View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk65-4 (Length: 752)

Name: R108-tnk65-4
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk65-4
R108-tnk65-4
[»] chr5 (13 HSPs)
chr5 (1-752)||(6549575-6550303)
chr5 (442-612)||(26747710-26747880)
chr5 (491-750)||(27014399-27014654)
chr5 (661-750)||(30618092-30618182)
chr5 (456-564)||(7250060-7250167)
chr5 (451-569)||(1973253-1973371)
chr5 (546-639)||(30618195-30618286)
chr5 (674-749)||(43294431-43294508)
chr5 (491-622)||(43294261-43294388)
chr5 (451-510)||(23062204-23062263)
chr5 (671-729)||(25052041-25052099)
chr5 (442-476)||(6556751-6556785)
chr5 (442-476)||(43297795-43297829)
[»] chr7 (18 HSPs)
chr7 (442-749)||(1295960-1296260)
chr7 (659-750)||(47868272-47868365)
chr7 (661-749)||(25570219-25570309)
chr7 (661-749)||(45173666-45173755)
chr7 (495-624)||(40793024-40793152)
chr7 (674-750)||(40446319-40446397)
chr7 (674-749)||(40793173-40793250)
chr7 (661-750)||(10687546-10687636)
chr7 (451-506)||(10552721-10552776)
chr7 (544-639)||(40446421-40446515)
chr7 (677-749)||(43379950-43380024)
chr7 (546-639)||(45173769-45173860)
chr7 (546-640)||(10687649-10687739)
chr7 (547-634)||(16798582-16798665)
chr7 (552-611)||(25570340-25570398)
chr7 (508-571)||(47868418-47868481)
chr7 (451-508)||(42734424-42734481)
chr7 (451-508)||(42736925-42736982)
[»] chr1 (16 HSPs)
chr1 (448-732)||(26066945-26067219)
chr1 (442-630)||(7402859-7403045)
chr1 (451-750)||(28861950-28862239)
chr1 (661-750)||(45471618-45471708)
chr1 (672-749)||(36361161-36361240)
chr1 (546-615)||(45471521-45471590)
chr1 (661-721)||(7403066-7403125)
chr1 (674-750)||(18888379-18888457)
chr1 (546-634)||(18888488-18888574)
chr1 (453-533)||(13706113-13706193)
chr1 (456-569)||(49259894-49260007)
chr1 (677-750)||(36791305-36791379)
chr1 (451-510)||(15292777-15292836)
chr1 (451-510)||(42058639-42058698)
chr1 (442-476)||(48138670-48138704)
chr1 (442-475)||(7407492-7407525)
[»] chr8 (9 HSPs)
chr8 (442-749)||(26701845-26702140)
chr8 (539-639)||(44319976-44320075)
chr8 (491-750)||(45115300-45115553)
chr8 (451-561)||(16583215-16583325)
chr8 (677-750)||(44320107-44320182)
chr8 (674-750)||(5772996-5773074)
chr8 (453-569)||(38032173-38032289)
chr8 (451-501)||(14737653-14737703)
chr8 (442-476)||(26702911-26702945)
[»] chr4 (18 HSPs)
chr4 (442-750)||(32715285-32715585)
chr4 (525-749)||(17915259-17915474)
chr4 (552-750)||(46518103-46518295)
chr4 (672-749)||(18622741-18622820)
chr4 (585-752)||(1589991-1590150)
chr4 (451-558)||(17915158-17915265)
chr4 (451-564)||(12028298-12028410)
chr4 (451-532)||(46518288-46518369)
chr4 (552-636)||(35430596-35430680)
chr4 (585-640)||(18622665-18622720)
chr4 (451-569)||(51026014-51026132)
chr4 (677-750)||(17482905-17482980)
chr4 (567-630)||(17496090-17496151)
chr4 (677-732)||(17495998-17496053)
chr4 (451-509)||(20854994-20855052)
chr4 (451-510)||(46356087-46356146)
chr4 (451-509)||(20855755-20855813)
chr4 (562-634)||(4417321-4417391)
[»] chr2 (11 HSPs)
chr2 (442-749)||(9640021-9640320)
chr2 (494-752)||(13329812-13330061)
chr2 (523-750)||(22711949-22712170)
chr2 (451-565)||(2121231-2121344)
chr2 (670-749)||(31434822-31434903)
chr2 (677-750)||(31203949-31204024)
chr2 (677-750)||(31184227-31184302)
chr2 (552-635)||(31434927-31435010)
chr2 (451-569)||(34519926-34520044)
chr2 (451-569)||(10358757-10358875)
chr2 (451-508)||(17112329-17112386)
[»] chr3 (17 HSPs)
chr3 (491-750)||(4121553-4121803)
chr3 (503-639)||(51549384-51549518)
chr3 (546-749)||(12486171-12486367)
chr3 (442-630)||(40469099-40469282)
chr3 (546-749)||(2285820-2286016)
chr3 (489-600)||(8262785-8262896)
chr3 (677-749)||(40468987-40469061)
chr3 (674-749)||(29774610-29774687)
chr3 (674-749)||(32425882-32425959)
chr3 (677-749)||(8262951-8263025)
chr3 (552-634)||(29774718-29774798)
chr3 (682-732)||(1276200-1276250)
chr3 (547-630)||(8786161-8786242)
chr3 (451-534)||(44809812-44809895)
chr3 (661-705)||(51549325-51549370)
chr3 (442-476)||(33942758-33942792)
chr3 (451-565)||(50459551-50459665)
[»] chr6 (6 HSPs)
chr6 (496-750)||(29266905-29267152)
chr6 (671-750)||(29231937-29232018)
chr6 (673-750)||(9094456-9094535)
chr6 (552-621)||(9094345-9094413)
chr6 (552-639)||(29232044-29232130)
chr6 (677-747)||(31858694-31858766)
[»] scaffold0325 (2 HSPs)
scaffold0325 (672-750)||(3048-3128)
scaffold0325 (491-621)||(2878-3005)


Alignment Details
Target: chr5 (Bit Score: 481; Significance: 0; HSPs: 13)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 481; E-Value: 0
Query Start/End: Original strand, 1 - 752
Target Start/End: Original strand, 6549575 - 6550303
Alignment:
1 attttctcggtctagttgtcatatgatctctcgttggttgtgagagnnnnnnntgctaaggttatgaatttagtaagattgtttttctttagcatgtagg 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||||    
6549575 atttcctcggtctagttgtcatatgatctctcgttggttgtgagagaaaaaaatgctaaggttatgaatttagtaagattgtttttctttagcatgtagg 6549674  T
101 aaatgtaatctaagtaattttgtaaacgtaaatgtgttcctaggccagaaactgcattattgttgtactatataatcctacgaagtgctagtcattggat 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||    
6549675 aaatgtaatctaagtaattttgtaaacgtaaatgtgttcctaggccagaaactgcattattgatgtgctatataatcctacgaagtactagtcattggat 6549774  T
201 tccaaaagtttgttttacattggttggtatacagcttgtagtacgggtttttctctaaccaggacgggacctattctctggatagtggttttcatttttg 300  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     |||||||||||||||||||| |||||||||||||    
6549775 tccaaaagtttgttttacattggttggtatacagcttgtagtacgggtttttctctaacca-----ggacctattctctggatagt-gttttcatttttg 6549868  T
301 gatgcactggctatgactattgaccaatgataacatcttcaatttcagttgcgttattgttggccaagtttgttggagggttcaggaaatatcacatcac 400  Q
    ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
6549869 gatgcactgactatgactattgaccaatgacaacatcttcaatttcagttgcgttattgttggccaagtttgttggagggttgaggaaatatcacatcac 6549968  T
401 attagtataaaatggagaaaattgnnnnnnnnnnnnnnnnnacattggaaacttcctattgacacaagtaatttactaaaaagtttccaacggtagttaa 500  Q
    ||||||||||||||||||||||||                 |  | |||||||||||||||||| |||||||||||||||||||| ||||| ||||||||    
6549969 attagtataaaatggagaaaattg-----------ttttttatgtaggaaacttcctattgacataagtaatttactaaaaagttcccaacagtagttaa 6550057  T
501 caaccgttggaagatgcgctgacagttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctc 600  Q
    |||||||| |||||||||| | |||||||||||||||||||||| || ||||||||||||||||| |||||||| ||||||| |||||||||||||||||    
6550058 caaccgttagaagatgcgccggcagttaactgccactgggactcagcagttgttaactgccgttgttttttgccccccaaaaccagaaaacccctacctc 6550157  T
601 tcctattcactcatcgccttacctcaccattaccatacctnnnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttccaaatca 700  Q
    |||||||||||||| ||||||||||||||||||||| |||                ||||||||||||||||||||||||||||||||| ||||||||||    
6550158 tcctattcactcattgccttacctcaccattaccattcct--------aaaaaaaattcaatttcaaatatttttgtgtcaaaatcttggttccaaatca 6550249  T
701 ttgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacagat 752  Q
    ||||||||| |||||||||||||||||  |||||||||||||||||||| ||||    
6550250 ttgctgatcgattgctaggacgtttctacacacaatatgcatcaaagaatagat 6550303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 123; E-Value: 9e-63
Query Start/End: Original strand, 442 - 612
Target Start/End: Original strand, 26747710 - 26747880
Alignment:
442 acattggaaacttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactggga 541  Q
    |||| |||||||||||||||||||||||||||||||||||||  |||| ||||||||||||||||||||||||||||| ||||||||| |||| ||||||    
26747710 acataggaaacttcctattgacacaagtaatttactaaaaagcctccagcggtagttaacaaccgttggaagatgcgccgacagttaattgccgctggga 26747809  T
542 ctccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactc 612  Q
    ||| |||||||||||||||||||||||||| || ||||||| |||||||||||||||| ||||||||||||    
26747810 ctcagcggttgttaactgccgttgcttttttccccccaaaaccagaaaacccctacctatcctattcactc 26747880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 110; E-Value: 5e-55
Query Start/End: Original strand, 491 - 750
Target Start/End: Complemental strand, 27014654 - 27014399
Alignment:
491 cggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaa 590  Q
