View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk58-3 (Length: 377)

Name: R108-tnk58-3
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk58-3
R108-tnk58-3
[»] chr1 (18 HSPs)
chr1 (301-354)||(2403048-2403101)
chr1 (301-354)||(1673375-1673428)
chr1 (301-354)||(29637333-29637386)
chr1 (301-354)||(1994959-1995012)
chr1 (301-354)||(27325751-27325804)
chr1 (301-354)||(44797589-44797642)
chr1 (301-356)||(46845777-46845832)
chr1 (301-356)||(527020-527075)
chr1 (301-356)||(6487734-6487789)
chr1 (301-354)||(32267588-32267641)
chr1 (301-356)||(7178232-7178287)
chr1 (301-356)||(26040976-26041031)
chr1 (301-356)||(39858353-39858408)
chr1 (301-347)||(40030844-40030890)
chr1 (301-356)||(15225112-15225167)
chr1 (301-356)||(33502645-33502700)
chr1 (301-356)||(49430585-49430640)
chr1 (301-354)||(13276587-13276640)
[»] chr4 (19 HSPs)
chr4 (301-356)||(5817501-5817556)
chr4 (301-354)||(45996017-45996070)
chr4 (301-354)||(17044009-17044062)
chr4 (301-354)||(25164594-25164647)
chr4 (301-354)||(37605814-37605867)
chr4 (301-354)||(55281214-55281267)
chr4 (301-356)||(32290220-32290275)
chr4 (301-356)||(51579326-51579381)
chr4 (301-354)||(3287090-3287143)
chr4 (301-354)||(43749098-43749151)
chr4 (301-356)||(24059254-24059309)
chr4 (301-356)||(25784029-25784084)
chr4 (301-356)||(32525143-32525198)
chr4 (301-356)||(20107116-20107172)
chr4 (301-344)||(39631271-39631314)
chr4 (301-356)||(41277221-41277276)
chr4 (301-356)||(42179258-42179313)
chr4 (309-356)||(51579594-51579641)
chr4 (301-346)||(36851233-36851278)
[»] chr3 (13 HSPs)
chr3 (301-356)||(23004762-23004817)
chr3 (301-354)||(9271116-9271169)
chr3 (301-354)||(38247804-38247857)
chr3 (301-354)||(50989209-50989262)
chr3 (301-354)||(51092341-51092394)
chr3 (301-356)||(8330713-8330768)
chr3 (301-356)||(33288138-33288193)
chr3 (299-354)||(8496710-8496765)
chr3 (301-354)||(12224126-12224179)
chr3 (301-356)||(46135533-46135588)
chr3 (301-354)||(48034932-48034985)
chr3 (301-346)||(29915090-29915135)
chr3 (301-346)||(29964243-29964288)
[»] chr8 (15 HSPs)
chr8 (303-356)||(8368492-8368545)
chr8 (301-354)||(1993763-1993816)
chr8 (301-354)||(14342312-14342365)
chr8 (301-354)||(43066027-43066080)
chr8 (301-356)||(2599537-2599592)
chr8 (301-356)||(16465733-16465788)
chr8 (301-356)||(41075718-41075773)
chr8 (301-352)||(4077086-4077137)
chr8 (301-356)||(10391426-10391481)
chr8 (301-356)||(28898001-28898056)
chr8 (301-356)||(31774730-31774785)
chr8 (301-356)||(45413659-45413714)
chr8 (301-356)||(11904859-11904914)
chr8 (303-336)||(44077642-44077675)
chr8 (301-341)||(31523648-31523688)
[»] chr7 (10 HSPs)
chr7 (301-354)||(46576365-46576418)
chr7 (301-356)||(31741049-31741104)
chr7 (301-356)||(38349580-38349635)
chr7 (301-356)||(42974499-42974554)
chr7 (302-347)||(33496506-33496551)
chr7 (301-354)||(38755018-38755071)
chr7 (301-354)||(48460665-48460718)
chr7 (301-345)||(47480144-47480188)
chr7 (301-356)||(28713683-28713738)
chr7 (302-356)||(11752604-11752658)
[»] chr6 (8 HSPs)
chr6 (301-354)||(14314109-14314162)
chr6 (301-354)||(9045839-9045892)
chr6 (301-356)||(23915978-23916033)
chr6 (301-347)||(34792781-34792827)
chr6 (301-354)||(1244679-1244732)
chr6 (303-351)||(9521943-9521991)
chr6 (301-356)||(29429590-29429645)
chr6 (301-349)||(16717996-16718044)
[»] chr5 (6 HSPs)
chr5 (301-354)||(13988253-13988306)
chr5 (301-354)||(36890383-36890436)
chr5 (301-356)||(15285335-15285390)
chr5 (301-356)||(8378350-8378405)
chr5 (301-354)||(11247198-11247251)
chr5 (301-356)||(43100329-43100384)
[»] chr2 (14 HSPs)
chr2 (301-354)||(13697088-13697141)
chr2 (301-352)||(14945861-14945912)
chr2 (301-354)||(14242638-14242691)
chr2 (301-354)||(36272784-36272837)
chr2 (301-354)||(36709314-36709367)
chr2 (301-356)||(3121616-3121671)
chr2 (301-354)||(32599371-32599424)
chr2 (301-354)||(40095269-40095322)
chr2 (301-354)||(17823585-17823638)
chr2 (301-350)||(23860291-23860340)
chr2 (301-356)||(24475822-24475877)
chr2 (303-356)||(25333152-25333205)
chr2 (301-354)||(33555486-33555539)
chr2 (301-354)||(42061354-42061407)
[»] scaffold0933 (1 HSPs)
scaffold0933 (301-354)||(3176-3230)


Alignment Details
Target: chr1 (Bit Score: 54; Significance: 6e-22; HSPs: 18)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 2403101 - 2403048
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2403101 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 2403048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 1673375 - 1673428
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||    
1673375 tgatacatagaccatcttaggtggcatgtaccacttgtacacccacacacaatt 1673428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 29637386 - 29637333
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||    
29637386 tgatacatagaccatcttaggtggcatgtaccacttgtacacccacacacaatt 29637333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 1994959 - 1995012
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
1994959 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 1995012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 27325804 - 27325751
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
27325804 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 27325751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 44797642 - 44797589
