagcctagcggctggagaaattcaccttaaagatgaataagt 29090487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 208 - 254
Target Start/End: Original strand, 5901808 - 5901854
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||||||||  |||||||||||| |||||||||||||    
5901808 tcaagtagcctagtggctaaagaaattcacctttaagatgaataagt 5901854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 38413074 - 38413030
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||||||||||| ||| ||||||||||||||||||||||||    
38413074 gtcaagtagcctagtgg-tagagaaattcaccttaaagatgaataa 38413030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 43027274 - 43027229
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||| ||||||||||| |||||||||||||||| |||||||    
43027274 gtcaagtagtctagtggctagagaaattcaccttaaaggtgaataa 43027229  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 3330177 - 3330224
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||| |||| |||||| ||| ||||||||||||||||||||||||||    
3330177 gtcaaatagcttagtggttagagaaattcaccttaaagatgaataagt 3330224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 17543066 - 17543113
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||| ||| |||| |||| ||||||||||||||||    
17543066 gtcaagtagcctagtggttagagaaagtcacattaaagatgaataagt 17543113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 42541274 - 42541227
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||| |||||| |||||||||||||||| ||| |||||    
42541274 gtcaagtagcctagcggctagagaaattcaccttaaaggtgagtaagt 42541227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 42678300 - 42678347
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||  ||||||| ||| ||||||||||||||||||||||||||    
42678300 gtcaagtaatctagtggttagagaaattcaccttaaagatgaataagt 42678347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 244
Target Start/End: Complemental strand, 42998754 - 42998717
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaag 244  Q
    |||||||||||||| |||||| ||||||||||||||||    
42998754 gtcaagtagcctagcggctagagaaattcaccttaaag 42998717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 243
Target Start/End: Original strand, 4632045 - 4632081
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaa 243  Q
    ||||| ||||||||||||||| |||||||||||||||    
4632045 gtcaaatagcctagtggctagagaaattcaccttaaa 4632081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 218 - 254
Target Start/End: Complemental strand, 6270539 - 6270503
Alignment:
218 tagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||| |||||||||||||||||| |||||||    
6270539 tagtggctagagaaattcaccttaaagataaataagt 6270503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 207 - 259
Target Start/End: Complemental strand, 20435899 - 20435848
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    |||||||||||||| |  ||| |||||||||||||||||||||||||| ||||    
20435899 gtcaagtagcctagcga-tagagaaattcaccttaaagatgaataagtgggat 20435848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 210 - 254
Target Start/End: Original strand, 25783193 - 25783237
Alignment:
210 aagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||| ||||||| ||| |||||||| |||||||||||||    
25783193 aagtagcctaatggctagagaacttcaccttgaagatgaataagt 25783237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 33)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 10123029 - 10123076
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
10123029 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 10123076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 27054815 - 27054768
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||    
27054815 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataagt 27054768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 43109214 - 43109259
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||    
43109214 gtcaagtagcctagtggctagagaaattcaccttaaagatgaataa 43109259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 16985911 - 16985958
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||| |||||||||||| ||||||||||||||||||||||||||    
16985911 gtcaagtaacctagtggctagagaaattcaccttaaagatgaataagt 16985958  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 24134600 - 24134647
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||| |||||||||||||| ||||||||||||||||||||||||||    
24134600 gtcaagcagcctagtggctagagaaattcaccttaaagatgaataagt 24134647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 25031473 - 25031520
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||| |||||||||||||| ||||||||||||||||||||||||||    
25031473 gtcaagcagcctagtggctagagaaattcaccttaaagatgaataagt 25031520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 40061562 - 40061515
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||| ||||||||||||||||||||    
40061562 gtcaagtagcctagtggctagagaaatccaccttaaagatgaataagt 40061515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 49620091 - 49620044
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||||||| ||||||||| ||||||||||||||||    
49620091 gtcaagtagcctagtggctagagaaattcactttaaagatgaataagt 49620044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 48497189 - 48497234
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||||||||||||||| |||||| |||||||||||||||||    
48497189 gtcaagtagcctagtggctagagaaatttaccttaaagatgaataa 48497234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 210 - 254
Target Start/End: Complemental strand, 50065126 - 50065082
Alignment:
210 aagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||| |||||||||| ||||||||||||||||||||||||||    
50065126 aagtagcttagtggctagagaaattcaccttaaagatgaataagt 50065082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 210 - 254
Target Start/End: Original strand, 50302830 - 50302874
Alignment:
210 aagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||| ||||||||||| ||||||||||||||||||||||||||    
50302830 aagtagtctagtggctagagaaattcaccttaaagatgaataagt 50302874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 3347679 - 3347726
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||| ||||||||| |||| ||||||||||||||||||||||||||    
3347679 gtcaagcagcctagtgactagagaaattcaccttaaagatgaataagt 3347726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 14262697 - 14262744
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||| |||| |||||||||| ||||||||||||||||||||||||||    