    ||||||||||| ||||||||||||  ||| |||||||||||||| ||| ||||| |||||||||||||   ||||||||||  | ||||||| ||| |||    
27014654 cggtagttaactaccgttggaagaaccgccgacagttaactgccgctgagactcagcggttgttaactattgttgctttttttcccccaaaaccaggaaa 27014555  T
591 cccctacctctcctattcactcatcgccttacctcaccattaccatacctnnnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgc 690  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||                | | ||||||||| |||||||||||||||||||     
27014554 cccctacctctcctattcactcatcaccttacctcaccattaccatacct------aaaaataaaatcccatttcaaatttttttgtgtcaaaatcttgt 27014461  T
691 ttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacag 750  Q
    ||| ||||||||||||||| |||||||||||||||||  |||||||||||||||||||||||    
27014460 ttctaaatcattgctgatcgattgctaggacgtttctacacacaatatgcatcaaagaacag 27014399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 661 - 750
Target Start/End: Complemental strand, 30618182 - 30618092
Alignment:
661 atttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttctacac--aatatgcatcaaagaacag 750  Q
    |||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||| ||||||||||  |||||||||||||||||||    
30618182 atttcaaa-atttttgtgtcaaaatcttgcttccaaatcattgttgatcgattgctaggatgtttctacacataatatgcatcaaagaacag 30618092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 456 - 564
Target Start/End: Original strand, 7250060 - 7250167
Alignment:
456 ctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggttgtta 555  Q
    ||||||||| || |||||||||||||||| |||| ||||||||||| || |||||||||  ||  | | |||||||||| || |||||| ||||||||||    
7250060 ctattgacataaataatttactaaaaagtctccagcggtagttaactactgttggaagaaccgtcggcggttaactgccgct-ggactcagcggttgtta 7250158  T
556 actgccgtt 564  Q
    |||||||||    
7250159 actgccgtt 7250167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 451 - 569
Target Start/End: Complemental strand, 1973371 - 1973253
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggt 550  Q
    ||||| |||||||||||||||||||| |||||| ||||  ||  |||||||||||||| |   |||||| |||||||||||||| |||| | |  | |||    
1973371 acttcatattgacacaagtaatttaccaaaaagcttccggcgacagttaacaaccgttaggccatgcgcagacagttaactgccgctggcatttagtggt 1973272  T
551 tgttaactgccgttgcttt 569  Q
    ||||||||| |||||||||    
1973271 tgttaactgtcgttgcttt 1973253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 546 - 639
Target Start/End: Complemental strand, 30618286 - 30618195
Alignment:
546 gcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacc 639  Q
    ||||| ||||| |||||||| ||||  || ||||||| |||||||||||||| ||||||||||| ||||| |||||  |||||| |||||||||    
30618286 gcggtcgttaattgccgttggtttt--ccccccaaaaccagaaaacccctacatctcctattcattcatcaccttagatcaccaataccatacc 30618195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 674 - 749
Target Start/End: Original strand, 43294431 - 43294508
Alignment:
674 ttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttcta--cacaatatgcatcaaagaaca 749  Q
    |||||||||||||||| ||| || |||||| ||||| |||||||| ||||||| |  |||||||||||||||||||||    
43294431 ttgtgtcaaaatcttggttctaactcattgttgatcgattgctagaacgtttccacgcacaatatgcatcaaagaaca 43294508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 491 - 622
Target Start/End: Original strand, 43294261 - 43294388
Alignment:
491 cggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaa 590  Q
    ||||||||||| |||||||| |||  | ||| |||||||| |||  |||| ||| ||||| |||||||| |||| |||||| || ||||||| |||||||    
43294261 cggtagttaactaccgttggtagaaccactggcagttaacagccgttggggctcagcggtagttaactgtcgtt-cttttttcc-cccaaaaccagaaaa 43294358  T
591 cccctacctctcctattcactcatcgccttac 622  Q
     ||||||  |||||||||||||||| ||||||    
43294359 gccctac--ctcctattcactcatcaccttac 43294388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 451 - 510
Target Start/End: Original strand, 23062204 - 23062263
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttgg 510  Q
    ||||||||||||||||| |||||||| ||||||| || | ||||||||||| ||||||||    
23062204 acttcctattgacacaaataatttaccaaaaagtctcaagcggtagttaactaccgttgg 23062263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 671 - 729
Target Start/End: Original strand, 25052041 - 25052099
Alignment:
671 tttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttctac 729  Q
    ||||| ||| ||||| ||| ||||||||||||||||||  |||||||||||||||||||    
25052041 tttttttgttaaaattttggttccaaatcattgctgatggattgctaggacgtttctac 25052099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 442 - 476
Target Start/End: Complemental strand, 6556785 - 6556751
Alignment:
442 acattggaaacttcctattgacacaagtaatttac 476  Q
    |||| ||||||||||||||||||||||||||||||    
6556785 acataggaaacttcctattgacacaagtaatttac 6556751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 442 - 476
Target Start/End: Complemental strand, 43297829 - 43297795
Alignment:
442 acattggaaacttcctattgacacaagtaatttac 476  Q
    |||| ||||||||||||||||||||||||||||||    
43297829 acatgggaaacttcctattgacacaagtaatttac 43297795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 142; Significance: 4e-74; HSPs: 18)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 142; E-Value: 4e-74
Query Start/End: Original strand, 442 - 749
Target Start/End: Original strand, 1295960 - 1296260
Alignment:
442 acattggaaacttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactggga 541  Q
    |||| ||||||||||||||||||||||||||||||||||||     || ||||||||||| ||||||||||||  | | |||||||||||||| ||||||    
1295960 acataggaaacttcctattgacacaagtaatttactaaaaaaccctcagcggtagttaactaccgttggaagaaccaccgacagttaactgccgctggga 1296059  T
542 ctccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacctn 641  Q
    ||| |||||||||||||| ||||||||||| || ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||     
1296060 ctcagcggttgttaactgtcgttgcttttttccccccaaaaccagaaaacccctacctctcctattcactcatcaccttacctcaccattaccatacct- 1296158  T
642 nnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgca 739  Q
                   | | |||||||   ||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||  ||||||||||||    
1296159 --------aaaaaaatcccatttcaatattttttgtgtcaaaatcttgcttccaaatcattgttgatcgattgctaggacgtttctacacacaatatgca 1296250  T
740 tcaaagaaca 749  Q
    ||||||||||    
1296251 tcaaagaaca 1296260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 659 - 750
Target Start/End: Complemental strand, 47868365 - 47868272
Alignment:
659 caatttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttcta--cacaatatgcatcaaagaacag 750  Q
    ||||||||||||||||||||||||||||||||||||||  ||||| ||||| ||||||||||||||||||  ||||||||||||||||||||||    
47868365 caatttcaaatatttttgtgtcaaaatcttgcttccaatccattgttgatcgattgctaggacgtttctacacacaatatgcatcaaagaacag 47868272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 661 - 749
Target Start/End: Complemental strand, 25570309 - 25570219
Alignment:
661 atttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttcta--cacaatatgcatcaaagaaca 749  Q
    ||||||||| ||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||  |||||||||||||||||||||    
25570309 atttcaaatttttttttgtcaaaatcttgcttccaaatcattgttgatcgattgctaggacgtttctacacacaatatgcatcaaagaaca 25570219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 661 - 749
Target Start/End: Complemental strand, 45173755 - 45173666
Alignment:
661 atttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttc--tacacaatatgcatcaaagaaca 749  Q
    |||||||| |||||||||||||||||||||||||||||||||| ||||  ||||||||||||||||  |||||||||||||||||||||||    
45173755 atttcaaa-atttttgtgtcaaaatcttgcttccaaatcattgatgattgattgctaggacgtttctatacacaatatgcatcaaagaaca 45173666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 495 - 624
Target Start/End: Original strand, 40793024 - 40793152
Alignment:
495 agttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccc 594  Q
    ||||||||||| ||||||||  |||  |||||| |||||| ||||||||| ||||||||||||  ||||| |||||| || ||||||| || |||||| |    
40793024 agttaacaaccattggaagaaccgccaacagtttactgccgctgggactcagcggttgttaacaaccgttacttttttcc-cccaaaaccaaaaaacctc 40793122  T
595 tacctctcctattcactcatcgccttacct 624  Q
    ||||||||||||||||||||| ||||||||    