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
44797642 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 44797589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 46845832 - 46845777
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||||||||||||||||||| |||||||| ||||||||||    
46845832 tgatacatagaccaccttagatggcatgtaccacttatacacccatacacaattgt 46845777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 527075 - 527020
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| ||||||||||||||| |||||||| ||||||||||    
527075 tgatacatagaccaccttaggtggcatgtaccacttatacacccatacacaattgt 527020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 6487734 - 6487789
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||||||||  |||| |||||||||||||||||||| ||||||||||||||    
6487734 tgatacatagaccaatttaggtggcatgtaccacttgtacatccacacacaattgt 6487789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 32267641 - 32267588
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||||||||  |||||||||| | ||||||||||||||||||||    
32267641 tgatacatagaccatcttaagtggcatgtacaatttgtacacccacacacaatt 32267588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 7178287 - 7178232
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| || ||||||||| ||||||||||||| ||||||||    
7178287 tgatacatagaccaccttaggtgacatgtaccatttgtacacccacatacaattgt 7178232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 26040976 - 26041031
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||| | |||| ||||| |||||||||||||||||||||||||| ||||||||    
26040976 tgatacacaaaccaccttaggtggcatgtaccacttgtacacccacatacaattgt 26041031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 39858353 - 39858408
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| |||||| |||||||| |||||||| ||||||||||    
39858353 tgatacatagaccaccttaggtggcatataccacttatacacccatacacaattgt 39858408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 301 - 347
Target Start/End: Original strand, 40030844 - 40030890
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccaca 347  Q
    |||||||||||||| ||||| | ||||||||||||||||||||||||    
40030844 tgatacatagaccaccttaggtagcatgtaccacttgtacacccaca 40030890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 15225167 - 15225112
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| |||||||||| |||| ||||||||||  |||||||    
15225167 tgatacatagaccaccttaggtggcatgtacaacttatacacccacatgcaattgt 15225112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 33502700 - 33502645
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||||||||  ||||||| ||||||||||||||||||| |||  |||||||    
33502700 tgatacatagaccacattagatgacatgtaccacttgtacacctacatgcaattgt 33502645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 49430640 - 49430585
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| ||||||||||||||| |||| | | ||||||||||    
49430640 tgatacatagaccaccttaggtggcatgtaccacttatacatcaatacacaattgt 49430585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 13276640 - 13276587
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| ||| ||||||||||| ||||| || ||||||||    
13276640 tgatacatagaccaccttaggtggtatgtaccacttatacactcatacacaatt 13276587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 52; Significance: 1e-20; HSPs: 19)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 5817556 - 5817501
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
5817556 tgatacatagaccatcttaggtggcatgtaccacttgtacacccacacacaattgt 5817501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 45996070 - 45996017
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||    
45996070 tgatacatagaccatcttaggtggcatgtaccacttgtacacccacacacaatt 45996017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 17044009 - 17044062
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
17044009 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 17044062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 25164647 - 25164594
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
25164647 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 25164594  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 37605867 - 37605814
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
37605867 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 37605814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 55281214 - 55281267
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
55281214 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 55281267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 32290220 - 32290275
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||    
32290220 tgatacatagaccatcttaggtggcatgtaccacttatacacccatacacaattgt 32290275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 51579326 - 51579381
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||| ||||||||    
51579326 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacatacaattgt 51579381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 3287090 - 3287143
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    ||||||||| |||| ||||||||| |||||||||||||||||||||||||||||    
3287090 tgatacataaaccaccttagatggtatgtaccacttgtacacccacacacaatt 3287143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 43749098 - 43749151