14262697 gtcaaatagcttagtggctagagaaattcaccttaaagatgaataagt 14262744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 15417793 - 15417840
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||||| |||| |||||||| |||||||||||||||||    
15417793 gtcaagtagcctagtgactagagaaattcatcttaaagatgaataagt 15417840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 15550988 - 15550941
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||| |||||||||||  ||||||||||||||||||||||||||    
15550988 gtcaagtaacctagtggctacagaaattcaccttaaagatgaataagt 15550941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 19424165 - 19424118
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||| |||||| |||||||||||||||| |||||||||    
19424165 gtcaagtagcctagcggctagagaaattcaccttaaaggtgaataagt 19424118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 29332403 - 29332356
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||| |||||| |||||||||||||||| |||||||||    
29332403 gtcaagtagcctagcggctagagaaattcaccttaaaggtgaataagt 29332356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 49239823 - 49239870
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||| |||||||||| |||||| |||||||||||||||||||    
49239823 gtcaagtagcttagtggctagagaaatttaccttaaagatgaataagt 49239870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 4127018 - 4126973
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||| |||||||||||  |||||||||||||||||||||||    
4127018 gtcaagtagtctagtggctagataaattcaccttaaagatgaataa 4126973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 259
Target Start/End: Complemental strand, 47651990 - 47651939
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    ||||||||||| ||||||||| ||||||||||||||| |||||||||| ||||    
47651990 gtcaagtagcccagtggctagagaaattcaccttaaa-atgaataagtgggat 47651939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 207 - 259
Target Start/End: Complemental strand, 50011626 - 50011574
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagtcggat 259  Q
    ||||||||| | ||| ||||| |||||||||||||||||||||||||| ||||    
50011626 gtcaagtagtccagtagctagagaaattcaccttaaagatgaataagtgggat 50011574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 7438740 - 7438693
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||||||  |||||||||||| |||||||||||||    
7438740 gtcaagtagtctagtggctaaagaaattcacctttaagatgaataagt 7438693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 12973254 - 12973301
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||||||  |||||| |||||||||||||||||||    
12973254 gtcaagtagtctagtggctaaagaaatttaccttaaagatgaataagt 12973301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Complemental strand, 30735947 - 30735900
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||||||||||| ||| ||||||||||||  ||||||||||||    
30735947 gtcaagtagcctagtggttagagaaattcacctttgagatgaataagt 30735900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 34702289 - 34702336
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||||| ||||||||||  |||||||| |||||||||||||||||    
34702289 gtcaagtagtctagtggctaaagaaattcatcttaaagatgaataagt 34702336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 207 - 254
Target Start/End: Original strand, 35195587 - 35195634
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||| |||||| |||||| ||||||||| |||||||||    
35195587 gtcaagtagcctagcggctagagaaatttaccttaaaggtgaataagt 35195634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 254
Target Start/End: Complemental strand, 8893978 - 8893932
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    ||||||| |||||||| | | ||||||||||||||||||||||||||    
8893978 tcaagtaacctagtggttggagaaattcaccttaaagatgaataagt 8893932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 254
Target Start/End: Original strand, 29936658 - 29936704
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||| ||||||| ||||||||| || |||||||||||||    
29936658 tcaagtagcctaatggctagagaaattcacttttaagatgaataagt 29936704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 208 - 254
Target Start/End: Complemental strand, 52720802 - 52720756
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||| ||||||| ||| ||||||||| ||||||||||||||||    
52720802 tcaagtagtctagtggttagagaaattcactttaaagatgaataagt 52720756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 252
Target Start/End: Original strand, 4684153 - 4684198
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    |||||||||  |||||||||| | ||||||||||||||||||||||    
4684153 gtcaagtagtttagtggctagagtaattcaccttaaagatgaataa 4684198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 244
Target Start/End: Original strand, 22386224 - 22386261
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaag 244  Q
    ||||||||| ||||||||||| ||||||||||||||||    
22386224 gtcaagtagtctagtggctagagaaattcaccttaaag 22386261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 207 - 252
Target Start/End: Complemental strand, 47683770 - 47683725
Alignment:
207 gtcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||||||||||| ||| |||||||| |||||| ||||||||    
47683770 gtcaagtagcctagtggttagagaaattcatcttaaacatgaataa 47683725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 208 - 252
Target Start/End: Original strand, 30325020 - 30325064
Alignment:
208 tcaagtagcctagtggctagggaaattcaccttaaagatgaataa 252  Q
    ||||||||  |||||||||| |||||||| |||||||||||||||    
30325020 tcaagtagtttagtggctagagaaattcatcttaaagatgaataa 30325064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0108 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0108
Description:

Target: scaffold0108; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 254
Target Start/End: Original strand, 18330 - 18369
Alignment:
215 gcctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||||  |||||||||||||||||||||||||    
18330 gcctagtggctagaaaaattcaccttaaagatgaataagt 18369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0339 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0339
Description:

Target: scaffold0339; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 217 - 254
Target Start/End: Original strand, 12648 - 12685
Alignment:
217 ctagtggctagggaaattcaccttaaagatgaataagt 254  Q
    |||||||||||  |||||||||||||||||||||||||    
12648 ctagtggctagaaaaattcaccttaaagatgaataagt 12685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 203929 times since January 2019
Visitors: 1517