40793123 tacctctcctattcactcatcaccttacct 40793152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 674 - 750
Target Start/End: Complemental strand, 40446397 - 40446319
Alignment:
674 ttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttcta--cacaatatgcatcaaagaacag 750  Q
    |||||||||||||||||||||||||||||| ||||| ||||||| || |||||||  ||||||||||||||||||||||    
40446397 ttgtgtcaaaatcttgcttccaaatcattgttgatcgattgctatgatgtttctacacacaatatgcatcaaagaacag 40446319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 51; E-Value: 8e-20
Query Start/End: Original strand, 674 - 749
Target Start/End: Original strand, 40793173 - 40793250
Alignment:
674 ttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaaca 749  Q
    ||||||||||||||||||||||| ||| |||||||| |||||||||||||||||  ||||||||||||||||| ||||    
40793173 ttgtgtcaaaatcttgcttccaactcactgctgatcgattgctaggacgtttctacacacaatatgcatcaaaaaaca 40793250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 661 - 750
Target Start/End: Complemental strand, 10687636 - 10687546
Alignment:
661 atttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttctac--acaatatgcatcaaagaacag 750  Q
    |||||||| |||||||||||||||||||| ||||||||||||| ||||  |||||||||||||||||||  ||||||| ||||||| |||||    
10687636 atttcaaa-atttttgtgtcaaaatcttggttccaaatcattgatgatggattgctaggacgtttctacggacaatatacatcaaaaaacag 10687546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 451 - 506
Target Start/End: Original strand, 10552721 - 10552776
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccg 506  Q
    |||||||||||||||||||||||||||||||||| |||| ||||||||||||||||    
10552721 acttcctattgacacaagtaatttactaaaaagtctccagcggtagttaacaaccg 10552776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 544 - 639
Target Start/End: Complemental strand, 40446515 - 40446421
Alignment:
544 ccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacc 639  Q
    ||||||| |||||||||||||| ||||  || ||||||| |||||||||||||||||||||||||| ||||| |||||| |||||| || ||||||    
40446515 ccgcggtcgttaactgccgttggttttatcc-cccaaaaccagaaaacccctacctctcctattcattcatcaccttacatcaccaatatcatacc 40446421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 677 - 749
Target Start/End: Complemental strand, 43380024 - 43379950
Alignment:
677 tgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaaca 749  Q
    ||||||||||||| ||||||||||||| ||||| |||| |||||||||| |  ||||||||||||||||||||||    
43380024 tgtcaaaatcttggttccaaatcattgatgatcgattgttaggacgtttgtacacacaatatgcatcaaagaaca 43379950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 546 - 639
Target Start/End: Complemental strand, 45173860 - 45173769
Alignment:
546 gcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacc 639  Q
    ||||| |||||||||||||| ||||| ||  |||||| ||||||||| || ||||||||||| | ||||| |||||| |||||| |||||||||    
45173860 gcggtcgttaactgccgttggttttttcc--ccaaaaccagaaaacctctgcctctcctatttattcatcaccttacatcaccaataccatacc 45173769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 546 - 640
Target Start/End: Complemental strand, 10687739 - 10687649
Alignment:
546 gcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacct 640  Q
    ||||| ||||||||| | ||| |||| || ||||||| ||||||||||||||   ||||||||||||||| ||||||||||||  ||||||||||    
10687739 gcggtagttaactgctgatgcgttttccc-cccaaaaccagaaaacccctac---tcctattcactcatcaccttacctcacctataccatacct 10687649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 547 - 634
Target Start/End: Complemental strand, 16798665 - 16798582
Alignment:
547 cggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattacc 634  Q
    |||| |||||||| |||||  |||| || |||||||||||||||||| ||||||  ||||||||||||| ||||||||||||||||||    
16798665 cggtagttaactgtcgttgagttttccc-cccaaaatcagaaaaccc-tacctc--ctattcactcatcaccttacctcaccattacc 16798582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 552 - 611
Target Start/End: Complemental strand, 25570398 - 25570340
Alignment:
552 gttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcact 611  Q
    ||||||||||||||||||||  | ||||||| |||||||||| |||||||||||||||||    
25570398 gttaactgccgttgctttttttc-cccaaaaccagaaaacccatacctctcctattcact 25570340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 508 - 571
Target Start/End: Complemental strand, 47868481 - 47868418
Alignment:
508 tggaagatgcgctgacagttaactgccactgggactccgcggttgttaactgccgttgcttttt 571  Q
    |||||||||||| |  ||||||||||| |||| |||| |||||||||||||||||||| |||||    
47868481 tggaagatgcgccggtagttaactgccgctggaactcagcggttgttaactgccgttgtttttt 47868418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 451 - 508
Target Start/End: Original strand, 42734424 - 42734481
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgtt 508  Q
    |||||||||||||||||||||||||  ||||||   ||||||| ||||||||||||||    
42734424 acttcctattgacacaagtaatttaacaaaaagcccccaacggcagttaacaaccgtt 42734481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 451 - 508
Target Start/End: Complemental strand, 42736982 - 42736925
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgtt 508  Q
    |||||||||||||||||||||||||  ||||||  |||| ||| ||||||||||||||    
42736982 acttcctattgacacaagtaatttatcaaaaagcctccagcggcagttaacaaccgtt 42736925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 136; Significance: 1e-70; HSPs: 16)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 448 - 732
Target Start/End: Complemental strand, 26067219 - 26066945
Alignment:
448 gaaacttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgc 547  Q
    ||||||| | ||||||| || |||||||||||||||| ||||||||||||||||||| |||||| ||||||  ||||||||||||||  ||||| || ||    
26067219 gaaactttcaattgacataaataatttactaaaaagtctccaacggtagttaacaactgttggaggatgcgacgacagttaactgccgttgggaatcagc 26067120  T
548 ggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacctnnnnnnn 647  Q
    ||||||||| |||||||| ||||| |||||||||| ||||||||  |||||||||||||||||||||| |||||||||| |||||||||||||           
26067119 ggttgttaattgccgttgattttt-cctcccaaaaccagaaaacttctacctctcctattcactcatcaccttacctcatcattaccatacct------- 26067028  T
648 nnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttctacaca 732  Q
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||    
26067027 --gaaaaaattcaatttcaaatatttttgtgtcaaaatcttgcttccaaatcattgttgatcgattgctaggacgtttctacaca 26066945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 97; E-Value: 3e-47
Query Start/End: Original strand, 442 - 630
Target Start/End: Original strand, 7402859 - 7403045
Alignment:
442 acattggaaacttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactggga 541  Q
    |||| |||||||||||||||||| ||||||||||||||||||   | |  |||||||||||||||||||||||||||| | |||||||||| | ||||||    
7402859 acataggaaacttcctattgaca-aagtaatttactaaaaagcccctagtggtagttaacaaccgttggaagatgcgccggcagttaactgtcgctggga 7402957  T
542 ctccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccat 630  Q
    |   ||||||||||| |||||||||||||| || || |||| ||||||| |||||||||||||||||||||||||||||||||||||||    
7402958 catagcggttgttaattgccgttgctttttcccccctaaaaccagaaaa-ccctacctctcctattcactcatcgccttacctcaccat 7403045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 76; E-Value: 1e-34
Query Start/End: Original strand, 451 - 750
Target Start/End: Original strand, 28861950 - 28862239
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggt 550  Q
    ||||||||||||||||||||||||||||||||| | | | ||| |||||||  |||||||||||  ||| | ||||||||||||  | ||| ||  ||||    
28861950 acttcctattgacacaagtaatttactaaaaagctcctagcggcagttaacttccgttggaagaaccgccggcagttaactgccgttaggagtcaacggt 28862049  T
551 tgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacctnnnnnnnnnn 650  Q
    |||||| |||||||||||||| || |  |||| ||||||| ||||||  |||||||||||||||| ||||||||||||| |||||| ||               
28862050 tgttaaatgccgttgctttttcccccaaaaaaccagaaaagccctac--ctcctattcactcatcaccttacctcacca-taccattcc--------aca 28862138  T
651 nnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaac 748  Q
          ||  |||||||| || ||| ||||||||||||  ||||||||||||||||||| |||||||||||||||||  |||||||||||||||||||||    