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||| ||||    
43749098 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacataatt 43749151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 24059309 - 24059254
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||||||||||||| || ||||||||||||| ||||||||    
24059309 tgatacatagaccaccttagatggcatgtatcatttgtacacccacatacaattgt 24059254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 25784084 - 25784029
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||||| |||||||| |||||||||||||||||||| ||||||| ||||||    
25784084 tgatacatagatcatcttaggtggcatgtaccacttgtacatccacacataattgt 25784029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 32525198 - 32525143
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||||||||| |||||| |||||||| |||| ||||||||||||||    
32525198 tgatacatagaccatcttaggtggcatataccacttatacatccacacacaattgt 32525143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 20107116 - 20107172
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtaca-cccacacacaattgt 356  Q
    |||||||||||||| ||||| |||||||||||||||||||| ||| |||||||||||    
20107116 tgatacatagaccaccttaggtggcatgtaccacttgtacaccccgcacacaattgt 20107172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 344
Target Start/End: Complemental strand, 39631314 - 39631271
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacaccc 344  Q
    |||||||||||||| ||||| |||||||||||||||||||||||    
39631314 tgatacatagaccaccttaggtggcatgtaccacttgtacaccc 39631271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 41277221 - 41277276
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||||| || ||||| || |||||||||| |||||||||||| ||||||||    
41277221 tgatacatagatcaccttaggtgacatgtaccacctgtacacccacatacaattgt 41277276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 42179313 - 42179258
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| ||| ||||||||||| ||||||||  |||||||||    
42179313 tgatacatagaccaccttaggtggtatgtaccacttatacacccatgcacaattgt 42179258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 309 - 356
Target Start/End: Original strand, 51579594 - 51579641
Alignment:
309 agaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||| ||||| |||||||||||||||||||||||| | ||||||||    
51579594 agaccaccttaggtggcatgtaccacttgtacacccaaatacaattgt 51579641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 301 - 346
Target Start/End: Original strand, 36851233 - 36851278
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccac 346  Q
    |||| ||||||||| ||||  |||||||||||||||||||||||||    
36851233 tgatgcatagaccaccttaagtggcatgtaccacttgtacacccac 36851278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 2e-18; HSPs: 13)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 23004762 - 23004817
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||    
23004762 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaattgt 23004817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 9271116 - 9271169
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||| ||||    
9271116 tgatacatagaccaccttagatggcatgtaccacttgtacacccacacataatt 9271169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 38247804 - 38247857
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
38247804 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 38247857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 50989209 - 50989262
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
50989209 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 50989262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 51092341 - 51092394
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
51092341 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 51092394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 8330768 - 8330713
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||||||||||||||||||||||||  |||||||||||||    
8330768 tgatacatagaccaccttagatggcatgtaccacttgtacattcacacacaattgt 8330713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 33288138 - 33288193
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| ||| |||||||||||||||||||||||||||||||    
33288138 tgatacatagaccaccttaggtggtatgtaccacttgtacacccacacacaattgt 33288193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 299 - 354
Target Start/End: Original strand, 8496710 - 8496765
Alignment:
299 attgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||||| ||||| ||||||||||||||||| |||||||| ||||||    
8496710 attgatacatagaccaccttaggtggcatgtaccacttgtccacccacatacaatt 8496765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 12224179 - 12224126
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    ||||||||| |||| ||||| |||||||||||| ||||||||||||||||||||    
12224179 tgatacataaaccaccttaggtggcatgtaccatttgtacacccacacacaatt 12224126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 46135533 - 46135588
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||||||||||||| |||||||||| || ||||||||| ||| ||||||||    
46135533 tgatacatagaccatcttaaatggcatgtatcatttgtacacctacatacaattgt 46135588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 48034985 - 48034932
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    ||||||||| |||| ||||| || ||||||||||||||||||||||| ||||||    
