View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk65-2 (Length: 358)

Name: R108-tnk65-2
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk65-2
R108-tnk65-2
[»] chr8 (2 HSPs)
chr8 (1-358)||(36877526-36877883)
chr8 (22-358)||(36870939-36871276)
[»] chr2 (1 HSPs)
chr2 (281-351)||(718371-718441)


Alignment Details
Target: chr8 (Bit Score: 350; Significance: 0; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 1 - 358
Target Start/End: Complemental strand, 36877883 - 36877526
Alignment:
1 cattctacctgatgacacaactgttgctgttaaatgcatggaagaatctgattttcaaggggatgatgagttctataccgaagtggagattattggcaac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36877883 cattctacctgatgacacaactgttgctgttaaatgcatggaagaatctgattttcaaggggatgatgagttctataccgaagtggagattattggcaac 36877784  T
101 ttgaaacaccgcaatctagtgccattaagagggtgttgtgtcgttgatgacgatcataatcaagagcacaaaaataggtatcttgtttatgattatatgc 200  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36877783 ttgaaacaccgcaatctagtgccattaagagggtgttgtgtggttgatgacgatcataatcaagagcacaaaaataggtatcttgtttatgattatatgc 36877684  T
201 caaatggtaaccttgaagatcatatctttccatcattggacaacgaaaatgaacagaaattgttgacttggcctcaaagaaaaaacataatcttggatgt 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36877683 caaatggtaaccttgaagatcatatctttccatcattggacaacgaaaatgaacagaaattgttgacttggcctcaaagaaaaaacataatcttggatgt 36877584  T
301 ggcaagtgggttggtttatttgcaccttggagttaaacctgctatttatcacagagat 358  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
36877583 ggcaagtgggttggtttatttgcactttggagttaaacctgctatttatcacagagat 36877526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 22 - 358
Target Start/End: Complemental strand, 36871276 - 36870939
Alignment:
22 tgttgctgttaaatgcatggaagaatctgattttcaaggggatgatgagttctataccgaagtggagattattggcaacttgaaacaccgcaatctagtg 121  Q
    |||||| |||||| | || ||||||||||||| |||||| |||| |||||| || |  || |||| |||| || | | ||||||||| |||||| | |||    
36871276 tgttgcggttaaaaggattgaagaatctgattatcaaggagatgttgagttttacagagaggtggggattgttagtagcttgaaacatcgcaatttggtg 36871177  T
122 ccattaagagggtgttgtgtcgttgatgacgatcataatcaagagcacaaaaataggtatcttgtttatgattatatgccaaatggtaaccttgaagatc 221  Q
    ||  ||||||| |||||||| |||| ||| ||| | ||||  ||| ||      | ||||||||| |||||||||||||| |||||||  ||| |||| |    
36871176 ccgctaagaggatgttgtgttgttggtgaagatgagaatcctgagtactttggaaagtatcttgtctatgattatatgccgaatggtagtcttaaagacc 36871077  T
222 atatctttccatcattggacaacgaaaa-tgaacagaaattgttgacttggcctcaaagaaaaaacataatcttggatgtggcaagtgggttggtttatt 320  Q
    || | || ||   | |||| ||| |||| |||| |  |||  ||||||||| ||||||||||||||||||||||||||||||| |  | |||||||||||    
36871076 atcttttccctgaaatggataaccaaaaatgaaaaacaatctttgacttggtctcaaagaaaaaacataatcttggatgtggcgaacgcgttggtttatt 36870977  T
321 tgcaccttggagttaaacctgctatttatcacagagat 358  Q
    ||||| |||||||||| ||| || ||||||||||||||    
36870976 tgcactttggagttaagcctcctgtttatcacagagat 36870939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 281 - 351
Target Start/End: Original strand, 718371 - 718441
Alignment:
281 aaaaacataatcttggatgtggcaagtgggttggtttatttgcaccttggagttaaacctgctatttatca 351  Q
    |||||||||||||||||||||| ||  ||||||| |||||| |||  ||||||||| ||||| ||||||||    
718371 aaaaacataatcttggatgtgggaaaagggttggcttatttacactatggagttaagcctgcaatttatca 718441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108464 times since January 2019
Visitors: 1329