28862139 aaaaaatttcatttcaaaaatcttt-tgtcaaaatctttgttccaaatcattgctgatcgattgctaggacgtttctacacacaatatgcatcaaagaac 28862237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 661 - 750
Target Start/End: Original strand, 45471618 - 45471708
Alignment:
661 atttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacag 750  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||  ||||||||||||||||| |||||    
45471618 atttcaaa-atttttgtgtcaaaatcttgcttccaaatcattgctgatcgattgctaggacgtttctacacacaatatgcatcaaataacag 45471708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 672 - 749
Target Start/End: Complemental strand, 36361240 - 36361161
Alignment:
672 ttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttcta--cacaatatgcatcaaagaaca 749  Q
    |||||||||||||||||| |||||| |||||||||||| ||||||||||||||||||  |||||||||||||||||||||    
36361240 ttttgtgtcaaaatcttggttccaactcattgctgatcgattgctaggacgtttctacacacaatatgcatcaaagaaca 36361161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 546 - 615
Target Start/End: Original strand, 45471521 - 45471590
Alignment:
546 gcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatc 615  Q
    ||||| |||||||||||||| ||||| |||||||||| |||||||||||||||||||||||||| |||||    
45471521 gcggtcgttaactgccgttggttttttcctcccaaaaccagaaaacccctacctctcctattcattcatc 45471590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 661 - 721
Target Start/End: Original strand, 7403066 - 7403125
Alignment:
661 atttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggac 721  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||    
7403066 atttcaaatatttttgtgtcaaaatcttg-ttccaaatcattgctgatcgattgctaggac 7403125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 48; E-Value: 5e-18
Query Start/End: Original strand, 674 - 750
Target Start/End: Complemental strand, 18888457 - 18888379
Alignment:
674 ttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacag 750  Q
    |||||||||||||||| ||||||||||||||||||| |||||||||| || |||  ||||||||||||||||| |||||    
18888457 ttgtgtcaaaatcttggttccaaatcattgctgatcgattgctaggaggtctctacacacaatatgcatcaaaaaacag 18888379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 546 - 634
Target Start/End: Complemental strand, 18888574 - 18888488
Alignment:
546 gcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattacc 634  Q
    ||||| |||||||||||||||||||| ||  |||||| ||||||| | |||||||  ||||||||||||| ||||||||||||||||||    
18888574 gcggtagttaactgccgttgctttttcccctccaaaaccagaaaagctctacctc--ctattcactcatcaccttacctcaccattacc 18888488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 453 - 533
Target Start/End: Original strand, 13706113 - 13706193
Alignment:
453 ttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgc 533  Q
    |||||||||||||||||||||||||||||||   ||||||||||||||| |||||||| | |  ||| |||||||||||||    
13706113 ttcctattgacacaagtaatttactaaaaagcccccaacggtagttaactaccgttgggaaaaccgccgacagttaactgc 13706193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 456 - 569
Target Start/End: Original strand, 49259894 - 49260007
Alignment:
456 ctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggttgtta 555  Q
    |||||| ||||| |||||||| ||||||  |||| ||| |||||||||||||| ||  |||||| |||||||||||||| ||||   || ||||||||||    
49259894 ctattggcacaaataatttaccaaaaagcctccagcggcagttaacaaccgttagaccatgcgccgacagttaactgccgctggctttcagcggttgtta 49259993  T
556 actgccgttgcttt 569  Q
    || | |||||||||    
49259994 accgtcgttgcttt 49260007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 677 - 750
Target Start/End: Complemental strand, 36791379 - 36791305
Alignment:
677 tgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacag 750  Q
    ||||||||||||| |||||||||||||| |||  |||||||||| |||| |  ||||||||||||||||| |||||    
36791379 tgtcaaaatcttggttccaaatcattgc-gattgattgctaggatgtttttacacacaatatgcatcaaaaaacag 36791305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 451 - 510
Target Start/End: Complemental strand, 15292836 - 15292777
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttgg 510  Q
    ||||| |||||||||||||||||||| ||||||  |||| || |||||||| ||||||||    
15292836 acttcttattgacacaagtaatttaccaaaaagcctccagcgatagttaactaccgttgg 15292777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 451 - 510
Target Start/End: Complemental strand, 42058698 - 42058639
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttgg 510  Q
    |||| ||||||||| ||||||||||| |||||| |||||  |||||||||| ||||||||    
42058698 acttgctattgacataagtaatttaccaaaaagcttccagtggtagttaactaccgttgg 42058639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 442 - 476
Target Start/End: Original strand, 48138670 - 48138704
Alignment:
442 acattggaaacttcctattgacacaagtaatttac 476  Q
    |||| ||||||||||||||||||||||||||||||    
48138670 acataggaaacttcctattgacacaagtaatttac 48138704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 442 - 475
Target Start/End: Complemental strand, 7407525 - 7407492
Alignment:
442 acattggaaacttcctattgacacaagtaattta 475  Q
    |||| |||||||||||||||||||||||||||||    
7407525 acataggaaacttcctattgacacaagtaattta 7407492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 117; Significance: 3e-59; HSPs: 9)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 117; E-Value: 3e-59
Query Start/End: Original strand, 442 - 749
Target Start/End: Original strand, 26701845 - 26702140
Alignment:
442 acattggaaacttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactggga 541  Q
    |||| ||||||||||||||||||||||||||||||||||||| | | |  |||||||||||| ||||||| ||||||| |  ||||||||| | ||||||    
26701845 acataggaaacttcctattgacacaagtaatttactaaaaagctccaagtggtagttaacaatcgttggatgatgcgccggaagttaactgtcgctggga 26701944  T
542 ctccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacctn 641  Q
    |||  || |||||||||||||||||||||| ||  |||||| |||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||     
26701945 ctcaacg-ttgttaactgccgttgcttttttccctccaaaaccagaaaacccctacctctcctattcactcatcaccttaccccaccattaccatacct- 26702042  T
642 nnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgca 739  Q
                   | | ||||||||     |||||||||||||||||||||||||||||||||||| ||||||| |||||||||  ||||||||||||    
26702043 --------aaaaaaatcccatttcaaa----attgtgtcaaaatcttgcttccaaatcattgctgatcgattgctaagacgtttctacacacaatatgca 26702130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 539 - 639
Target Start/End: Original strand, 44319976 - 44320075
Alignment:
539 ggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatac 638  Q
    |||||| |||||||||||||||||||||||||| || ||||||| |||||||||||||||||| ||||||| ||||| |||||| |||||| ||||||||    
44319976 ggactcagcggttgttaactgccgttgcttttttcc-cccaaaaccagaaaacccctacctcttctattcattcatcaccttacatcaccaataccatac 44320074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 491 - 750
Target Start/End: Original strand, 45115300 - 45115553
Alignment:
491 cggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaa 590  Q
    ||||||||||| |||||||| |||   || |||||||||||||| ||||||||| ||||| ||||||| ||||| |||||| || ||||||| |||||||    
45115300 cggtagttaactaccgttggtagaactgccgacagttaactgccgctgggactcagcggtagttaactaccgttccttttttccccccaaaaccagaaaa 45115399  T
591 cccctacctctcctattcactcatcgccttacctca---ccattaccatacctnnnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatct 687  Q
     |||||| ||  ||||||||||||| |||||| |||   |||| |||||||||                | | |||||||| ||||| ||||||||||||    
45115400 gccctacttc--ctattcactcatcaccttacatcatctccat-accatacctaaaaaaaaa-------tcccatttcaaaaatttt-gtgtcaaaatct 45115488  T
688 tgcttccaaatcattgctgatctattgctaggacgtttctacac--aatatgcatcaaagaacag 750  Q
    || |||||| |||||||||||| |||||||||| ||||||||||  |||||||||||||||||||    
45115489 tggttccaactcattgctgatcgattgctaggatgtttctacacataatatgcatcaaagaacag 45115553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 451 - 561
Target Start/End: Original strand, 16583215 - 16583325
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggt 550  Q
    |||||||||||||||||||||||||||||||||   ||| ||||||||||| |||||||| | |  ||| ||||||||||||||  |||||||| |||||    
16583215 acttcctattgacacaagtaatttactaaaaagcccccagcggtagttaactaccgttgggaaaaccgccgacagttaactgccgttgggactcagcggt 16583314  T