48034985 tgatacataaaccaccttaggtgacatgtaccacttgtacacccacatacaatt 48034932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 301 - 346
Target Start/End: Complemental strand, 29915135 - 29915090
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccac 346  Q
    |||||||||||||| ||||  |||||| ||||||||||||||||||    
29915135 tgatacatagaccaccttatgtggcatataccacttgtacacccac 29915090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 301 - 346
Target Start/End: Complemental strand, 29964288 - 29964243
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccac 346  Q
    |||||||||||||| ||||  |||||| ||||||||||||||||||    
29964288 tgatacatagaccaccttatgtggcatataccacttgtacacccac 29964243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 46; Significance: 4e-17; HSPs: 15)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 303 - 356
Target Start/End: Complemental strand, 8368545 - 8368492
Alignment:
303 atacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||| ||||| |||||||||||||||||||||||||||||||||||    
8368545 atacatagaccaccttaggtggcatgtaccacttgtacacccacacacaattgt 8368492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 1993816 - 1993763
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| ||||||||| |||||||||||||||||||||||    
1993816 tgatacatagaccaccttaggtggcatgtatcacttgtacacccacacacaatt 1993763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 14342365 - 14342312
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| ||||||||||||||| |||||||||||||||||    
14342365 tgatacatagaccaccttaggtggcatgtaccacttatacacccacacacaatt 14342312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 43066080 - 43066027
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||| ||||||||||||    
43066080 tgatacatagaccaccttaggtggcatgtaccacttgtacatccacacacaatt 43066027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 2599537 - 2599592
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| ||||||||||||||| |||||||| ||||||||||    
2599537 tgatacatagaccaccttaggtggcatgtaccacttatacacccatacacaattgt 2599592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 16465788 - 16465733
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| |||||| ||||||||||||||||| ||||||| ||||||||    
16465788 tgatacatagaccaccttagacggcatgtaccacttgtatacccacatacaattgt 16465733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 41075773 - 41075718
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| || ||||||||||||||||||||||| ||||||||    
41075773 tgatacatagaccaccttaggtgacatgtaccacttgtacacccacatacaattgt 41075718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 352
Target Start/End: Complemental strand, 4077137 - 4077086
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaa 352  Q
    ||||| |||||||| ||||| |||||||||||||||||| ||||||||||||    
4077137 tgatatatagaccaccttaggtggcatgtaccacttgtatacccacacacaa 4077086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 10391481 - 10391426
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||||| |||||||| |||||||| |||||| |||||||| ||||||||||    
10391481 tgatacatagatcatcttaggtggcatgtgccacttatacacccatacacaattgt 10391426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 28898001 - 28898056
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| |||||| |||||||| |||||||| ||||||||||    
28898001 tgatacatagaccaccttaggtggcatataccacttatacacccatacacaattgt 28898056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 31774730 - 31774785
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| || |||||||||||||||||| |||| ||||||||    
31774730 tgatacatagaccaccttaggtgacatgtaccacttgtacactcacatacaattgt 31774785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 45413714 - 45413659
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| ||||||||||||||| |||| ||| ||||||||||    
45413714 tgatacatagaccaccttaggtggcatgtaccacttatacatccatacacaattgt 45413659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 11904859 - 11904914
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||| |||| ||||| |||||| ||||||||||||||||||| | ||||||    
11904859 tgatacataaaccaccttaggtggcatataccacttgtacacccacatataattgt 11904914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 303 - 336
Target Start/End: Original strand, 44077642 - 44077675
Alignment:
303 atacatagaccatcttagatggcatgtaccactt 336  Q
    ||||||||| ||||||||||||||||||||||||    
44077642 atacatagatcatcttagatggcatgtaccactt 44077675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 301 - 341
Target Start/End: Complemental strand, 31523688 - 31523648
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtaca 341  Q
    ||||| ||||||||||||||||| |||||| ||||||||||    
31523688 tgatagatagaccatcttagatgacatgtatcacttgtaca 31523648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 46; Significance: 4e-17; HSPs: 10)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 46576418 - 46576365
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
46576418 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 46576365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 31741049 - 31741104
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| ||||||||||||||| |||||||| ||||||||||    
