View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: R108-tnk65-8 (Length: 1016)

Name: R108-tnk65-8
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] R108-tnk65-8
R108-tnk65-8
[»] chr6 (3 HSPs)
chr6 (3-1016)||(33934609-33935623)
chr6 (57-177)||(33934544-33934663)
chr6 (635-665)||(31592767-31592797)
[»] chr2 (1 HSPs)
chr2 (632-665)||(14297991-14298024)


Alignment Details
Target: chr6 (Bit Score: 941; Significance: 0; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 941; E-Value: 0
Query Start/End: Original strand, 3 - 1016
Target Start/End: Original strand, 33934609 - 33935623
Alignment:
3 tcggactgcagagtgattgtagtttctttattatcattagtgaaaatttgaatttgtgtaaacttatgtagagaaacatgcgatgtttggtactgaagtt 102  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
33934609 tcggactgcagagtgattgtagtttctttattatcattagtgaaaatttgaatttgtgtaaacttatgtagagaaacatgcgatgtttggtaatgaagtt 33934708  T
103 tggtcaatatatctatatctcggactgcagagtgattgtagtgtttctttttatcattagtgaaaattagaatttacgatacacaacttatatttaaata 202  Q
    |||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
33934709 tggtcaatatgtctatatctcggactgcagagtgattatagtgtttctttttatcattagtgaaaattagaatttacgatatacaacttatatttaaata 33934808  T
203 tcacgatgcaaattaaacactgcttgtgaataactacgactaatagttaacaataatattgactttaggtagggcactccatgtagtcgaactctaggta 302  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33934809 tcacgatgcaaattaaacactgcttgtgaataactacgactaatagttaacaataatattgactttaggtagggcactccatgtagtcgaactctaggta 33934908  T
303 gggcacccttgtggtgattattggaaaaaattaaagtctcacatagaaaagacacgagtctaatagtgagagatattgaccatattataaactggttttt 402  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33934909 gggcacccttgtggtgattattggaaaaaattaaagtcccacatagaaaagacacgagtctaatagtgagagatattgaccatattataaactggttttt 33935008  T
403 gtaaggatgagtttacaacaataattttgatcgatcattttatactaagacactattgtttttagttttctacttgttagaatagcagccacacttcaaa 502  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33935009 gtaaggatgagtttacaataataattttgatcgatcattttatactaagacactattgtttttagttttctacttgttagaatagcagccacacttcaaa 33935108  T
503 agaataaatacatgagaaacgtaaacaatgaacacccgatgtttggtactggtaacgaggttcggcctgttgtgcctacacctccgattatagagtgaca 602  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||    
33935109 agaataaatacatgagaaacgtaaacaatgaacacccgatgtttggtactggtaacgaggttcggcttgttgtgcctacacctccgattacagagtgaca 33935208  T
603 acaatttctttataatatttcaaactttaagtttacaatatacaacttgtatttaaatac--tacattcgaacaacatgtccatttaccgggtaactatg 700  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||  ||| |||||||||||||||||||||||  |||||||||    
33935209 acaatttctttataatatttcaaactttaagtttgcaatatacaacttgtatttaaatactatacgttcgaacaacatgtccatttacc-agtaactatg 33935307  T
701 actcataaacaacaataccttaacacacccttttcattcactctttcccaactttctttgtcaatattccttaagtgttgccacctttgaattattctac 800  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33935308 actcataaacaacaatcccttaacacacccttttcattcactctttcccaactttctttgtcaatattccttaagtgttgccacctttgaattattctac 33935407  T
801 attttcccttcttttgatagaggaaattaagttattataaactacacatcctttgtgcagctgttaaaaaagactttttgaattctcataattttttcct 900  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33935408 attttcccttcttttgatagaagaaattaagttattataaactacacatcctttgtgcagctgttaaaaaagactttttgaattctcataattttttcct 33935507  T
901 tttgattctagctagggtaatattaatataggttggtgtgcactgcgctgtgttcaaccgttcatacacctttcaattgacctttttggccatgaaagct 1000  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33935508 tttgattctagctagggtaatattaatataggttcgtgtgcactgcgctgtgttcaaccgttcatacacctttcaattgacctttttggccatgaaagct 33935607  T
1001 gagtcctaaaagtgat 1016  Q
    ||||||||||||||||    
33935608 gagtcctaaaagtgat 33935623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 71; E-Value: 1e-31
Query Start/End: Original strand, 57 - 177
Target Start/End: Original strand, 33934544 - 33934663
Alignment:
57 tgtgtaaacttatgtagagaaacatgcgatgtttggtactgaagtttggtcaatatatctatatctcggactgcagagtgattgtagtgtttcttt-tta 155  Q
    ||||||||||| ||| ||||| ||||||||||||||||   ||||||||||||||| |||||||||||||||||||||||||||||  |||||||| |||    
33934544 tgtgtaaacttgtgtggagaaccatgcgatgtttggtaaccaagtttggtcaatatgtctatatctcggactgcagagtgattgta--gtttctttatta 33934641  T
156 tcattagtgaaaattagaattt 177  Q
    ||||||||||||||| ||||||    
33934642 tcattagtgaaaatttgaattt 33934663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000009
Query Start/End: Original strand, 635 - 665
Target Start/End: Complemental strand, 31592797 - 31592767
Alignment:
635 ttacaatatacaacttgtatttaaatactac 665  Q
    |||||||||||||||||||||||||||||||    
31592797 ttacaatatacaacttgtatttaaatactac 31592767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000004
Query Start/End: Original strand, 632 - 665
Target Start/End: Complemental strand, 14298024 - 14297991
Alignment:
632 agtttacaatatacaacttgtatttaaatactac 665  Q
    |||||||| |||||||||||||||||||||||||    
14298024 agtttacagtatacaacttgtatttaaatactac 14297991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 204484 times since January 2019
Visitors: 1518