551 tgttaactgcc 561  Q
    |||||||||||    
16583315 tgttaactgcc 16583325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 677 - 750
Target Start/End: Original strand, 44320107 - 44320182
Alignment:
677 tgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacag 750  Q
    ||||||||||||||||||||||||||| ||||  |||||||||||||||||  |||||||||||||||||||||||    
44320107 tgtcaaaatcttgcttccaaatcattggtgattgattgctaggacgtttctacacacaatatgcatcaaagaacag 44320182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 674 - 750
Target Start/End: Original strand, 5772996 - 5773074
Alignment:
674 ttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacag 750  Q
    |||||||||||||||| |||||| |||||||||||| |||||||||||||||||  |||||||||||| ||||||||||    
5772996 ttgtgtcaaaatcttggttccaactcattgctgatcgattgctaggacgtttctacacacaatatgcaacaaagaacag 5773074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 41; E-Value: 0.00000000000007
Query Start/End: Original strand, 453 - 569
Target Start/End: Original strand, 38032173 - 38032289
Alignment:
453 ttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggttg 552  Q
    |||||||||||||||||||||||| ||||||   ||| ||| |||||||||||||| |   |||||| |||||||||||||| |||     | |||||||    
38032173 ttcctattgacacaagtaatttaccaaaaagcccccagcggcagttaacaaccgttaggctatgcgccgacagttaactgccgctgacttccagcggttg 38032272  T
553 ttaactgccgttgcttt 569  Q
    ||||||| |||||||||    
38032273 ttaactgtcgttgcttt 38032289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 451 - 501
Target Start/End: Complemental strand, 14737703 - 14737653
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaac 501  Q
    |||||||||||||||||||||||||| ||||||  ||||  ||||||||||    
14737703 acttcctattgacacaagtaatttacaaaaaagcctccagtggtagttaac 14737653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 442 - 476
Target Start/End: Complemental strand, 26702945 - 26702911
Alignment:
442 acattggaaacttcctattgacacaagtaatttac 476  Q
    |||| ||||||||||||||||||||||||||||||    
26702945 acataggaaacttcctattgacacaagtaatttac 26702911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 115; Significance: 5e-58; HSPs: 18)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 115; E-Value: 5e-58
Query Start/End: Original strand, 442 - 750
Target Start/End: Original strand, 32715285 - 32715585
Alignment:
442 acattggaaacttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactggga 541  Q
    |||| ||||||||||||||||||||| |||||||||||||||  |||| ||||||||||| ||||||||||||  ||  | |||||||||||   |||||    
32715285 acataggaaacttcctattgacacaaataatttactaaaaagcctccagcggtagttaactaccgttggaagaaccgtcggcagttaactgctgatggga 32715384  T
542 ctccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacctn 641  Q
    ||| |||||||||||||| ||||||||||| || || |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||     
32715385 ctcagcggttgttaactgtcgttgcttttttcccccaaaaaccagaaaacccccacctctcctattcactcatcaccttacctcaccattaccatacct- 32715483  T
642 nnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttctacac--aatatgca 739  Q
                   | | | ||||| | ||||| | ||||||| |||||| |||||||||||||||| |||||||||||||||||||||  ||||||||    
32715484 --------aaaaaaatcccacttcaattttttttct-tcaaaattttgctttcaaatcattgctgatcgattgctaggacgtttctacacataatatgca 32715574  T
740 tcaaagaacag 750  Q
    |||||||||||    
32715575 tcaaagaacag 32715585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 88; E-Value: 7e-42
Query Start/End: Original strand, 525 - 749
Target Start/End: Original strand, 17915259 - 17915474
Alignment:
525 gttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacct 624  Q
    ||||||| || ||||||||| |||||||||||| ||||||||||||| || |||||||  ||||||||||||||||||||||||||||||| ||||||||    
17915259 gttaactaccgctgggactcggcggttgttaacagccgttgcttttttccccccaaaacgagaaaacccctacctctcctattcactcatcaccttacct 17915358  T
625 caccattaccatacctnnnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtt 724  Q
    || ||| |||||||||                | | |||||||  | |||||||||||||||||||||| ||||||||||||||| ||||||||||||||    
17915359 catcatcaccatacct---------aaaaaaatcccatttcaa--aattttgtgtcaaaatcttgcttctaaatcattgctgatcgattgctaggacgtt 17915447  T
725 tct--acacaatatgcatcaaagaaca 749  Q
    |||  ||||||||||||||||||||||    
17915448 tctacacacaatatgcatcaaagaaca 17915474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 78; E-Value: 6e-36
Query Start/End: Original strand, 552 - 750
Target Start/End: Complemental strand, 46518295 - 46518103
Alignment:
552 gttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacctnnnnnnnnnnn 651  Q
    |||||||| ||||||||||| || ||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||               
46518295 gttaactgtcgttgctttttcccccccaaaaccagaaaacccctacctctcctattcactcatcaccttacctcaccatcaccatacct---------aa 46518205  T
652 nnnnnttcaatttc-aaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaac 748  Q
         | | ||||| |||| ||||||||||||| ||||||||||||||||||| ||||  |||||||||||||||||  |||||||||||||||||||||    
46518204 aaaaatcccatttcaaaatttttttgtgtcaaattcttgcttccaaatcattgatgattgattgctaggacgtttctacacacaatatgcatcaaagaac 46518105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 61; E-Value: 9e-26
Query Start/End: Original strand, 672 - 749
Target Start/End: Original strand, 18622741 - 18622820
Alignment:
672 ttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaaca 749  Q
    ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||  ||||||||||||||||||||||    
18622741 ttttgtgtcaaaatcttgctttcaaatcattgctgatcgattgctaggacgtttctacacacaatatgcatcaaagaaca 18622820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 60; E-Value: 3e-25
Query Start/End: Original strand, 585 - 752
Target Start/End: Original strand, 1589991 - 1590150
Alignment:
585 agaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacctnnnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaa 684  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||| |||||||                 ||| ||||||| ||||  |||||||||    
1589991 agaaaacccctacctctcctattcactcatcaccttacctcaccattatcatacctaaaaaaaatc-------tca-tttcaaaaattt--gtgtcaaaa 1590080  T
685 tcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacagat 752  Q
    |||||| |||||||||||||||||| ||||||||||||||| |  |||||||||||||||||||||||||    
1590081 tcttgcatccaaatcattgctgatcgattgctaggacgtttttacacacaatatgcatcaaagaacagat 1590150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 451 - 558
Target Start/End: Original strand, 17915158 - 17915265
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggt 550  Q
    ||||| ||||||||||||||||||| |||||||   ||| ||||||||||| |||||||||| |  ||| |||||||||||||| ||||||||| |||||    
17915158 acttcttattgacacaagtaatttattaaaaagcccccagcggtagttaactaccgttggaaaaatcgccgacagttaactgccgctgggactcggcggt 17915257  T
551 tgttaact 558  Q
    ||||||||    
17915258 tgttaact 17915265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 451 - 564
Target Start/End: Complemental strand, 12028410 - 12028298
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggt 550  Q
    ||||||||||||||||| ||||||||||||||||  ||| ||||||||| | ||||||||||||  ||| |||||||||||||   | |||| | |||||    
12028410 acttcctattgacacaaataatttactaaaaagtccccagcggtagttacctaccgttggaagaaccgccgacagttaactgctgat-ggacccagcggt 12028312  T
551 tgttaactgccgtt 564  Q
    ||||||||||||||    
12028311 tgttaactgccgtt 12028298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 451 - 532
Target Start/End: Complemental strand, 46518369 - 46518288
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactg 532  Q
    ||||||||||||||||||||||||||||||||| | | | |||||||||||  |||||||||||  ||||| ||||||||||    
46518369 acttcctattgacacaagtaatttactaaaaagctccaagcggtagttaactcccgttggaagaaccgctggcagttaactg 46518288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 552 - 636
Target Start/End: Original strand, 35430596 - 35430680
Alignment:
552 gttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccat 636  Q
    |||||||||||||| |||||  | | ||||| |||||||||||||||||||||||||| ||||| |||||| |||||| ||||||    