31741049 tgatacatagaccaccttaggtggcatgtaccacttatacacccatacacaattgt 31741104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 38349635 - 38349580
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||| |||||||||| |||||| ||||||||||||||||||| | ||||||    
38349635 tgatacataaaccatcttaggtggcatataccacttgtacacccacatataattgt 38349580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 42974554 - 42974499
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||| |||| ||||| ||||||||||||||| |||||||||| ||||||||    
42974554 tgatacataaaccaccttaggtggcatgtaccacttatacacccacatacaattgt 42974499  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 302 - 347
Target Start/End: Original strand, 33496506 - 33496551
Alignment:
302 gatacatagaccatcttagatggcatgtaccacttgtacacccaca 347  Q
    ||||||||||||| ||||| || |||||||||||||||||||||||    
33496506 gatacatagaccaccttaggtgacatgtaccacttgtacacccaca 33496551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 38755071 - 38755018
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||| ||||||| ||| ||||    
38755071 tgatacatagaccaccttaggtggcatgtaccacttgaacacccatacataatt 38755018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 48460665 - 48460718
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||| ||||||| ||||| ||||||    
48460665 tgatacatagaccaccttaggtggcatgtaccatttgtacatccacatacaatt 48460718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 301 - 345
Target Start/End: Complemental strand, 47480188 - 47480144
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacaccca 345  Q
    |||||||||||||| ||||| |||||||||||| |||||||||||    
47480188 tgatacatagaccaccttaggtggcatgtaccatttgtacaccca 47480144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 28713683 - 28713738
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||| |||| ||||| |||||| ||||||||||||||||||| | ||||||    
28713683 tgatacataaaccaccttaggtggcatataccacttgtacacccacatataattgt 28713738  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 302 - 356
Target Start/End: Original strand, 11752604 - 11752658
Alignment:
302 gatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||||||| ||||| ||||||||| |||||||||||| ||| | ||||||    
11752604 gatacatagaccaccttaggtggcatgtatcacttgtacacctacatataattgt 11752658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 4e-17; HSPs: 8)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 14314162 - 14314109
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
14314162 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 14314109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 9045839 - 9045892
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| ||||||||| |||||||||||||||||||||||    
9045839 tgatacatagaccaccttaggtggcatgtatcacttgtacacccacacacaatt 9045892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 23915978 - 23916033
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||||| || ||||||||||||||||||||| |||||||| ||||||||||    
23915978 tgatacatagatcaccttagatggcatgtaccacttatacacccatacacaattgt 23916033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 301 - 347
Target Start/End: Complemental strand, 34792827 - 34792781
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccaca 347  Q
    |||||||||||||| ||||| ||||||||||||||||||||||||||    
34792827 tgatacatagaccaccttaggtggcatgtaccacttgtacacccaca 34792781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 1244732 - 1244679
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||  |||||||||||||||||||| ||||||||||||    
1244732 tgatacatagaccaccttaagtggcatgtaccacttgtacatccacacacaatt 1244679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 303 - 351
Target Start/End: Complemental strand, 9521991 - 9521943
Alignment:
303 atacatagaccatcttagatggcatgtaccacttgtacacccacacaca 351  Q
    ||||||||| || ||||| ||||||||||||||||||||||||||||||    
9521991 atacatagatcaccttaggtggcatgtaccacttgtacacccacacaca 9521943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 29429590 - 29429645
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||| |||| | ||||| |||||||||||||||||||||||||| ||||||||    
29429590 tgatacacagactaccttaggtggcatgtaccacttgtacacccacatacaattgt 29429645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 301 - 349
Target Start/End: Original strand, 16717996 - 16718044
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacaca 349  Q
    ||||||||| |||| ||||| |||||| |||||||||||||||||||||    
16717996 tgatacataaaccaccttaggtggcatataccacttgtacacccacaca 16718044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 46; Significance: 4e-17; HSPs: 6)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 13988253 - 13988306
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
13988253 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 13988306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 36890383 - 36890436
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
36890383 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 36890436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 15285335 - 15285390
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||||||||||||||||||| ||||| || ||||||||||    
15285335 tgatacatagaccaccttagatggcatgtaccacttatacactcatacacaattgt 15285390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 8378350 - 8378405
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| |||||||| ||||||||| ||||||| ||||||||| ||||    
8378350 tgatacatagaccaccttagatgacatgtaccatttgtacatccacacacagttgt 8378405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 11247198 - 11247251
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||| | |||||||||||| ||| ||||||||| ||||||||||||    
11247198 tgatacatagactaccttagatggcatatactacttgtacatccacacacaatt 11247251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 43100384 - 43100329
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    ||||||||| |||||||||| ||| || ||||||||||||||||||| | ||||||    
43100384 tgatacataaaccatcttaggtggtatataccacttgtacacccacatataattgt 43100329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 46; Significance: 4e-17; HSPs: 14)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 13697141 - 13697088
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||||    
13697141 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaatt 13697088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 301 - 352
Target Start/End: Complemental strand, 14945912 - 14945861
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaa 352  Q
    |||||||||||||| ||||| |||||||||||||||||||||||||||||||    
14945912 tgatacatagaccaccttaggtggcatgtaccacttgtacacccacacacaa 14945861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 14242691 - 14242638
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||||||||| ||| ||||||||| |||||||||||||||||||    
14242691 tgatacatagaccatcttaggtggtatgtaccacctgtacacccacacacaatt 14242638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 36272837 - 36272784
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| ||||||||||||||| |||||||||||||||||    
36272837 tgatacatagaccaccttaggtggcatgtaccacttatacacccacacacaatt 36272784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 36709367 - 36709314
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||||||||| ||| ||||||||||| |||||||||||||||||    
36709367 tgatacatagaccatcttaggtggtatgtaccacttatacacccacacacaatt 36709314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 301 - 356
Target Start/End: Original strand, 3121616 - 3121671
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||||||||||||||||||| ||||| || ||||||||||    
3121616 tgatacatagaccaccttagatggcatgtaccacttatacactcatacacaattgt 3121671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 32599424 - 32599371
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| ||||| |||||||||||||||||||| ||||||| ||||    
32599424 tgatacatagaccaccttaggtggcatgtaccacttgtacatccacacataatt 32599371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 40095269 - 40095322
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    |||||||||||||| |||||||| ||||||||||||||||| ||||| ||||||    
40095269 tgatacatagaccaccttagatgacatgtaccacttgtacatccacatacaatt 40095322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 301 - 354
Target Start/End: Original strand, 17823585 - 17823638
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    ||||||||| |||| ||||||||| ||||| |||||||||||||||| ||||||    
17823585 tgatacataaaccaccttagatggtatgtatcacttgtacacccacatacaatt 17823638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 301 - 350
Target Start/End: Complemental strand, 23860340 - 23860291
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacac 350  Q
    |||||||||||||| ||||| |||||||||||||||||| || |||||||    
23860340 tgatacatagaccaccttaggtggcatgtaccacttgtatactcacacac 23860291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 301 - 356
Target Start/End: Complemental strand, 24475877 - 24475822
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||||| ||||| ||| ||||| ||||| |||||||| ||||||||||    
24475877 tgatacatagaccaccttaggtggtatgtatcacttatacacccatacacaattgt 24475822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 303 - 356
Target Start/End: Original strand, 25333152 - 25333205
Alignment:
303 atacatagaccatcttagatggcatgtaccacttgtacacccacacacaattgt 356  Q
    |||||||||||| ||| ||| |||||||||||||||||| | ||||||| ||||    
25333152 atacatagaccaccttggatcgcatgtaccacttgtacatcaacacacatttgt 25333205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 33555539 - 33555486
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    ||||||||||| || ||||  |||||||||||||||||||||  ||||||||||    
33555539 tgatacatagatcaccttaagtggcatgtaccacttgtacacttacacacaatt 33555486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 42061407 - 42061354
Alignment:
301 tgatacatagaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    ||||||||||| ||  || | |||||||||||||||||||||||||| ||||||    
42061407 tgatacatagagcactttgggtggcatgtaccacttgtacacccacatacaatt 42061354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0933 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0933
Description:

Target: scaffold0933; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 301 - 354
Target Start/End: Complemental strand, 3230 - 3176
Alignment:
301 tgatacata-gaccatcttagatggcatgtaccacttgtacacccacacacaatt 354  Q
    ||||||||| |||||||||||||| ||||||||| ||||||||||||| ||||||    
3230 tgatacataagaccatcttagatgacatgtaccatttgtacacccacatacaatt 3176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106171 times since January 2019
Visitors: 1319