35430596 gttaactgccgttggtttttttccctcaaaaccagaaaacccctacctctcctattcattcatcaccttacatcaccaataccat 35430680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 585 - 640
Target Start/End: Original strand, 18622665 - 18622720
Alignment:
585 agaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacct 640  Q
    ||||||||||||||||||||||||||| | | ||||||||||||||||||||||||    
18622665 agaaaacccctacctctcctattcacttaccaccttacctcaccattaccatacct 18622720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 43; E-Value: 0.000000000000005
Query Start/End: Original strand, 451 - 569
Target Start/End: Original strand, 51026014 - 51026132
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggt 550  Q
    |||||||||||||||||||||||||  ||||||  |||| ||| |||||||||||||| ||  |||||| | |||||||||||| || |    |  ||||    
51026014 acttcctattgacacaagtaatttatcaaaaagcctccagcggcagttaacaaccgttagaccatgcgccggcagttaactgccgctagcttccaacggt 51026113  T
551 tgttaactgccgttgcttt 569  Q
    |||||||||||||||||||    
51026114 tgttaactgccgttgcttt 51026132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 677 - 750
Target Start/End: Original strand, 17482905 - 17482980
Alignment:
677 tgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacag 750  Q
    ||||||||||||| ||||||||||||  ||||| |||||||| || |||||  ||||||||||||||||| |||||    
17482905 tgtcaaaatcttggttccaaatcatttttgatcaattgctagcacatttctacacacaatatgcatcaaaaaacag 17482980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 567 - 630
Target Start/End: Complemental strand, 17496151 - 17496090
Alignment:
567 tttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccat 630  Q
    ||||| ||||||||||||||||||||||||  |  |||||||||||||| ||||||||||||||    
17496151 ttttttcctcccaaaatcagaaaaccccta--tgccctattcactcatcaccttacctcaccat 17496090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 677 - 732
Target Start/End: Complemental strand, 17496053 - 17495998
Alignment:
677 tgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttctacaca 732  Q
    ||||||||||||| |||||||| |||| ||||| ||||||||||| ||||||||||    
17496053 tgtcaaaatcttggttccaaataattgttgatcgattgctaggacatttctacaca 17495998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 451 - 509
Target Start/End: Original strand, 20854994 - 20855052
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttg 509  Q
    |||| |||||||||||||||||||||||||||| | ||| ||||||||||  |||||||    
20854994 actttctattgacacaagtaatttactaaaaagctcccagcggtagttaattaccgttg 20855052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.00000002
Query Start/End: Original strand, 451 - 510
Target Start/End: Complemental strand, 46356146 - 46356087
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttgg 510  Q
    ||||| |||||||| |||||||||||||||| |  |||||| ||||||||| ||||||||    
46356146 acttcttattgacataagtaatttactaaaaggcatccaacagtagttaactaccgttgg 46356087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 451 - 509
Target Start/End: Complemental strand, 20855813 - 20855755
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttg 509  Q
    ||||||||||| ||||||||||||| |||||||  | || ||||||||||| |||||||    
20855813 acttcctattggcacaagtaatttattaaaaagccttcagcggtagttaactaccgttg 20855755  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000003
Query Start/End: Original strand, 562 - 634
Target Start/End: Complemental strand, 4417391 - 4417321
Alignment:
562 gttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattacc 634  Q
    ||||||||||  | |||||||||||||||  | |||   ||||||||||||||| ||||||||||||||||||    
4417391 gttgctttttttcccccaaaatcagaaaagtcatac--atcctattcactcatcaccttacctcaccattacc 4417321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 110; Significance: 5e-55; HSPs: 11)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 110; E-Value: 5e-55
Query Start/End: Original strand, 442 - 749
Target Start/End: Complemental strand, 9640320 - 9640021
Alignment:
442 acattggaaacttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactggga 541  Q
    ||||||||||||||| |||||| ||| |||||||||||||||   ||| ||||| ||||||| |||||||||||| || | |||||||||||| ||||||    
9640320 acattggaaacttcc-attgacgcaaataatttactaaaaagcccccagcggtaattaacaatcgttggaagatgtgccggcagttaactgccgctggga 9640222  T
542 ctccgcggttgttaactgccgttgctttttgcctc--ccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacc 639  Q
    | | |||||||||||||||||||||||||| || |    ||||  |||||||||||||||||| |||||||| |||  ||||||||||||||||||||||    
9640221 cccagcggttgttaactgccgttgctttttcccccaaaaaaaactagaaaacccctacctctcttattcacttatcatcttacctcaccattaccatacc 9640122  T
640 tnnnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatg 737  Q
    |                ||||||||||||||  |||||||||||||||||||| |||||||||||||||| ||||||| |||||||||  ||||||||||    
9640121 t---------aaaaaaattcaatttcaaata--tttgtgtcaaaatcttgctttcaaatcattgctgatcgattgctaagacgtttctacacacaatatg 9640033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 110; E-Value: 5e-55
Query Start/End: Original strand, 494 - 752
Target Start/End: Original strand, 13329812 - 13330061
Alignment:
494 tagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaaccc 593  Q
    |||||||| ||||||| ||||  ||| | |||||||||||  |||||||||  |||||||||||| ||||||||||||   |||||||| ||||||||||    
13329812 tagttaactaccgttgaaagaaccgccggcagttaactgctgctgggactcaacggttgttaactaccgttgctttttt--tcccaaaaccagaaaaccc 13329909  T
594 ctacctctcctattcactcatcgccttacctcaccattaccatacctnnnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttc 693  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||                ||| ||||||||  |||||||||||||||||||||||    
13329910 ctacctctcctattcactcatcaccttacctcaccattaccatacct---------aaaaaaattctatttcaaaattttttgtgtcaaaatcttgcttc 13330000  T
694 caaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacagat 752  Q
    || ||||||||||||| |||||||||||||||||  |||||||||||||||||||||||||    
13330001 catatcattgctgatcgattgctaggacgtttctacacacaatatgcatcaaagaacagat 13330061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 95; E-Value: 4e-46
Query Start/End: Original strand, 523 - 750
Target Start/End: Complemental strand, 22712170 - 22711949
Alignment:
523 cagttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttac 622  Q
    ||||||| |||| || |||||| ||||||||||||| |||||||||||| ||  |||||| |||||||||||||||||||||||||||||||| ||||||    
22712170 cagttaattgccgctaggactcagcggttgttaactaccgttgcttttttccctccaaaaccagaaaacccctacctctcctattcactcatcaccttac 22712071  T
623 ctcaccattaccatacctnnnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacg 722  Q
    |||| |||||||||||||                 || ||||||||  ||||||||||||| ||||||||||||||||||||||||| ||||||||||||    
22712070 ctcatcattaccatacctaaaaaaaatc-------tc-atttcaaaattttttgtgtcaaagtcttgcttccaaatcattgctgatcgattgctaggacg 22711979  T
723 tttct--acacaatatgcatcaaagaacag 750  Q
    |||||  |||||||||||||||||||||||    
22711978 tttctacacacaatatgcatcaaagaacag 22711949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 451 - 565
Target Start/End: Complemental strand, 2121344 - 2121231
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggt 550  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| ||||||||| | |||||||||||| || |||| |  ||||    
2121344 acttcctattgacacaagtaatttactaaaaagtctccaacggtagttaactaccgttgaaagatgcgccggcagttaactgccgct-ggacccaacggt 2121246  T
551 tgttaactgccgttg 565  Q
    ||||||||| |||||    
2121245 tgttaactgtcgttg 2121231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 670 - 749
Target Start/End: Complemental strand, 31434903 - 31434822
Alignment:
670 atttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttcta--cacaatatgcatcaaagaaca 749  Q
    |||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||  |||||||||||||||||||||    
31434903 atttttgtgtcaaaatcttgcttccaaatcattgctgatcgattactaggacgtttctacacacaatatgcatcaaagaaca 31434822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 677 - 750
Target Start/End: Complemental strand, 31204024 - 31203949
Alignment:
677 tgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttcta--cacaatatgcatcaaagaacag 750  Q
    ||||||||||||| ||||||||||||| ||||| |||| |||||||||||||  ||||||||||||||||||||||    
31204024 tgtcaaaatcttggttccaaatcattgttgatcaattgataggacgtttctacacacaatatgcatcaaagaacag 31203949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 677 - 750
Target Start/End: Complemental strand, 31184302 - 31184227
Alignment:
677 tgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttcta--cacaatatgcatcaaagaacag 750  Q
    ||||||||||||| ||||||||||||| ||||| |||| |||||||||||||  ||||||||| ||||||||||||    
31184302 tgtcaaaatcttggttccaaatcattgttgatcaattgataggacgtttctacacacaatatggatcaaagaacag 31184227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 552 - 635
Target Start/End: Complemental strand, 31435010 - 31434927
Alignment:
552 gttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattacca 635  Q
    |||||||| ||||| ||||| || ||||||| |||||||||||||| ||||||||||| ||||| |||||| |||||| |||||    
31435010 gttaactgtcgttggtttttcccccccaaaaccagaaaacccctacatctcctattcattcatcaccttacatcaccaatacca 31434927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 451 - 569
Target Start/End: Original strand, 34519926 - 34520044
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggt 550  Q
    |||||||||||||||||||||||||| ||||||   ||||||| | |||||||||||| |   ||||||   |||||||||||| ||||    | ||||     
34519926 acttcctattgacacaagtaatttaccaaaaagcccccaacggcaattaacaaccgttaggccatgcgccatcagttaactgccgctggcttccagcggg 34520025  T
551 tgttaactgccgttgcttt 569  Q
    |||||||||||||||||||    
34520026 tgttaactgccgttgcttt 34520044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.0000000003
Query Start/End: Original strand, 451 - 569
Target Start/End: Original strand, 10358757 - 10358875
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggt 550  Q
    |||||||||| ||| ||||||||||| ||||||  ||| ||||||||||||||||||| |   |||| | |||||||||||| | ||||    | ||| |    
10358757 acttcctattaacataagtaatttaccaaaaagcctccgacggtagttaacaaccgttaggccatgcaccgacagttaactgtcgctggcttccagcgat 10358856  T
551 tgttaactgccgttgcttt 569  Q
    ||||||||| |||||||||    
10358857 tgttaactgtcgttgcttt 10358875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 451 - 508
Target Start/End: Original strand, 17112329 - 17112386
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgtt 508  Q
    |||||||||||||||||||||||||| ||||||   ||| ||| ||||||||||||||    
17112329 acttcctattgacacaagtaatttaccaaaaagcccccagcggcagttaacaaccgtt 17112386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 83; Significance: 6e-39; HSPs: 17)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 6e-39
Query Start/End: Original strand, 491 - 750
Target Start/End: Complemental strand, 4121803 - 4121553
Alignment:
491 cggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaa 590  Q
    ||||||||||| ||||||||||||  ||| ||||  ||||| ||  | |||||| |||||||||||||| ||||||||||| || ||||||| |||||||    
4121803 cggtagttaactaccgttggaagaaccgccgacacgtaactacc-gttggactcagcggttgttaactgacgttgcttttt-ccccccaaaaccagaaaa 4121706  T
591 cccctacctctcctattcactcatcgccttacctcaccattaccatacctnnnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgc 690  Q
     ||||||||||| |||||||||||| ||||||||||||| |||||||||                 | | ||||||||| |||||  |||||||||||||    
4121705 tccctacctctcttattcactcatcaccttacctcaccaataccatacc---------caaaaaaatcccatttcaaattttttttggtcaaaatcttgc 4121615  T
691 ttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacag 750  Q
    ||||||||||||| ||||| |||||||||||||||||  |||||||||||||||||||||||    
4121614 ttccaaatcattgttgatcgattgctaggacgtttctacacacaatatgcatcaaagaacag 4121553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 503 - 639
Target Start/End: Complemental strand, 51549518 - 51549384
Alignment:
503 accgttggaagatgcgctgacagttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctc 602  Q
    ||||||||||||  ||| | |||||||||||| |||| |||| |||||||||||||||||||||||||| || ||||||| ||||||| |||||||||||    
51549518 accgttggaagaaccgccggcagttaactgccgctgg-actcagcggttgttaactgccgttgctttttccc-cccaaaaccagaaaatccctacctctc 51549421  T
603 ctattcactcatcgccttacctcaccattaccatacc 639  Q
    ||||||||||||| ||||||||||||| |||||||||    
51549420 ctattcactcatcaccttacctcaccaataccatacc 51549384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 546 - 749
Target Start/End: Original strand, 12486171 - 12486367
Alignment:
546 gcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacctnnnnn 645  Q
    ||||| |||||||| ||||| |||||  | ||||||| |||||||||||||||||||||||||| ||||| |||||| |||||| |||||||||          
12486171 gcggtcgttaactgtcgttggtttttttcccccaaaaccagaaaacccctacctctcctattcattcatcaccttacatcaccaataccatacccaaaaa 12486270  T
646 nnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaa 743  Q
                || |||||||| |||||||||||||||||||||||||||||||||| ||||| |||| ||| | ||||||  ||||||||||||||||    
12486271 aatc--------tccatttcaaa-atttttgtgtcaaaatcttgcttccaaatcattgttgatcgattgttagcatgtttctacacacaatatgcatcaa 12486361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 442 - 630
Target Start/End: Complemental strand, 40469282 - 40469099
Alignment:
442 acattggaaacttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactggga 541  Q
    |||||| | ||||||||||||||||| |||||||||||||||  |||| | ||||||||| |||||||| | |  ||| | |||||||||| | ||||||    
40469282 acattgaatacttcctattgacacaaataatttactaaaaagcatccagcagtagttaactaccgttgggaaaaccgccggcagttaactgtcgctggga 40469183  T
542 ctccgcggttgttaactgccgttgctttttgcct-cccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccat 630  Q
    ||| |||| ||||||||| | ||||||    ||| ||||||| ||||||| ||||||  |||||||||||| ||| ||||||||||||||    
40469182 ctcagcgggtgttaactgtcattgctt----cctccccaaaaccagaaaagccctac--ctcctattcactgatcaccttacctcaccat 40469099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 56; E-Value: 8e-23
Query Start/End: Original strand, 546 - 749
Target Start/End: Complemental strand, 2286016 - 2285820
Alignment:
546 gcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacctnnnnn 645  Q
    ||||| |||||||||| ||| ||||| || ||||||| |||||||||||||||||||||||||| ||||| |||||| |||||| ||| |||||          
2286016 gcggtcgttaactgcccttggttttttccccccaaaaccagaaaacccctacctctcctattcattcatcaccttacatcaccaatacgatacccaaaaa 2285917  T
646 nnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttcta--cacaatatgcatcaa 743  Q
                 | |||||||| |||||||| |||||||||||||||||||||||||||| || |||| || ||||||||||  |||||||||||||||    
2285916 aatcc--------ccatttcaaa-atttttgtatcaaaatcttgcttccaaatcattgctggtcgattgttatgacgtttctacacacaatatgcatcaa 2285826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 489 - 600
Target Start/End: Original strand, 8262785 - 8262896
Alignment:
489 aacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaa 588  Q
    ||||||||||||| | |||||| | |  ||| |||||||||||||| ||| ||||| |||||||||||||||||||||||||| || ||||||| |||||    
8262785 aacggtagttaactatcgttggtataaccgccgacagttaactgccgctgtgactcagcggttgttaactgccgttgctttttcccccccaaaaccagaa 8262884  T
589 aacccctacctc 600  Q
    || || ||||||    
8262885 aagccatacctc 8262896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 677 - 749
Target Start/End: Complemental strand, 40469061 - 40468987
Alignment:
677 tgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttcta--cacaatatgcatcaaagaaca 749  Q
    ||||||||||||  ||||||||||||||||||| ||||||||||||||||||  |||||||||||||||||||||    
40469061 tgtcaaaatcttcgttccaaatcattgctgatcgattgctaggacgtttctacacacaatatgcatcaaagaaca 40468987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 674 - 749
Target Start/End: Complemental strand, 29774687 - 29774610
Alignment:
674 ttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttc--tacacaatatgcatcaaagaaca 749  Q
    |||||||||||||||| ||||||||||||| ||||  ||||||||||||||||   ||||||||||||||||||||||    
29774687 ttgtgtcaaaatcttggttccaaatcattgttgattgattgctaggacgtttccacacacaatatgcatcaaagaaca 29774610  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 47; E-Value: 2e-17
Query Start/End: Original strand, 674 - 749
Target Start/End: Original strand, 32425882 - 32425959
Alignment:
674 ttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaaca 749  Q
    |||||| ||||||||| |||||| |||||| ||||| |||||||||||||||||  ||||||||||||||||||||||    
32425882 ttgtgtaaaaatcttggttccaactcattgttgatcgattgctaggacgtttctacacacaatatgcatcaaagaaca 32425959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 677 - 749
Target Start/End: Original strand, 8262951 - 8263025
Alignment:
677 tgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttcta--cacaatatgcatcaaagaaca 749  Q
    ||||||||||||  || |||||||||||||||| ||||||||||||||||||  |||||||||||||||| ||||    
8262951 tgtcaaaatctttgtttcaaatcattgctgatcgattgctaggacgtttctacgcacaatatgcatcaaataaca 8263025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 40; E-Value: 0.0000000000003
Query Start/End: Original strand, 552 - 634
Target Start/End: Complemental strand, 29774798 - 29774718
Alignment:
552 gttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattacc 634  Q
    ||||| ||||| |||| |||||| |||||||  || |||||||||||||  ||||||||||||| ||||||||||||||||||    
29774798 gttaaatgccgctgctctttgccccccaaaactagtaaacccctacctc--ctattcactcatcaccttacctcaccattacc 29774718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 682 - 732
Target Start/End: Complemental strand, 1276250 - 1276200
Alignment:
682 aaatcttgcttccaaatcattgctgatctattgctaggacgtttctacaca 732  Q
    |||||||| ||||||||||||| ||||| ||||||||||||||||||||||    
1276250 aaatcttggttccaaatcattgttgatcgattgctaggacgtttctacaca 1276200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 547 - 630
Target Start/End: Complemental strand, 8786242 - 8786161
Alignment:
547 cggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccat 630  Q
    |||| ||||| || ||||||||||| || |||||||||| ||||||||||  ||  ||||||||||||| ||||||||||||||    
8786242 cggtagttaattgtcgttgcttttttccccccaaaatcaaaaaacccctaggtc--ctattcactcatcaccttacctcaccat 8786161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 451 - 534
Target Start/End: Original strand, 44809812 - 44809895
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgcc 534  Q
    ||||||||||||||||  ||||||| |||||||| | || ||||||||||| |||||||||| |  ||| | ||||||||||||    
44809812 acttcctattgacacagataatttattaaaaagtcttcagcggtagttaactaccgttggaaaaaccgccggcagttaactgcc 44809895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 661 - 705
Target Start/End: Complemental strand, 51549370 - 51549325
Alignment:
661 atttcaaatatttttgtgtcaaaatctt-gcttccaaatcattgct 705  Q
    ||||||||||||||| |||||||||||| |||||||||||||||||    
51549370 atttcaaatatttttttgtcaaaatcttagcttccaaatcattgct 51549325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 442 - 476
Target Start/End: Complemental strand, 33942792 - 33942758
Alignment:
442 acattggaaacttcctattgacacaagtaatttac 476  Q
    |||| ||||||||||||||||||||||||||||||    
33942792 acataggaaacttcctattgacacaagtaatttac 33942758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 31; E-Value: 0.00000007
Query Start/End: Original strand, 451 - 565
Target Start/End: Complemental strand, 50459665 - 50459551
Alignment:
451 acttcctattgacacaagtaatttactaaaaagtttccaacggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggt 550  Q
    |||||||||||||||||||||||||| ||| |||  ||| ||| |||||||||| ||| |   |||||  | ||||||||||||  |||    | |||||    
50459665 acttcctattgacacaagtaatttaccaaagagtccccagcggcagttaacaactgttaggccatgcgtcggcagttaactgccgttggcttccagcggt 50459566  T
551 tgttaactgccgttg 565  Q
    |||||||||||||||    
50459565 tgttaactgccgttg 50459551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 75; Significance: 4e-34; HSPs: 6)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 75; E-Value: 4e-34
Query Start/End: Original strand, 496 - 750
Target Start/End: Original strand, 29266905 - 29267152
Alignment:
496 gttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaacccct 595  Q
    |||||| |||| ||| |||||||  | |||||||||||| ||||  | | |||||||||||||| ||||| ||||| || ||||||| ||||||||||||    
29266905 gttaactaccgctggtagatgcgtcggcagttaactgccgctggagc-cagcggttgttaactgtcgttggttttttccccccaaaaccagaaaacccct 29267003  T
596 acctctcctattcactcatcgccttacctcaccattaccatacctnnnnnnnnnnnnnnnnttcaatttcaaatatttttgtgtcaaaatcttgcttcca 695  Q
    |||||||||||||| ||||| |||||| |||||| |||||||||                   | |||||||| ||||| ||||||||||||||||||||    
29267004 acctctcctattcattcatcaccttacatcaccaataccatacccaaaaaaaatcc-------ccatttcaaaaatttt-gtgtcaaaatcttgcttcca 29267095  T
696 aatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacag 750  Q
    |||||||||| ||| |||||||||||||||||  |||||||||||||||||||||||    
29267096 aatcattgctcatcgattgctaggacgtttctacacacaatatgcatcaaagaacag 29267152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 55; E-Value: 3e-22
Query Start/End: Original strand, 671 - 750
Target Start/End: Complemental strand, 29232018 - 29231937
Alignment:
671 tttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttcta--cacaatatgcatcaaagaacag 750  Q
    ||||| ||||||||||||||||||||||||||||||||| ||||||| ||||||||||  |||||||||||||||| |||||    
29232018 tttttttgtcaaaatcttgcttccaaatcattgctgatcgattgctatgacgtttctacacacaatatgcatcaaataacag 29231937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 53; E-Value: 5e-21
Query Start/End: Original strand, 673 - 750
Target Start/End: Original strand, 9094456 - 9094535
Alignment:
673 tttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacag 750  Q
    |||||| |||||||||||||||||||||||| ||||| |||||||||||||| ||  |||||||||||||||||||||||    
9094456 tttgtgccaaaatcttgcttccaaatcattgttgatcgattgctaggacgttccttcacacaatatgcatcaaagaacag 9094535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 46; E-Value: 8e-17
Query Start/End: Original strand, 552 - 621
Target Start/End: Original strand, 9094345 - 9094413
Alignment:
552 gttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgcctta 621  Q
    |||||||||||||| ||||| || ||||||||||||||| |||||||||||||||||||||||| |||||    
9094345 gttaactgccgttggttttttcc-cccaaaatcagaaaatccctacctctcctattcactcatcacctta 9094413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 552 - 639
Target Start/End: Complemental strand, 29232130 - 29232044
Alignment:
552 gttaactgccgttgctttttgcctcccaaaatcagaaaacccctacctctcctattcactcatcgccttacctcaccattaccatacc 639  Q
    |||||||||||||| ||||| || || |||| |||||||||||||||||||||||||| ||||| ||||||  ||||| |||||||||    
29232130 gttaactgccgttggtttttccc-ccaaaaaccagaaaacccctacctctcctattcattcatcaccttacaccaccaataccatacc 29232044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000005
Query Start/End: Original strand, 677 - 747
Target Start/End: Original strand, 31858694 - 31858766
Alignment:
677 tgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaa 747  Q
    ||||||||||||| ||||||||||||| |||||  ||| |||||||||| |  ||||||||||||||||||||    
31858694 tgtcaaaatcttggttccaaatcattgttgatcggttgttaggacgtttgtacacacaatatgcatcaaagaa 31858766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0325 (Bit Score: 54; Significance: 1e-21; HSPs: 2)
Name: scaffold0325
Description:

Target: scaffold0325; HSP #1
Raw Score: 54; E-Value: 1e-21
Query Start/End: Original strand, 672 - 750
Target Start/End: Original strand, 3048 - 3128
Alignment:
672 ttttgtgtcaaaatcttgcttccaaatcattgctgatctattgctaggacgtttct--acacaatatgcatcaaagaacag 750  Q
    |||||||||||||||||| |||||| |||||| ||||| |||||||||||||||||  |||||||||||||||||||||||    
3048 ttttgtgtcaaaatcttggttccaactcattgttgatcgattgctaggacgtttctacacacaatatgcatcaaagaacag 3128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0325; HSP #2
Raw Score: 36; E-Value: 0.00000000007
Query Start/End: Original strand, 491 - 621
Target Start/End: Original strand, 2878 - 3005
Alignment:
491 cggtagttaacaaccgttggaagatgcgctgacagttaactgccactgggactccgcggttgttaactgccgttgctttttgcctcccaaaatcagaaaa 590  Q
    ||||||||||| |||||||| |||  ||  |||||||||| ||| ||||| ||| ||||| ||||||||  ||| |||||| || || |||| |||||||    
2878 cggtagttaactaccgttggtagaaccggcgacagttaacagccgctggggctcagcggtagttaactgttgttccttttt-ccccctaaaaccagaaaa 2976  T
591 cccctacctctcctattcactcatcgcctta 621  Q
     ||||||  |||||||||||||||| |||||    
2977 gccctac--ctcctattcactcatcacctta 3005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175882 times since January 2019
Visitors: 1577